ID: 1133099373

View in Genome Browser
Species Human (GRCh38)
Location 16:3469993-3470015
Sequence GGCCCCAGGGCAGCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 1, 2: 10, 3: 93, 4: 723}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133099373_1133099381 18 Left 1133099373 16:3469993-3470015 CCTGCTGGGGCTGCCCTGGGGCC 0: 1
1: 1
2: 10
3: 93
4: 723
Right 1133099381 16:3470034-3470056 GGTCCTTTGTCTCGTGTCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 66
1133099373_1133099380 17 Left 1133099373 16:3469993-3470015 CCTGCTGGGGCTGCCCTGGGGCC 0: 1
1: 1
2: 10
3: 93
4: 723
Right 1133099380 16:3470033-3470055 AGGTCCTTTGTCTCGTGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 91
1133099373_1133099384 23 Left 1133099373 16:3469993-3470015 CCTGCTGGGGCTGCCCTGGGGCC 0: 1
1: 1
2: 10
3: 93
4: 723
Right 1133099384 16:3470039-3470061 TTTGTCTCGTGTCAGGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 88
1133099373_1133099383 22 Left 1133099373 16:3469993-3470015 CCTGCTGGGGCTGCCCTGGGGCC 0: 1
1: 1
2: 10
3: 93
4: 723
Right 1133099383 16:3470038-3470060 CTTTGTCTCGTGTCAGGGGATGG 0: 1
1: 0
2: 0
3: 5
4: 108
1133099373_1133099379 16 Left 1133099373 16:3469993-3470015 CCTGCTGGGGCTGCCCTGGGGCC 0: 1
1: 1
2: 10
3: 93
4: 723
Right 1133099379 16:3470032-3470054 CAGGTCCTTTGTCTCGTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 100
1133099373_1133099377 -3 Left 1133099373 16:3469993-3470015 CCTGCTGGGGCTGCCCTGGGGCC 0: 1
1: 1
2: 10
3: 93
4: 723
Right 1133099377 16:3470013-3470035 GCCTGGAAAGTGCTTTAAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133099373 Original CRISPR GGCCCCAGGGCAGCCCCAGC AGG (reversed) Intronic
900122510 1:1054828-1054850 GGCCCACGGGCAGCTCCGGCAGG - Exonic
900130483 1:1085181-1085203 GGTCTCTGGGCAGCCCCACCTGG - Intronic
900143024 1:1146373-1146395 AGGCACAGGGCTGCCCCAGCAGG - Intergenic
900184729 1:1327745-1327767 GCCCCTAGGGCAGGTCCAGCAGG - Exonic
900210600 1:1454055-1454077 GGGCCCTGGGCAGACCCAGCTGG - Intronic
900216472 1:1484726-1484748 GGGCCCTGGGCAGACCCAGCTGG - Intronic
900223555 1:1522454-1522476 GGGCCCTGGACAGACCCAGCCGG - Intronic
900292605 1:1929852-1929874 GGCCCAAGGCCACCCCCATCGGG - Intronic
900365530 1:2310594-2310616 GGCCCCCGTGGAGGCCCAGCCGG - Intergenic
900392843 1:2441210-2441232 GCCCCCCTGGCAGCCCCTGCCGG + Intronic
900570644 1:3356648-3356670 TGCCCCAGAGCGGCCCCAGGAGG + Intronic
900578564 1:3396204-3396226 GCCCCCAGGACACCCCCAGCTGG + Intronic
900635485 1:3662815-3662837 GGCCCCAGGACAGACCTGGCTGG + Intronic
900658221 1:3770629-3770651 GGTTCAAGGGCAGCCCCAGAGGG - Intronic
900777550 1:4596045-4596067 GGGCCCAGGGCTGCCACGGCTGG + Intergenic
900971200 1:5993173-5993195 GGCCTCTGCGCAGCCCCACCGGG + Intronic
901060122 1:6468040-6468062 GGCCCCTCGGCAATCCCAGCTGG + Exonic
901084462 1:6602199-6602221 GGACCCAGCGCAGCGCCAGCTGG + Exonic
901237852 1:7677042-7677064 GGCCCCAGCTCAGCCCCAGTGGG - Intronic
901405123 1:9040157-9040179 GGACCCCGGTCAGCCCCAGCAGG + Exonic
901628201 1:10635292-10635314 GGCCCCACGGGAGGCCCACCAGG + Intergenic
901638401 1:10680860-10680882 GGCCCCAGCCCTGCCCCAGTGGG - Intronic
901646208 1:10718105-10718127 GGGCCAGGGGCAGGCCCAGCTGG + Intronic
901919856 1:12528222-12528244 TGCCCCAGGCCAGCCCCACTAGG + Intergenic
901923853 1:12553665-12553687 TGCCCCAGGGCAGCCCATGATGG + Intergenic
902233462 1:15043009-15043031 GTCCCCAGAGCAGAGCCAGCAGG - Intronic
902342665 1:15794222-15794244 GGCCACAGGCCAGCCCCTCCAGG + Intergenic
902715524 1:18270059-18270081 GGCCCCAAGGCAGAGCCAGGTGG + Intronic
902752459 1:18526613-18526635 GGCCCCATGAGAGCCACAGCTGG - Intergenic
902923811 1:19682814-19682836 GTCCCCAGAGGAGCCCCACCAGG - Exonic
903007946 1:20310750-20310772 GGTCCCGGGGAGGCCCCAGCAGG - Intronic
903446042 1:23423799-23423821 GGCCAGAGCGCAGACCCAGCTGG - Intronic
903475376 1:23615789-23615811 GGCCCCAGGGCAGCCCCCTGAGG - Intronic
903647019 1:24901984-24902006 GGTCCCAGGGTGGTCCCAGCTGG - Exonic
904132954 1:28288896-28288918 AGCCCCAGGGCAGATCTAGCAGG + Intergenic
904500231 1:30908852-30908874 GGCCCCAGTGCGCCCCCCGCGGG + Intergenic
904825344 1:33270718-33270740 TCCCCCAGGGCAGACCCAGAGGG - Intronic
904906228 1:33899282-33899304 GGCCCAAAAGCAGCCCCAGGGGG + Intronic
905256953 1:36690989-36691011 GGGCCCAGGACAGCACCATCAGG - Intergenic
905278964 1:36836883-36836905 GGTACAAGGTCAGCCCCAGCAGG - Intronic
905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG + Intergenic
905454543 1:38079074-38079096 AGCCCCAAGGCAGTCCCAGACGG + Intergenic
905561361 1:38929675-38929697 GTCTCCCTGGCAGCCCCAGCTGG - Intronic
905865109 1:41372302-41372324 GGACCAAGGGCAGCCCCTGGGGG + Intronic
906139803 1:43527286-43527308 GGCAGCAGGGCAGCCCCACGTGG + Intronic
906207629 1:43995637-43995659 GGCTCCAGGGCTGCCTCAGAGGG - Exonic
906286003 1:44588294-44588316 TGCCGCTTGGCAGCCCCAGCAGG - Intronic
906345631 1:45012705-45012727 GGCCCCAGGGCGGGCCCTTCTGG + Intronic
906641093 1:47440788-47440810 GGCCCCTGGGCAGCCCAAGCAGG + Intergenic
907192423 1:52660439-52660461 TCCCCCAGGGCAGCCGCAGTGGG + Intronic
907388259 1:54139763-54139785 GGCCACAGAGAAGCCCCTGCGGG + Exonic
907440329 1:54474822-54474844 GGCCCCAAGCCCACCCCAGCTGG - Intergenic
907755085 1:57303360-57303382 CGCCCCAGTCCAGTCCCAGCTGG + Intronic
908007283 1:59739899-59739921 GGCCAATGGGCAGCCCCAGCAGG + Intronic
908561280 1:65309419-65309441 GGCCCCAGGCCAGCACCTCCTGG - Intronic
909538014 1:76760144-76760166 GGCCCCAGGCCAACCCATGCAGG + Intergenic
910803168 1:91165186-91165208 GCAGCCAGGTCAGCCCCAGCTGG + Intergenic
910846732 1:91611596-91611618 GGAGCCAGGGCAGGCCCTGCTGG - Intergenic
911339258 1:96617515-96617537 GGCCCCAGGGAAGCTCAAACTGG - Intergenic
912453508 1:109782960-109782982 TGCCCTAGGCCAGCCCCAGTGGG + Intergenic
912543408 1:110433776-110433798 GGCCCCTGGCCAGCGCCAGGAGG - Intergenic
913975291 1:143450702-143450724 GACCCCCAGGCAGCCCCATCGGG + Intergenic
914069684 1:144276318-144276340 GACCCCCAGGCAGCCCCATCGGG + Intergenic
914109471 1:144690036-144690058 GACCCCCAGGCAGCCCCATCGGG - Intergenic
915098111 1:153478398-153478420 GCTCCCAGGGCAGCCACAGCAGG + Intergenic
915931354 1:160062513-160062535 GCCCCCAGGGGAGCCCCTGTGGG - Intronic
915980312 1:160416131-160416153 GGCTCCCGGGGAGCCCCTGCTGG + Exonic
917510072 1:175662463-175662485 GGCCCTAGGGGAGGCCCAGTAGG - Intronic
917944519 1:179955039-179955061 GGCCCCAGGGCTGCCCGGCCTGG - Exonic
918070154 1:181128680-181128702 GGCCCCAGGGCAGGCCGGGCAGG + Intergenic
918148193 1:181776236-181776258 GGCCCCTCGGCCGCCCCAGCGGG + Intronic
918175461 1:182040581-182040603 GGCCCCAAGGCAGCCCCAAAGGG - Intergenic
919800389 1:201350567-201350589 GGCCCCATGCCCACCCCAGCAGG - Intergenic
919855519 1:201703760-201703782 GACCACAGGGCAGCCCCACGCGG - Intronic
919878753 1:201888910-201888932 GGCCCCGCCGCAGCTCCAGCTGG + Exonic
920650563 1:207834194-207834216 GGCCCCAGGGCTGCCCCCTGAGG + Intergenic
922419607 1:225450654-225450676 AGCCCCAGGGCTGCGACAGCAGG - Intergenic
922774703 1:228209269-228209291 GGGCTCATGGCAGCCCCATCAGG - Intronic
924571566 1:245241705-245241727 GGGCCCATGGCAGCCCCAGCTGG + Intronic
924632609 1:245754930-245754952 GGCCCCACGGCACCCTCAGGAGG + Intronic
924707116 1:246510260-246510282 GGCCACATGGAAGCCCCACCAGG + Intergenic
1062978901 10:1705436-1705458 AGCCCCAGGGCAGCAGCAGGAGG + Intronic
1063121169 10:3106487-3106509 GGCCCCCAGTCAGCCCCAGGTGG - Intronic
1063167528 10:3477270-3477292 GGCCCCAGGACAGGCACTGCAGG + Intergenic
1063176244 10:3553130-3553152 GGCCTCAAAGCATCCCCAGCAGG - Intergenic
1063504142 10:6580550-6580572 GGGCCCAGGACAGCCCCGGGAGG + Intergenic
1064146139 10:12827872-12827894 AGACCCAGGGTTGCCCCAGCTGG + Intronic
1066218437 10:33311351-33311373 GCCCCCAAGGCAGGCCCACCTGG - Intronic
1066652090 10:37665865-37665887 GCCCCCTGGGCAGCAACAGCAGG + Intergenic
1067055620 10:43048286-43048308 GGCTCCAGGGCAGCCCATCCTGG + Intergenic
1067249653 10:44575863-44575885 CGCCCCAGGGCAGGCCCAGGAGG + Intergenic
1067473755 10:46553437-46553459 GACCCCAGGGAGGCCCCATCTGG + Intronic
1067561695 10:47309011-47309033 AGCCCCAGGGAAGCCGGAGCTGG + Intronic
1067681625 10:48445437-48445459 GCACCCAGGCCAGGCCCAGCTGG - Intergenic
1067695991 10:48536026-48536048 GGACCCAGGCCAGCCTCTGCCGG - Intronic
1068953776 10:62804393-62804415 GGCCCCAGCGCGGCGCCAGAAGG + Intergenic
1069438542 10:68407322-68407344 GGCGCCCGGGCGGCCCCAGGGGG + Intergenic
1069779170 10:70944036-70944058 GGCTGCAGGGCAGGCTCAGCGGG - Intergenic
1069837576 10:71319109-71319131 GGCCCCAGCTCAGCGCCAGAAGG + Intergenic
1070327391 10:75397417-75397439 GGCCCCGGCCCAGGCCCAGCCGG + Intergenic
1070643557 10:78185970-78185992 GGCTCCTGGCCAGCTCCAGCTGG + Intergenic
1070768850 10:79070757-79070779 GGCTCCCGGGCAGGCGCAGCCGG - Intronic
1070778993 10:79126753-79126775 GGCACCTGGGGAGCCACAGCAGG + Intronic
1070794039 10:79206701-79206723 GGGCCAAGGGCAGCCCCACATGG + Intronic
1070918673 10:80170763-80170785 GGCCCCAGGGCTGCCTCAGCAGG + Intronic
1071976838 10:90964149-90964171 GCCCCCAGAGCAGCCTGAGCTGG - Intergenic
1072555535 10:96511808-96511830 GTCCCCAGGTCACACCCAGCAGG + Intronic
1072717643 10:97762280-97762302 AGCCCCAGACCTGCCCCAGCAGG - Intergenic
1073297664 10:102450854-102450876 GGCCGGAGGGCAGGCCCACCAGG + Exonic
1073414267 10:103368212-103368234 GGCACCGGGGCCGCCCCCGCCGG - Exonic
1074137939 10:110644198-110644220 GGCCGCAGAGCAGCTCCCGCCGG + Intergenic
1074517324 10:114182209-114182231 GGTCACAGGGCAGCAACAGCTGG + Intronic
1074869759 10:117567411-117567433 GCCCCCAGCTGAGCCCCAGCTGG + Intergenic
1075519417 10:123135195-123135217 GGCCCCTGTCCAGCCCCAGGGGG + Intergenic
1075687669 10:124375659-124375681 GATCCCAGGGCAGCTCCAGTTGG - Intergenic
1075705430 10:124497511-124497533 GGACCCAGGGGAGCCCCACCCGG - Intronic
1075714336 10:124547542-124547564 GGCCCCAGGGAGGCCCCAGGTGG - Intronic
1076413805 10:130270825-130270847 AGCCCCAGGTCAGCCCAAGGGGG - Intergenic
1076566484 10:131403013-131403035 TGCCCCAGGGCAGCCCAGCCTGG + Intergenic
1076673000 10:132133451-132133473 GGCACCCGGGCAGCCCCAGACGG + Exonic
1076684685 10:132192803-132192825 GGCACCAAGGCAGCGCTAGCAGG + Exonic
1076723659 10:132403744-132403766 GGCCCCGCGGCTGCCACAGCCGG - Intronic
1076727809 10:132421558-132421580 GGCCCTGGGACAGCCTCAGCTGG - Intergenic
1076806110 10:132859660-132859682 CGCCCCGGAGCAGCCACAGCAGG + Intronic
1076837627 10:133029064-133029086 GGTCCAAGGGCGGCCACAGCCGG + Intergenic
1076849875 10:133087505-133087527 GTCAGCAGGGCAGCCGCAGCCGG - Intronic
1076872046 10:133199044-133199066 GGCCCCGGGGCCACCCCTGCCGG + Exonic
1076922303 10:133460394-133460416 GGCCCTGGGGCAGCCCCACCTGG + Intergenic
1077134862 11:993458-993480 GGCCTCACGGCAGGGCCAGCTGG - Intronic
1077219869 11:1411114-1411136 GGCCCCTGAGGATCCCCAGCTGG - Intronic
1077328277 11:1973001-1973023 GGCCACACAGCAGCCCCACCCGG + Intronic
1077340193 11:2023028-2023050 GGCCCGAGGGCAGCTACAGCCGG - Intergenic
1077435756 11:2538395-2538417 GGGCCCAGGGCAGAGGCAGCAGG + Intronic
1077450986 11:2645391-2645413 GGCCTCAGGACAGGCCCACCTGG - Intronic
1077499411 11:2902462-2902484 GGGAGCAGGGCAGCCGCAGCAGG - Exonic
1077548747 11:3189654-3189676 GACCACATGACAGCCCCAGCAGG - Intergenic
1077573147 11:3356133-3356155 TGCCCCTGGGCAGCCCGAGTAGG + Intronic
1078068559 11:8093847-8093869 GATTCCAGGGCAGGCCCAGCTGG - Intronic
1078191615 11:9095975-9095997 GGCCCTGGGGCAGCCGCAGGAGG - Intronic
1078446575 11:11409341-11409363 TCCCACAGGGCAGGCCCAGCAGG + Intronic
1079102963 11:17552868-17552890 GCCCCCAGGCCAGCCCCACCTGG - Intronic
1079689509 11:23403962-23403984 GGCCCGGGGGCAGCCCAAGGTGG - Intergenic
1080037291 11:27722633-27722655 GGCGGCGGGGCAGCCCCCGCAGG - Intergenic
1080779856 11:35419769-35419791 GGCCCCAGGTCACCCCGTGCGGG + Intronic
1080896005 11:36449219-36449241 GGCCCCAGGGCAGTGCCACCTGG - Intronic
1081852173 11:46281438-46281460 GATCCCAGAGAAGCCCCAGCTGG + Intronic
1082884178 11:58066460-58066482 GGTCCCATGGAAGCCCCAGCAGG - Intronic
1082953801 11:58847267-58847289 TGCCCCAGAGCTGCCACAGCTGG - Intronic
1083137307 11:60691513-60691535 GCACCCAGAGCAGCCTCAGCTGG + Intergenic
1083682778 11:64359017-64359039 GGAGACAGGGCGGCCCCAGCCGG + Intergenic
1083693880 11:64429734-64429756 GGGCCAAGGGCAGCCCAGGCAGG + Intergenic
1083751889 11:64765598-64765620 GGCGCCAGGAGAGCCCAAGCTGG + Intronic
1083827998 11:65213944-65213966 GGCCGCAGGGCAGCAGCAGCAGG - Intergenic
1084035733 11:66509219-66509241 GGCCCCAGTGAGGCCCCATCTGG + Exonic
1084149454 11:67281393-67281415 GGGCCCAGGGCTGCCTCAGGGGG - Intronic
1084496735 11:69509614-69509636 GGCCCCTGGCCAGCACCTGCAGG + Intergenic
1085043239 11:73339019-73339041 GGCCCCAGAGCTGCCCAAACTGG - Intronic
1085048722 11:73368436-73368458 GGACTGAGGGCAGCCCCATCAGG - Exonic
1085384869 11:76151813-76151835 GGCCCCAGGGCTGCAGGAGCAGG - Intergenic
1085507119 11:77066960-77066982 CGCCGCAGGCCAGTCCCAGCTGG + Exonic
1085521815 11:77143567-77143589 GGCCCCAGGGCTTCCCCTCCGGG - Intronic
1085539567 11:77254116-77254138 GGCCACGGGGCAGGCACAGCTGG + Intronic
1085745875 11:79113764-79113786 GGCCCCAGGACAGCCTCTGAGGG - Intronic
1088250721 11:107858846-107858868 GGCCAGAGCGGAGCCCCAGCCGG - Exonic
1088814703 11:113413043-113413065 GGACCCATGGCAGCCCCTGCAGG + Intronic
1089650679 11:119910827-119910849 GGCCCCATGGCAGCAACAGGTGG - Intergenic
1089697757 11:120226390-120226412 GCCCCCAGGGCAGGCTCTGCTGG - Intronic
1090243343 11:125199184-125199206 TGCCCCAGCCCAGCCCCAGGTGG + Intronic
1090260361 11:125314804-125314826 AGCCCCGGGGCAGCCCTGGCTGG + Intronic
1090413678 11:126526500-126526522 GGCCCCAGGCCCACCCCAGGAGG + Intronic
1202811255 11_KI270721v1_random:28180-28202 GGCCACACAGCAGCCCCACCCGG + Intergenic
1202823178 11_KI270721v1_random:78217-78239 GGCCCGAGGGCAGCTACAGCCGG - Intergenic
1091682972 12:2540132-2540154 GGCCCATGGGCAGCACTAGCAGG - Intronic
1091794755 12:3291689-3291711 TGCCTCATGTCAGCCCCAGCTGG - Intergenic
1095703758 12:45216558-45216580 GGCCCCGGTGCGGCCCCTGCGGG + Intronic
1095944517 12:47746440-47746462 GGCCCCAGGCCATTCTCAGCTGG - Intronic
1096149197 12:49297973-49297995 CTCCCCAGGACAGCCACAGCCGG + Exonic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1097102330 12:56598526-56598548 GGACCCAGGGCAGCATCAGCAGG + Exonic
1097233314 12:57524986-57525008 GGCCCCACCCCAGCCCCACCCGG - Exonic
1101422715 12:104562723-104562745 GGACCCTGGGCAGGCCCGGCAGG - Intronic
1101788784 12:107910175-107910197 GGCCCCAGGGAAGGCACAGGCGG - Intergenic
1102173541 12:110860028-110860050 GAACCCAGAGCACCCCCAGCAGG + Intronic
1102201994 12:111063611-111063633 GCCCCCAAGGCAGGCCCTGCTGG - Intronic
1102218990 12:111181587-111181609 GGCCCCAGCACTGCCCGAGCCGG + Intronic
1102494204 12:113307869-113307891 GGACCAAGGCCAGCCCCAACAGG + Intronic
1102513815 12:113433633-113433655 GGACCCAAGGCAACCACAGCAGG - Intronic
1102654814 12:114473174-114473196 GAACTCAGGGCAGCCACAGCTGG + Intergenic
1102700924 12:114838741-114838763 GGCCCCAGAGCACACCCAGGGGG + Intergenic
1103475117 12:121212167-121212189 TGCCCAAGGGAAGCCCAAGCAGG + Intronic
1103532453 12:121611726-121611748 GCCCCCAGGTTAGCCCCAGCAGG - Intergenic
1104013138 12:124946353-124946375 GGCGCCAGGGCAGCCTCCTCAGG - Intergenic
1104373865 12:128247343-128247365 TGCCCCAGGGCAGCGCTGGCCGG - Intergenic
1104598335 12:130134789-130134811 GGCCCCAGGCCTGCATCAGCAGG - Intergenic
1104924747 12:132308412-132308434 GGCCCCAGCGCTGCCCTTGCTGG + Intronic
1105210420 13:18253917-18253939 GGCCCCAGGGCATCCTGGGCTGG - Intergenic
1105250925 13:18697996-18698018 GCCCCCACGGCAGCCCCTGCAGG - Intergenic
1105808562 13:23973578-23973600 GGCCACTGGGAAGCCCCAACAGG - Intergenic
1105884012 13:24627161-24627183 GGCTCCATTGCAGCCACAGCTGG - Intergenic
1105895097 13:24710611-24710633 AGGCCCAGGGCTGCCCCAGGAGG - Intronic
1106564308 13:30871569-30871591 GGCTGCAGGGAGGCCCCAGCTGG + Intergenic
1106725167 13:32476892-32476914 GGCTCGAGTGCAGCCCCGGCGGG + Intronic
1107935449 13:45341723-45341745 TGCCCCAGGGCTGCCCCAGCTGG + Intergenic
1108350247 13:49585294-49585316 GGCTCCCGGGCAGTCCCTGCGGG - Intronic
1109123424 13:58487379-58487401 TGCTCCAGGGAAGCCCCACCAGG + Intergenic
1112294764 13:98177021-98177043 GGCCCCGGGGCCTCCACAGCTGG - Exonic
1112468750 13:99668908-99668930 GGCTCCAGGGCAGGACAAGCTGG + Intronic
1113439167 13:110314583-110314605 GGCCCCATGACAGCTCCACCGGG - Intronic
1113738394 13:112694058-112694080 GGAACCAGGGCAGCCTCAGCGGG + Intronic
1113769107 13:112897351-112897373 AGCATCAGGGCTGCCCCAGCCGG + Intronic
1113803244 13:113097035-113097057 GTCTCCGGGGAAGCCCCAGCGGG - Exonic
1113905963 13:113819307-113819329 GGCCACAGGGGAGGCCCCGCTGG - Intergenic
1113954093 13:114087596-114087618 GGGCCCCGGGCAGTGCCAGCAGG + Intronic
1114524421 14:23359289-23359311 CGCCCCTTGGCAGCCCCACCAGG - Intronic
1117546442 14:56797924-56797946 GGGCCCGAGGCAGGCCCAGCTGG + Intergenic
1119001968 14:70890532-70890554 GCCTCCTGGGTAGCCCCAGCTGG + Intergenic
1119485558 14:74984609-74984631 AGGCCCAGGGCAGCCCCTTCAGG - Intergenic
1122081498 14:99270652-99270674 GGCCCTACGGCTCCCCCAGCCGG + Intronic
1122130878 14:99604111-99604133 GGCTCCCGGGCGGCCCCGGCGGG - Intergenic
1122228297 14:100292299-100292321 TGCGCCAGGGCAGGCCCCGCAGG + Exonic
1122400089 14:101461865-101461887 GGCCCCAAAGCAGCTCCACCAGG - Intergenic
1122691408 14:103533613-103533635 GGCCCCAGGGGAGGCTCTGCCGG - Intronic
1122839144 14:104446290-104446312 GGGCTCAGGGCAGTCACAGCTGG + Intergenic
1122859659 14:104576875-104576897 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1122859667 14:104576924-104576946 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1122859676 14:104576973-104576995 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1122859684 14:104577022-104577044 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1122898236 14:104771076-104771098 GCCCTCACAGCAGCCCCAGCAGG + Intronic
1122973893 14:105163290-105163312 GGCCCCAGGGCCGCAGCAGGAGG + Intronic
1122982407 14:105197597-105197619 GGCCTCAGGGCAGGGCCATCGGG + Intergenic
1123006185 14:105324951-105324973 GGCCCGTGTGCACCCCCAGCAGG - Intronic
1123044578 14:105505122-105505144 GGCCCCAGGACTGCACCAGCAGG + Intergenic
1123049211 14:105532552-105532574 GGCCCCAGCACAGGGCCAGCGGG - Intergenic
1124061084 15:26294199-26294221 GAGCCCAGGGCACCCCCAGCTGG - Intergenic
1124139338 15:27063733-27063755 GGCTGCAGGGCAACCCCACCTGG - Intronic
1124252094 15:28113538-28113560 AGCTGCAGGGCAGCCCCACCTGG + Intronic
1124631296 15:31339039-31339061 GCCGCCAGGGCATCCCCAGAGGG - Intronic
1124637338 15:31373590-31373612 GGCTCCAGGCCACACCCAGCTGG + Exonic
1125429325 15:39580390-39580412 GGCCCCCTGGCAGCCGCGGCAGG + Intergenic
1125490895 15:40147679-40147701 GGCCCCAGGGCAGCTCCAGAAGG + Intergenic
1126139333 15:45424529-45424551 GGCTCCGGGGCAGCCACAGAGGG + Intergenic
1126351216 15:47746673-47746695 GGCCATATGGCAGCCTCAGCAGG + Intronic
1126661564 15:51038400-51038422 GGCCCCAGGGCAGCGTATGCTGG + Intergenic
1126667280 15:51086824-51086846 AGCCCAAGGTCAGCCCCAGAGGG - Intronic
1127267924 15:57376379-57376401 GGCCCGCCGGCAGCCCCGGCGGG + Intronic
1127588341 15:60398214-60398236 GGCCTCGGGGCAGCCTCGGCCGG - Intronic
1128568271 15:68715318-68715340 GGCCCCGAGGCTGCCACAGCTGG + Intronic
1128842329 15:70860192-70860214 GGCCCTGGGGCAGCCGCAGGAGG - Intronic
1129111317 15:73339014-73339036 GGCCACACAGCAGCCCCAGCTGG + Intronic
1129201894 15:74007686-74007708 GGCCCCAGGGCAGCCACCCCAGG - Intronic
1129535578 15:76311352-76311374 GGCTCCGGGGCAGCTCCGGCGGG - Exonic
1129687605 15:77695591-77695613 GGCCCCAGGTCAGGCCCTGTGGG + Intronic
1129781743 15:78276797-78276819 GCCCCCAGGGCAGTGGCAGCTGG + Intronic
1131153749 15:90062506-90062528 GGCCCCAGTGGGGCCCCAGGCGG + Intronic
1131658412 15:94485726-94485748 GGCCCAAGGACAGGCCCATCTGG + Intergenic
1132347269 15:101115914-101115936 GGGCCCAGGGCCGGGCCAGCAGG + Intergenic
1132355717 15:101169857-101169879 TGGCCCTGTGCAGCCCCAGCTGG - Intergenic
1132542735 16:518839-518861 GGTCACAGGGCGGCCCCAGCAGG + Intronic
1132590746 16:725355-725377 GGCCAGAGGGAAGCCTCAGCAGG - Intronic
1132669097 16:1095423-1095445 GCCCCCAGGGCAGGGCCTGCAGG + Intronic
1132675562 16:1119908-1119930 GGCCCCAGGCCTGCTGCAGCGGG - Intergenic
1132687498 16:1168456-1168478 TCCCCCAGAGCAGCCCAAGCAGG - Intronic
1132702993 16:1229876-1229898 GGCCCCTGGTGAGTCCCAGCCGG - Exonic
1132705330 16:1240992-1241014 GGCCCCTGGTGAGTCCCAGCCGG + Exonic
1132708461 16:1256355-1256377 GGCCCCTGGTGAGTCCCAGCCGG + Exonic
1132806720 16:1778393-1778415 GCCCGCAGTGCAGTCCCAGCAGG + Intronic
1132814979 16:1821403-1821425 GGCCCTAGGGCAGTGCCAGACGG + Intronic
1132896726 16:2232715-2232737 CAGCCCCGGGCAGCCCCAGCAGG - Intronic
1132971230 16:2690173-2690195 GTCCACAGGGCAGCCGCAGATGG - Intronic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133099373 16:3469993-3470015 GGCCCCAGGGCAGCCCCAGCAGG - Intronic
1133271581 16:4613233-4613255 TGCCCCAAGGCAGCCCCACCCGG - Intronic
1133285655 16:4689460-4689482 GGCCCCAGCGCAGACGCACCAGG - Exonic
1134079621 16:11315925-11315947 GGCCCTAAGGCAGACCCAGCCGG - Intronic
1134094702 16:11411715-11411737 GGTCCCATGGGAGTCCCAGCAGG + Intronic
1134279277 16:12803587-12803609 GGCCCCGGTGCAGCCCCGGATGG + Intronic
1134797690 16:17056862-17056884 GGCACCAGGCCAGCACCTGCAGG - Intergenic
1134850398 16:17474138-17474160 GGCTCCAGAGCAGCCTCTGCTGG - Intergenic
1135421687 16:22309291-22309313 GGCCGCAGGGCAGCCTACGCGGG - Intronic
1136051751 16:27655767-27655789 GGCCTCAGGGAAGCCCCTGCTGG + Intronic
1136186784 16:28593090-28593112 GGCCCCACTGCAGCCCCATGTGG - Intronic
1136253652 16:29024172-29024194 GGCCCCAGGGCTCCCCAGGCAGG - Intergenic
1136269701 16:29141453-29141475 GGGCACTGGGCAGCCCCAGCAGG - Intergenic
1136374285 16:29856210-29856232 GGCTCCTAGGCCGCCCCAGCTGG + Intergenic
1136572684 16:31106052-31106074 AGCCCCAAGGCAGCCACGGCTGG - Intergenic
1137267495 16:46881133-46881155 AGCTCCAGGGCTTCCCCAGCAGG - Intergenic
1137476127 16:48811275-48811297 GCTCCCAAGGCAGCCTCAGCCGG + Intergenic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1137728133 16:50670607-50670629 GGGCCCACTGCAGCCCCACCGGG - Intronic
1139391712 16:66609614-66609636 GACCCCAGGGGGGCCCCAGCAGG - Intronic
1139421349 16:66851298-66851320 GGGTCCAGGGGAGCCCCAGAGGG - Intronic
1139650072 16:68357800-68357822 GGCCTCAGTGCTGCACCAGCTGG + Exonic
1139939186 16:70592208-70592230 GGCCCCAGCCCAGCCTCAGCCGG - Intronic
1141029248 16:80573486-80573508 AGACCCAAGGCAGTCCCAGCTGG - Intergenic
1141596386 16:85099554-85099576 GGACCCATGGCAGCCACGGCAGG + Intronic
1141616005 16:85209754-85209776 ATCACCAGGGCAGGCCCAGCAGG - Intergenic
1141664318 16:85458119-85458141 GGCCCCTCTGCAGCACCAGCCGG + Intergenic
1141715659 16:85725355-85725377 GTCCCCACCGCAGCCCCATCTGG + Intronic
1141722251 16:85763023-85763045 GTGCCCAGGCCAGCCCCAGCAGG - Intergenic
1141976088 16:87517547-87517569 GGCCACAGGGCTGCCCAACCAGG - Intergenic
1142073325 16:88103383-88103405 GGGCACTGGGCAGCCCCAGCAGG - Intronic
1142140134 16:88469099-88469121 GGCCCCAGGGCCGTCCCTGCCGG - Intronic
1142172051 16:88628050-88628072 ACCCCCCGGGCAGCCCCAGCAGG + Exonic
1142187441 16:88701232-88701254 GGCTCCAGGGCGGCCCAAGCAGG + Intronic
1142198394 16:88749411-88749433 GGAACCAGGGCAGCAGCAGCAGG + Exonic
1142223064 16:88864769-88864791 GGACACACAGCAGCCCCAGCTGG - Intronic
1142227465 16:88884631-88884653 GGCCTCACGGCAGCCCTTGCTGG + Intronic
1142256159 16:89014810-89014832 GGGCCCTGGGGAGCCCCAGCAGG - Intergenic
1142259947 16:89038007-89038029 TTCCCCAAAGCAGCCCCAGCGGG + Intergenic
1142283742 16:89162524-89162546 GGGCCCGGGGCAGCCGCACCTGG - Intergenic
1142989867 17:3723513-3723535 GGCCCAAGCGAAGCTCCAGCGGG + Intronic
1143007453 17:3846156-3846178 AGCCCCAGGGCCGGCCCCGCCGG + Exonic
1143139455 17:4733052-4733074 GGCCACAGGGCAGCCCCATGAGG + Exonic
1143202362 17:5121770-5121792 GGCCCCCAGCCCGCCCCAGCAGG - Intronic
1143498806 17:7327198-7327220 GTCCCCAGCGCAGGCCCGGCCGG - Exonic
1143614103 17:8039454-8039476 GCCCCCAGTGCTGCCCCTGCTGG + Exonic
1143773204 17:9181310-9181332 GGGCCCATGGCTGCCCAAGCTGG - Intronic
1144577070 17:16436006-16436028 AGCCTCGGGGCTGCCCCAGCAGG + Intronic
1144590745 17:16521485-16521507 CTCTCCAGGGCAGCCACAGCTGG - Intergenic
1144627011 17:16849159-16849181 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1144679638 17:17184373-17184395 TGCTCCAGGGAATCCCCAGCAGG - Intronic
1144703530 17:17353310-17353332 CCGCCTAGGGCAGCCCCAGCAGG - Intergenic
1144777178 17:17790839-17790861 TGCCACAGGGCAGCCCAGGCGGG - Intronic
1144778673 17:17797257-17797279 GGCGCCAGGGCAGTCCCCCCAGG - Exonic
1144879429 17:18423553-18423575 GGCCCCCAGCCCGCCCCAGCAGG - Intergenic
1145057714 17:19714316-19714338 GCCACCTGGGCAGCCCCTGCTGG + Intronic
1145152812 17:20520834-20520856 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1146052885 17:29567051-29567073 GGGCCCTGGGCAGCCGCCGCCGG - Exonic
1146164152 17:30575006-30575028 GGTCCCCAGGCCGCCCCAGCAGG + Intergenic
1147563354 17:41522142-41522164 CGCCTCTGGGCAGTCCCAGCTGG + Exonic
1147956552 17:44138491-44138513 GACCCCAGTGGAGCCCCACCTGG - Intergenic
1148135630 17:45290025-45290047 CGCCCCAGGACTGGCCCAGCAGG + Intronic
1148496258 17:48054983-48055005 AGCCCCAGGGCAGCCGGTGCCGG - Intronic
1148564675 17:48625927-48625949 GGCCCCGGGGCAGGGCCAGGCGG - Exonic
1148849456 17:50547746-50547768 GGCCCCACAGGAGTCCCAGCAGG + Exonic
1148894745 17:50833176-50833198 GACCCCACGGCAGCCCCAGGAGG - Intergenic
1151329618 17:73399149-73399171 GGCCCCAGGCCTGCCCTACCTGG + Exonic
1151362173 17:73595611-73595633 GGGCCCAGGCCAGGCCCAGATGG + Intronic
1151743745 17:76000894-76000916 GGCCCCTGGGCAGCCCTTCCTGG + Exonic
1151758321 17:76087231-76087253 AGTCCCAGGGCAGGGCCAGCAGG + Intronic
1151801721 17:76383237-76383259 GGCCCCCGGGCAGTCCCCGCTGG - Intronic
1152239268 17:79153045-79153067 GGAAATAGGGCAGCCCCAGCGGG - Intronic
1152264566 17:79286838-79286860 GGCACCAGGGCGTCCTCAGCAGG - Intronic
1152392023 17:80008941-80008963 AGCCCTGGGGCAGACCCAGCTGG + Intronic
1152407293 17:80104946-80104968 AGCACCAGGGCTGCCCCATCTGG - Intergenic
1152420907 17:80192656-80192678 GGCCCCTGGGCTGGCCCAGAGGG - Intronic
1152426637 17:80221625-80221647 GGCCGCAGGGGAGCAGCAGCAGG - Exonic
1152523035 17:80871477-80871499 GGACCCAGGCCAGCGCCACCAGG - Intronic
1152561669 17:81081815-81081837 GACCGCAGTGCAGCCCCAGGGGG + Intronic
1152621790 17:81368554-81368576 GGGCCCATGGCAGCCTTAGCGGG + Intergenic
1152630012 17:81406696-81406718 GGCCCCAGAGCAGCTGCCGCGGG + Intronic
1152639458 17:81443614-81443636 GGGCGCAGGGCAGGGCCAGCTGG - Intronic
1152729286 17:81961711-81961733 GGCCCCAGGGCTGCGCGAGGTGG - Intronic
1152797234 17:82314437-82314459 GGCCCCGGGGGAGACCCAGCTGG - Intergenic
1152822090 17:82442520-82442542 GGGCCCTGGGCAGCCCCTGGGGG + Exonic
1152876017 17:82786585-82786607 AGTCCCTGGGCAGCCACAGCTGG - Intronic
1152944514 17:83191758-83191780 GCCCTCGGGGCAGCCCCAGCCGG - Intergenic
1153137323 18:1930658-1930680 GGCCCCAGGGCAGCACACTCTGG - Intergenic
1153997434 18:10454520-10454542 CGCCCCCGGGCAGCCGCCGCCGG - Intergenic
1154092428 18:11378205-11378227 GGCCCATGGGCAGCCTCGGCAGG - Intergenic
1154270308 18:12912496-12912518 GGCCCCACTGCAGCCACACCAGG + Intronic
1154437920 18:14360918-14360940 GCCCCCACGGCAGCCCCTGCAGG + Intergenic
1155176977 18:23309354-23309376 CACCCCAGGGCAGCCACTGCTGG - Intronic
1156027279 18:32669675-32669697 GGCCCCAGGACTGGCCCACCTGG - Intergenic
1157483205 18:48069100-48069122 GGCCCCAGCGCAGCCAGGGCAGG + Intronic
1157598610 18:48879005-48879027 GCACCCAGGGCAGCCTGAGCAGG + Intergenic
1157602445 18:48902288-48902310 GGCCCCAACGCAGCCTCGGCAGG - Intergenic
1157616211 18:48989150-48989172 AGCCCCCGGGCAGCCCCAGAGGG - Intergenic
1157721606 18:49929466-49929488 TGCTCTAGGGCAGCCCCAGGAGG + Intronic
1157728179 18:49981054-49981076 GGCCCCTGGCCATCCCCAGATGG + Intronic
1157764251 18:50285369-50285391 AGGCCCAGGTCAGCCCCAGGTGG + Intronic
1157848934 18:51030068-51030090 GCCTACAGGGCAGCGCCAGCCGG - Intronic
1158405314 18:57154818-57154840 CCCCCCAGAGCAGCCACAGCAGG - Intergenic
1160490628 18:79334613-79334635 GGCTCCCGGACAGCCCCAGGGGG - Intronic
1160667921 19:341926-341948 TCCCCCAGGGCAGCCCCCACAGG + Intronic
1160734816 19:657738-657760 GGCCCCCGGCCAGCCCCTCCAGG + Intronic
1160756257 19:758482-758504 GGCCCCAGACGAGCCCCAGCAGG + Exonic
1160832017 19:1108564-1108586 GGCCGCAAGGCAGCGCCAGCGGG + Exonic
1160870005 19:1273375-1273397 GGCCTCAGGGCAGCCCTGGGAGG + Intronic
1160921652 19:1523656-1523678 GGCCCCAGGGACCCGCCAGCAGG + Intergenic
1160948062 19:1652488-1652510 TGCCCCAGGGGCGCCCCGGCCGG - Intronic
1161068301 19:2248743-2248765 GGCCCCAGGCCCTCCCCAGTCGG - Intergenic
1161073001 19:2271548-2271570 GGCCCCAGAGCAGCCCCAGCAGG - Intronic
1161329900 19:3681755-3681777 AGCCCCAGGGCAGCCCCTGGGGG + Intronic
1161329914 19:3681790-3681812 AGCCCCAGGGCAGCCCCTGGGGG + Intronic
1161592850 19:5136581-5136603 GGTCCCAGGCCTGCCACAGCCGG + Intronic
1161766692 19:6212515-6212537 GACCCCAGCGCAGCGCGAGCCGG + Intergenic
1161803712 19:6430222-6430244 GCCCCAAGCGCAGCCCCACCGGG + Intronic
1162069968 19:8147585-8147607 GGCCCCGGGGCTGCCCCATTTGG - Intronic
1162317055 19:9945867-9945889 TGCCCCAAGCCAGGCCCAGCAGG + Intergenic
1162363113 19:10231257-10231279 GTCCCCAGGGCGGCCGCGGCTGG + Exonic
1162395630 19:10416828-10416850 TGCCCCAGGGCTCCCCCTGCCGG - Intronic
1162520708 19:11177933-11177955 GGCCCTAGGGGAGTCCCAGAAGG - Intronic
1162562305 19:11423803-11423825 GGCCCCAGGGGTGCCTAAGCCGG - Intronic
1162799530 19:13103050-13103072 GGCCCCAGGGCAGCCGGGGAGGG + Intronic
1163012761 19:14435345-14435367 GGCCCCACCCCATCCCCAGCAGG - Intronic
1163171290 19:15532949-15532971 GGCCCCAGGGTGCCCCCACCTGG + Intronic
1163256754 19:16160695-16160717 GGCCCTGGGGCAACCCCAGGTGG + Intergenic
1163525969 19:17821549-17821571 GGCGCCTGGGCCGTCCCAGCTGG + Exonic
1163605877 19:18274982-18275004 GGCCCCAGCCCAGCCCCAGGAGG - Intergenic
1164512079 19:28905581-28905603 GGCCCCATGGAAGCTCCTGCAGG + Intergenic
1164585940 19:29476143-29476165 TGCCCCAGGGGAGTCCCAGGAGG + Intergenic
1164599174 19:29549469-29549491 GCCCCCAGTGCTGCCCCAGGAGG + Intronic
1164693607 19:30227813-30227835 GGCGGCCGGGCAGCCCGAGCGGG + Intergenic
1165022185 19:32934285-32934307 AGTCCCAGGGCAGCCTCTGCTGG + Intronic
1165092862 19:33395851-33395873 GGTCCCAGGGCAGGCCCTGAGGG + Intronic
1165100415 19:33435565-33435587 AGCACCAGGGCAGGCCCTGCTGG - Intronic
1165357024 19:35310651-35310673 ATCCCCAGATCAGCCCCAGCTGG - Intronic
1165384362 19:35501823-35501845 GGACCCAGGGGAGCCACGGCTGG - Intronic
1165384369 19:35501840-35501862 GGGTCCAGGCCAGGCCCAGCAGG + Intronic
1165719255 19:38067394-38067416 GGACCCAGGGCAGTCCCCACAGG - Intronic
1165743544 19:38217424-38217446 GGCCCCTGGCCACCCCCACCTGG + Intronic
1165761987 19:38326942-38326964 GGCCCCTGGCCAGCCCTACCGGG + Exonic
1166070416 19:40384025-40384047 CGCAGAAGGGCAGCCCCAGCAGG + Exonic
1166924900 19:46260738-46260760 GCCCCCAGGGGACCCCCGGCTGG - Intergenic
1167095991 19:47375418-47375440 GGCCTCAGGGCAGACTCAGTGGG - Intronic
1167182854 19:47918450-47918472 GGCCCGAGGGCAGGCGCAACCGG - Intergenic
1167183523 19:47923800-47923822 GGCCCGAGGGCAGGCGCAACCGG - Intergenic
1167184819 19:47934202-47934224 GGCCCGAGGGCAGGCGCAACCGG - Intergenic
1167293185 19:48635600-48635622 GTCCCGAGGGCAGCCCGGGCGGG + Exonic
1167358537 19:49018066-49018088 CGCCCCAGGGCGCCTCCAGCGGG + Intergenic
1167499284 19:49836312-49836334 GGGCCTGGGGCAGCCCCAGTTGG + Exonic
1167541729 19:50092566-50092588 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167542402 19:50097903-50097925 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167542839 19:50100968-50100990 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167543275 19:50104032-50104054 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167543709 19:50107091-50107113 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167544383 19:50112445-50112467 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167545058 19:50117797-50117819 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167545735 19:50123151-50123173 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167546412 19:50128479-50128501 GGCCCGAGGGCAGGCGCAACCGG + Intergenic
1167633887 19:50642221-50642243 GGACCCTGGGCAGGCCCAGCAGG - Intronic
1168008635 19:53512204-53512226 GGCCCCAGGGACGCGCCAGTGGG + Intergenic
1168052800 19:53842184-53842206 AGTCCCAGGCCAGCCCTAGCCGG - Intergenic
1168214834 19:54917783-54917805 ATGCCCAGGGCAGCCCCAGATGG + Intergenic
1168313365 19:55472787-55472809 GCCCCCGTGGCAGCCCCAGCCGG - Intergenic
1168346030 19:55650637-55650659 GGCCCAAGGGCAGCCAGAGGTGG - Intronic
1168687799 19:58358830-58358852 GGCCCCAGTGCTGGCTCAGCTGG + Intronic
1168694493 19:58396845-58396867 GGGCCCAGGGCGACCCCGGCGGG - Exonic
925161646 2:1688354-1688376 AGCGCCAGCGCAGCCCCAGATGG - Intronic
925261258 2:2530456-2530478 GGCCACATGGCGGCCACAGCTGG + Intergenic
925288462 2:2730828-2730850 GGCCCCAGGTCCGCACCACCAGG + Intergenic
925427594 2:3763250-3763272 GTCCCCAGCACAGCCCCAGGAGG + Intronic
927153169 2:20207141-20207163 TGCCCCAGGGCTGCCTCAGGAGG - Intronic
927506677 2:23619520-23619542 GGCCCCAGGGCAGCCGAAGCAGG + Intronic
927518581 2:23686169-23686191 TGCCCCAGTGCAGCCCCCTCTGG - Intronic
927881868 2:26694603-26694625 GGACCCAGAGGTGCCCCAGCTGG - Intronic
928178870 2:29053528-29053550 GGTCGCAGGGAAGCCCCTGCTGG - Exonic
928289449 2:30024746-30024768 GGCCCCTGGGAAGCCCCTGGAGG + Intergenic
929578692 2:43068453-43068475 GGCCCACGGGCGGCCCCCGCCGG - Intergenic
932192764 2:69754801-69754823 GGCCCCAGGACAGCCTTAGGAGG - Intronic
932495590 2:72144427-72144449 GGCCCAGGGGCACCCCCAGGAGG + Intronic
932551269 2:72772303-72772325 GGCTCCAGGCCTGCCCCTGCAGG + Intronic
934179991 2:89611675-89611697 GACCCCCAGGCAGCCCCATCGGG + Intergenic
934290286 2:91685936-91685958 GACCCCCAGGCAGCCCCATCGGG + Intergenic
934619747 2:95796941-95796963 AGACCCAGGGCAGCCCCAGAGGG - Intergenic
934641141 2:96027616-96027638 AGACCCAGGGCAGCCCCAGAGGG + Intronic
934662477 2:96150471-96150493 GGTCACAGGGGAGCCCCAGGAGG - Intergenic
934682168 2:96291943-96291965 AGCCCCAGGGCACCTGCAGCAGG + Intronic
934916065 2:98302077-98302099 GACCCCAGTGTGGCCCCAGCCGG + Intronic
934938605 2:98483411-98483433 GGCTGCAGGGCTGCCCCAGGCGG + Intronic
935275714 2:101474114-101474136 GTCCCGAGGGCAGCCGTAGCGGG + Intronic
936083867 2:109453267-109453289 GGCCACAGGGCAGCCCCTGCAGG - Intronic
936433287 2:112482302-112482324 GGCCGCCGGGCAGCCGCCGCAGG - Exonic
936519317 2:113201838-113201860 GGCCCCTGGGCAGCCCAGCCAGG + Exonic
937091404 2:119208910-119208932 ACAGCCAGGGCAGCCCCAGCGGG - Intergenic
937225516 2:120366585-120366607 GGCTCCAGGGCAGCCTGGGCAGG - Intergenic
937318526 2:120947229-120947251 GGCTCCAGCCCAGCCCCACCTGG + Intronic
937320272 2:120956737-120956759 GGCACCAGGGCTGCCCCTGCAGG - Intronic
937883526 2:126885631-126885653 GGCTCCACGCCAGGCCCAGCGGG + Intergenic
937905696 2:127051785-127051807 GGCACCACGGCAGGCCCTGCAGG + Intronic
940830379 2:158458229-158458251 GGCGCTAGGGCAGCCGCGGCGGG - Intronic
941001266 2:160205728-160205750 TGCCCCGGGGCAGGCCCAGCTGG - Intronic
942317595 2:174709786-174709808 GGACCCAGGGCACCCTCCGCAGG + Intergenic
943692451 2:190881709-190881731 GGCCCCACCGCGGCCCCACCAGG - Intronic
946175808 2:217921401-217921423 GCCCTCAGCCCAGCCCCAGCTGG + Intronic
946177304 2:217929520-217929542 GGCCACAGGGAAGCACCAGCAGG + Intronic
946230220 2:218286679-218286701 ACCCCCAGGAGAGCCCCAGCCGG - Exonic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946394489 2:219436265-219436287 GCCTCCATGGTAGCCCCAGCTGG - Intronic
947723563 2:232383048-232383070 GGCCCTGGGGCAGCGCCAGCAGG + Intergenic
947739768 2:232479786-232479808 GTCCCCAGGGCAGGCGGAGCTGG - Intergenic
947767475 2:232646929-232646951 GGCCTCAGTGCAGCTACAGCTGG - Intronic
947807827 2:232980856-232980878 GCCACCAGGGCATCCTCAGCAGG + Intronic
947917811 2:233845522-233845544 TCCCCCAGGGCAGCGCCATCAGG - Intronic
948051451 2:234982334-234982356 GACCCCAGCCCAGCACCAGCAGG - Intronic
948221844 2:236276193-236276215 GGACTGAGGGCTGCCCCAGCTGG + Intergenic
948270514 2:236670012-236670034 TGGCCAATGGCAGCCCCAGCAGG - Intergenic
948754080 2:240149185-240149207 AGTCTCAGGGCAGCCCCAGCAGG + Intergenic
948916639 2:241037681-241037703 GGCCCCACCACATCCCCAGCGGG - Intronic
1169140058 20:3222723-3222745 GGCCCCACAATAGCCCCAGCAGG + Intronic
1171391896 20:24807017-24807039 GGGCCCAGGGCTGCCCATGCTGG - Intergenic
1171412917 20:24958623-24958645 GGCTGCAGGGCGGGCCCAGCAGG + Intronic
1171450583 20:25233385-25233407 CGCACCAGGGCAGCACCTGCTGG - Intergenic
1171488119 20:25498292-25498314 GGGCCCAGGTCAGCTCCAGAAGG + Exonic
1172589906 20:36110389-36110411 GGCTTCAGCTCAGCCCCAGCAGG + Intronic
1172656957 20:36543281-36543303 GGATCCCGGCCAGCCCCAGCTGG - Intronic
1172781192 20:37437833-37437855 GGCCCAAGGGAAGGCTCAGCGGG - Intergenic
1172781312 20:37438438-37438460 GGCCACTGGGGACCCCCAGCAGG - Intergenic
1172838961 20:37890664-37890686 GGCCCCAGGGCAGCTTTGGCAGG - Intergenic
1173224258 20:41152773-41152795 GACACCAGGGAAGCACCAGCAGG + Intronic
1173916141 20:46709837-46709859 TCCCCCAGGGCCGCCCCGGCCGG + Intronic
1175335870 20:58195976-58195998 GGCTACAGGGCGGCCACAGCAGG - Intergenic
1175470765 20:59225896-59225918 GAGCCCAGGGTAGCTCCAGCTGG + Intronic
1175766205 20:61594412-61594434 GGAGCCAGGGCAGACCCAGGTGG - Intronic
1175803123 20:61812355-61812377 TGGCCCATGGCAGCCCCACCCGG - Intronic
1175896603 20:62338565-62338587 GGACCCAGGGCAACGCCTGCCGG - Exonic
1175912605 20:62411995-62412017 GGCTCAATGGCAGCTCCAGCTGG - Intronic
1175996632 20:62814947-62814969 GCCCCCAGGGCTGCTCCAACAGG - Intergenic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176035709 20:63035505-63035527 GGCCTGAGGGCAGCTCCGGCCGG - Intergenic
1176044531 20:63085507-63085529 GGCCCATGGGCAGACCCCGCGGG + Intergenic
1176089431 20:63312381-63312403 GGCGACATGGCAGGCCCAGCTGG - Intronic
1176111176 20:63411461-63411483 GGCCCCCGGGCAGCACCTCCAGG - Intronic
1176150879 20:63590150-63590172 GGCCCGGGGGCAGCCCCTGCGGG + Exonic
1176212875 20:63933780-63933802 GGCCCTAGCTCAGCCCCACCAGG + Exonic
1176457751 21:6928551-6928573 GTCCCCACGCCAGCCCCTGCAGG - Intergenic
1176835922 21:13793635-13793657 GTCCCCACGGCAGCCCCTGCAGG - Intergenic
1177464509 21:21458191-21458213 GGCCCCAGTGGGGCCACAGCTGG - Intronic
1178663095 21:34522962-34522984 AGCCCCAGGGCACCCACGGCAGG - Intronic
1179127121 21:38600192-38600214 AGCCCCAGGGTAGCCAAAGCCGG - Intronic
1179178692 21:39027113-39027135 GACCCCAGGGGAGCCACAGCAGG + Intergenic
1179485001 21:41704406-41704428 GGCCCCAGAATAGCCCCTGCAGG + Intergenic
1179491579 21:41744764-41744786 GCCCCCAGGCCAGCCCCACGTGG - Intronic
1179605543 21:42513552-42513574 GGCCTCCGGGCAGTCCCAGGCGG - Intronic
1179617863 21:42593531-42593553 GGCCCCACCCCCGCCCCAGCTGG + Intergenic
1179659621 21:42865925-42865947 GCCGCCTGGGCAGCCCCAACAGG + Intronic
1179925823 21:44533576-44533598 TGCCCCAGGACAGCTCCTGCAGG + Intronic
1179996627 21:44977296-44977318 GCCCCCACGGCAGCCCCTGCAGG - Intergenic
1179998840 21:44986112-44986134 GGGCCCAGGCCAGCCCGGGCAGG + Intergenic
1180080803 21:45486812-45486834 GGACCCAGCCCAGCCCCCGCTGG - Intronic
1180094557 21:45549962-45549984 AGCCCCAGGGCAGCCCTCCCAGG + Intergenic
1180856111 22:19046716-19046738 GGCCACAGGGCAGGCAGAGCAGG + Intronic
1181142109 22:20813473-20813495 GGCTCTAGGGCAGTCCCATCGGG + Exonic
1181162797 22:20967804-20967826 GGTCCTAGAGCAGCTCCAGCAGG + Exonic
1181171934 22:21014842-21014864 GGCCTGAGGGCAGCAGCAGCAGG - Intronic
1181400391 22:22647328-22647350 GGCCCCAGGGCATCCTGGGCTGG + Intronic
1181636258 22:24176227-24176249 GTGCCCAGGGCAGCCTCTGCCGG - Exonic
1181648974 22:24248463-24248485 GGCCCCAGGGCATCCTGGGCTGG - Intergenic
1181689221 22:24549095-24549117 GGTCCCTGAGCAGCCCCTGCAGG - Intronic
1181702370 22:24628426-24628448 GGCCCCAGGGCATCCTGGGCTGG + Intronic
1182295734 22:29310551-29310573 GGGCCTGGGGCCGCCCCAGCGGG + Intronic
1182520254 22:30880999-30881021 CGCCCTGGGGCAGCCCCACCTGG - Intronic
1182697684 22:32207511-32207533 CACCCCAGGCCAGGCCCAGCCGG - Intergenic
1182735135 22:32527960-32527982 ATCCCCAGGGCAAGCCCAGCTGG - Exonic
1183069746 22:35387779-35387801 GGCCCCATGGCACCTCCAGGGGG - Intronic
1183070049 22:35389923-35389945 GGCACCAGGGCTTCGCCAGCGGG + Exonic
1183295967 22:37029742-37029764 GGCCCCAGCTCAGCACCAGGTGG - Exonic
1183347748 22:37317307-37317329 GGCCCAATGCCAGCCCCAGCAGG - Intergenic
1183472802 22:38018573-38018595 GACCCCAGCCCAGCCCCAGATGG - Intronic
1183495871 22:38143515-38143537 GGCCCCAGGGCCACACCAGCAGG + Intronic
1183726013 22:39590096-39590118 GGCGCCCGGGCAGGCCCTGCAGG - Intronic
1183727276 22:39596720-39596742 GGGGCCAGGGCAGACCCAGGGGG + Intronic
1183831472 22:40420483-40420505 GGGCCCAGGGGCGCCCGAGCTGG + Exonic
1184106699 22:42371564-42371586 GGCCCCAGGGCTGCACAAGGTGG + Intergenic
1184160351 22:42693909-42693931 CGCCCCGGAGCAGCCGCAGCAGG + Exonic
1184248012 22:43245387-43245409 AGCCCTGGGGCAGACCCAGCCGG - Intronic
1184477646 22:44730091-44730113 GCCCCCAGGGCTGCCCCTGGCGG + Intronic
1184610278 22:45599008-45599030 GGCCCCCGACCAGGCCCAGCTGG - Intronic
1184649360 22:45912611-45912633 GGCCCCAGGCAATCTCCAGCAGG + Intergenic
1184741885 22:46433343-46433365 GGCCCCAGGGCGGCTCGAGAAGG - Intronic
1184778820 22:46636048-46636070 GGCCCCAGGACAGACCCCGGGGG - Intronic
1184976248 22:48064445-48064467 GGACCCAGAGCAGCACAAGCTGG + Intergenic
1185017665 22:48354268-48354290 TCCCCCAGGGCAGCCCCCGTCGG + Intergenic
1185068358 22:48643104-48643126 ACCCCCAGCTCAGCCCCAGCAGG - Intronic
1185097885 22:48821568-48821590 CTCCCCTGGCCAGCCCCAGCCGG + Intronic
1185276088 22:49950712-49950734 GGACCCCCGGCAGCTCCAGCAGG - Intergenic
950040307 3:9915707-9915729 CGCCCCAAGGCGGCCCCAGCTGG - Exonic
950478358 3:13228152-13228174 GGCACCTGGGCACTCCCAGCAGG - Intergenic
950577026 3:13838109-13838131 GGCCCCACCGCACCCTCAGCTGG - Intronic
950675845 3:14554003-14554025 GTCCCCAGGGCAGTCACATCTGG - Intergenic
950940148 3:16884269-16884291 GGCCCCGGGGCAGCTCCCGGAGG - Intronic
952898381 3:38094289-38094311 GTCCCCAGGGCAGCCCTGGTTGG - Intronic
953154498 3:40356810-40356832 GGCCAGAGGGGAGCACCAGCTGG + Intergenic
953782972 3:45887765-45887787 GGGCCCTGTGCAGCCCCTGCTGG + Intronic
953979827 3:47408014-47408036 GGCCCCAGGGCTGCCTATGCTGG + Intronic
954413450 3:50381269-50381291 GGAGCTGGGGCAGCCCCAGCTGG - Intronic
954433732 3:50484954-50484976 TGCCCCAGGGCTGGCCCAGGAGG + Intronic
954460472 3:50623868-50623890 GGAGCCCTGGCAGCCCCAGCTGG + Intronic
954609144 3:51935101-51935123 TGCCTCAGGGCACCCCCAGTGGG - Intronic
954613909 3:51959879-51959901 TGCCCCAGGGCAGCACCTCCAGG + Exonic
954648553 3:52145801-52145823 GGCCCAAGGGCAGCCCTGGTGGG - Intronic
954671847 3:52295291-52295313 GGCACGAGGGCAGCAGCAGCCGG - Intergenic
954808707 3:53235014-53235036 GGCCCCACTGCAGCACCAGATGG - Exonic
954813221 3:53260595-53260617 GGCCCAAGTGCAGCCCCCTCTGG - Intergenic
954984260 3:54775833-54775855 GGCTCAGGGGCAGCCCCAGGAGG + Intronic
955911516 3:63863710-63863732 GGTCTCAGGGGAGGCCCAGCGGG + Intronic
957937976 3:86968757-86968779 GGATCCAGGGCAGAGCCAGCAGG + Exonic
960055372 3:113273097-113273119 GGCCCCAGGGGATGACCAGCTGG - Exonic
960537345 3:118828365-118828387 GGCCCCACATCAGCCCCATCAGG + Intergenic
961116450 3:124334107-124334129 GGCCCCATGGCAGCTCTGGCTGG + Intronic
961126472 3:124423018-124423040 GGTCCCAGGTCAGGCTCAGCTGG - Intronic
961440742 3:126951706-126951728 GTCCCCAGCCCATCCCCAGCTGG - Intronic
961634042 3:128321740-128321762 GCCACCAGTGCAGACCCAGCAGG - Intronic
961645755 3:128391983-128392005 GGACCCAGGGAAGCCACGGCTGG - Intronic
961656248 3:128443719-128443741 GCCCCCAGGGCAGCCCCACCTGG + Intergenic
961714058 3:128846789-128846811 GGCCCACGGGTAGCCCCAGGAGG - Intergenic
961786345 3:129349501-129349523 GGCACCTGGGCACTCCCAGCAGG + Intergenic
963236680 3:142963390-142963412 GGGCGCTGGGCAGCCCCCGCCGG + Exonic
963745305 3:149119142-149119164 GGAACCAAGGCAGCCCCCGCCGG + Intergenic
963746725 3:149131604-149131626 GGGCCTAGGGCAGCCTGAGCAGG - Intronic
965515703 3:169619215-169619237 GGCCGCAGCGCATCCCCAGTCGG + Intronic
966449077 3:180037121-180037143 GGCCCGAGGGCGGCCCCGGGCGG + Intergenic
966819644 3:183914702-183914724 GGCCCTGGGGCAGCCTCAGGCGG - Intergenic
966924604 3:184636107-184636129 GGATCCAGGGCTGCCCCAACAGG + Intronic
967557783 3:190878007-190878029 GGCCCGAGGGCAGGCGCAACCGG + Intronic
967685020 3:192408901-192408923 GGCCCCTGGAAAGCCGCAGCCGG - Exonic
967969393 3:194988013-194988035 GACCCCAGCCCAGGCCCAGCAGG + Intergenic
968083609 3:195863904-195863926 GGCTTGAGGGCTGCCCCAGCAGG - Exonic
968530811 4:1090498-1090520 GGCCCCAGTGTTGCCCCAGGTGG + Intronic
968554154 4:1238834-1238856 GACCCCAGGGCAGCTCCATGAGG + Intronic
968596570 4:1489112-1489134 GACCCCAGGGCACCTCCACCGGG + Intergenic
968648778 4:1752296-1752318 GGCCGGAGGGCAGCCCAAGCTGG + Intergenic
968653846 4:1770355-1770377 GGCCCCGCGGCAGCCCGGGCGGG + Intergenic
968802494 4:2752401-2752423 GTCCTCAGTGCAGCCACAGCTGG - Intronic
968909737 4:3471556-3471578 GGCCCCAGGGCCGCTTGAGCCGG - Intronic
969292934 4:6252277-6252299 GGTCCGTGGGCAGCCCCTGCAGG - Intergenic
969299920 4:6291761-6291783 GCCCCCAGGGCAGGCAGAGCAGG - Intronic
969588396 4:8107629-8107651 GACCCCAGGGCAGGCACAGGCGG + Intronic
969619755 4:8273129-8273151 AGACCCAGGCCAGGCCCAGCCGG - Intronic
969829288 4:9781955-9781977 GACCCCCAGGCAGCCCCATCGGG - Exonic
971385792 4:26139536-26139558 GGCCTCAGCACAGCCCCAGGGGG - Intergenic
972765930 4:42152223-42152245 CGCACCAGGGCAGACCCGGCGGG - Exonic
973741307 4:53922138-53922160 GGCTCCAGGCCAGGCCCATCTGG + Intronic
975683156 4:76896491-76896513 GGAAGGAGGGCAGCCCCAGCCGG - Exonic
976077782 4:81319427-81319449 TTCCCCATGGCAGCCTCAGCGGG + Intergenic
978067986 4:104429529-104429551 TCCACCATGGCAGCCCCAGCAGG - Intergenic
980075232 4:128287562-128287584 GCCCCCAGCGCACCCACAGCCGG + Exonic
982090375 4:151875327-151875349 GGCCCCAGTGCAGCTACAGATGG - Intergenic
982217430 4:153094628-153094650 GACCGCAGGGCAGAACCAGCAGG - Intergenic
984710676 4:182881492-182881514 GGCCCCAGGTCATACCCAGGAGG - Intergenic
984727762 4:183037723-183037745 GGACCCAGGGGAGCCAAAGCCGG - Intergenic
984766473 4:183404155-183404177 GGCCCCAGGGCAGCTGCACTGGG - Intergenic
985555666 5:556800-556822 GGGCCCGGGGCAGCATCAGCAGG + Intergenic
985621039 5:956334-956356 GGACTCAGGGCAGTGCCAGCTGG + Intergenic
985748303 5:1660166-1660188 GGCAGCTGGGCAGCCCCTGCCGG - Intergenic
985760531 5:1746479-1746501 GGTCCCCGGGCAGCCCAGGCAGG - Intergenic
985788828 5:1914585-1914607 GGCCCCAGCCAAGCCTCAGCAGG - Intergenic
985792660 5:1938843-1938865 GGACTCAGTGCAGCCCCACCTGG + Intergenic
985822080 5:2167201-2167223 GGCCCAAGGAGAGCCCCAGCTGG + Intergenic
985950481 5:3218577-3218599 GCCCCCAGGGCAAGCCCTGCAGG + Intergenic
986151864 5:5137301-5137323 GGCTTCAGGACAGCCCTAGCAGG + Intergenic
986447770 5:7837813-7837835 GGCCCCTGGCCAGCCACTGCGGG + Intronic
988350959 5:30106656-30106678 GGCCCCACAGCAGCATCAGCGGG - Intergenic
989229908 5:39074204-39074226 GGAGCCAGGGCAGCCGCAGCTGG - Intronic
990727588 5:58773906-58773928 GGCACCAGGACAACCTCAGCTGG + Intronic
992052581 5:72955387-72955409 GGCCTGCGGGCCGCCCCAGCTGG + Intergenic
992111546 5:73498720-73498742 GCCCCCAGGGCAGCCGCCCCTGG - Exonic
996056472 5:118988378-118988400 GCGCCCAGGGCAGCCGCCGCCGG + Exonic
996675210 5:126167663-126167685 GGCCCCAGGGCAGCATATGCTGG + Intergenic
997232152 5:132253173-132253195 TGGCTCAGCGCAGCCCCAGCAGG - Intronic
998092666 5:139380320-139380342 GGGCCCCAGGCAGCCCCAGCAGG + Exonic
1001081726 5:168672233-168672255 GTGCCGAGGGCAGCCCCAGAAGG - Intronic
1001118907 5:168962649-168962671 CCCCCCAGGGCAGCCTGAGCTGG + Intronic
1001314374 5:170632109-170632131 GTCCCCAGGCCAGGCTCAGCTGG + Intronic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1001889966 5:175330547-175330569 GGCCCCAGGACATCCCCAGAAGG - Intergenic
1001907737 5:175487068-175487090 GGCCCGAGGGCAGGCACAGGAGG + Intronic
1001908104 5:175489890-175489912 GGCCCGAGGGCAGGCACAGGAGG - Intronic
1001960762 5:175879151-175879173 GGATCCAGGGGAGCCCCAGCAGG - Intronic
1002021916 5:176368892-176368914 GGGCCCAGGGCAGCCGCAGTCGG - Exonic
1002057742 5:176608512-176608534 GGCCCCAGAGTGGCCCAAGCTGG - Intronic
1002345266 5:178544293-178544315 GCCCCCAGCCCAGCCCCTGCTGG + Intronic
1002488050 5:179553122-179553144 AGCCCCAGGGCAGCTCGAGTGGG - Intronic
1002508725 5:179698894-179698916 GGCCCCTGAGTAGCCACAGCCGG - Exonic
1002763287 6:218216-218238 GTCCCCGGGGCCTCCCCAGCAGG - Intergenic
1002835405 6:861327-861349 GGGCCCAGGGAAGACTCAGCGGG + Intergenic
1003174764 6:3746409-3746431 GGCCCCATGGGAGCCCTGGCAGG + Intronic
1004614859 6:17280707-17280729 GGACCCGGCGCAGCACCAGCCGG - Intergenic
1005814835 6:29542114-29542136 GGTTCCAGGGTAGTCCCAGCAGG - Intergenic
1005999837 6:30956203-30956225 GACACCAAGGCAGCCCCACCTGG + Intergenic
1006379476 6:33689169-33689191 GGCCCCAGAGCAGGTCCAACAGG - Intronic
1006580055 6:35071919-35071941 GGTTGCAGGGCAGCCCCAGATGG - Intronic
1006939484 6:37742479-37742501 GGCCTCAGGGGTCCCCCAGCTGG - Intergenic
1006945125 6:37779608-37779630 GGGCCCAGGGGAGGGCCAGCTGG - Intergenic
1006984817 6:38169338-38169360 GCCACCAGGGCAGCACCAGGAGG + Exonic
1007284242 6:40736370-40736392 TCTCCCAGGGCAGGCCCAGCAGG + Intergenic
1007284263 6:40736428-40736450 CCTCCCAGGGCAGGCCCAGCAGG + Intergenic
1007664373 6:43505761-43505783 GCCCCCAGCGCAGCCCCAAGAGG + Exonic
1007831634 6:44643374-44643396 GTCCCCAGGGCAGGCCCCTCTGG - Intergenic
1009985642 6:70778737-70778759 GGCCCCTGGGCAGTCCATGCTGG + Intronic
1015412732 6:132913192-132913214 GCAGCCAGGGAAGCCCCAGCTGG + Intergenic
1016330273 6:142946569-142946591 GGCCCCACGGCTGCCGCTGCGGG + Intergenic
1018217207 6:161540080-161540102 GCCGCCAGGTCTGCCCCAGCTGG + Intronic
1019093103 6:169556300-169556322 GTCCCCAGGGAAGCCTCAGAAGG + Intronic
1019143354 6:169962007-169962029 GGCGCCGGCGCAGCCCCAGGAGG + Intergenic
1019151238 6:170007314-170007336 GGGCCCAGAGCCGCCCCAGGTGG - Intergenic
1019176054 6:170160087-170160109 GGGCCTCGGGCAGCACCAGCAGG + Intergenic
1019277456 7:183258-183280 GGACCAAGGGCAGGCACAGCTGG + Intergenic
1019333822 7:473331-473353 GGCCCCTGTGCAGCCCCATGGGG - Intergenic
1019347079 7:536341-536363 GGGCCCAAGCCAGCCCCACCTGG + Intergenic
1019430414 7:996502-996524 GGCCCCGGGGCAGCAGCACCTGG + Intergenic
1019626940 7:2020586-2020608 GGTACCAGGGCAGCCCGGGCAGG - Intronic
1019649942 7:2151466-2151488 GGCCCCAGGGTTCTCCCAGCTGG + Intronic
1019711472 7:2520003-2520025 GGCGCCGGGGCAGCCCCCGCGGG - Exonic
1019746321 7:2702161-2702183 GCTCCCAGGGCAGCCCCTGAAGG - Intronic
1019747655 7:2709562-2709584 GATCCCCAGGCAGCCCCAGCAGG - Intronic
1019910831 7:4099780-4099802 GGCCCAAGGGGAGCCGCAGCTGG + Intronic
1020253025 7:6484257-6484279 CGCCCCAGCGCAGGCTCAGCAGG + Intergenic
1020272464 7:6605542-6605564 GTCTCCAGGGCAGGACCAGCAGG - Intronic
1020292176 7:6730279-6730301 GGCCTCTGGGGAGCCCCAGGAGG + Intergenic
1021687981 7:23206076-23206098 GGCCAGTGGGCAGCCACAGCGGG - Intergenic
1022610641 7:31867830-31867852 GGCCCAAGGTCAGGCCCAACTGG + Intronic
1022955335 7:35375142-35375164 GGCCCCAGGGCAGATACCGCCGG + Intergenic
1023016000 7:35968938-35968960 TCCCCCAGGCCAGCCCGAGCTGG - Intergenic
1023791927 7:43759154-43759176 GACCCCAGGGCATCCCAGGCGGG - Intronic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1024281805 7:47724741-47724763 GACCCCAGGGTGGCCCCAGCAGG + Intronic
1024570939 7:50722340-50722362 GGCCCCAGGGTAACCCCGCCTGG + Intronic
1025976887 7:66377117-66377139 TGCCTCACGGCAGCCCCGGCAGG - Intronic
1026836752 7:73644854-73644876 GGCCCCATGCCGGCCCCATCAGG + Intergenic
1026841296 7:73671218-73671240 GGCCCCCGGGCGGCCCCAGTGGG - Exonic
1026957890 7:74389277-74389299 GGCCACAGGGAGGACCCAGCCGG - Intronic
1027056594 7:75053697-75053719 GGGCCCAGGAGTGCCCCAGCTGG - Intronic
1027518276 7:79169560-79169582 GCCACCAGGGCAGGCTCAGCTGG + Intronic
1027769833 7:82392577-82392599 GGCCCCAGGCCTGCCACAGGAGG - Intronic
1028242698 7:88440204-88440226 GGCCACAGAGGAGACCCAGCTGG - Intergenic
1028752316 7:94394772-94394794 GGGGCCCGGGCAGCCACAGCTGG - Exonic
1029127083 7:98301903-98301925 GGCACCAGGTCACCCCCTGCAGG + Intronic
1029494401 7:100889421-100889443 GGCCCGAGAGCAGCGCCAGGCGG + Exonic
1029733820 7:102454639-102454661 CGCTCCAGAGCAGGCCCAGCGGG - Exonic
1030112631 7:106039576-106039598 GGCCCTAGGCCAGCCTCACCCGG - Intergenic
1032016576 7:128383949-128383971 GGTGCCAGGGCAGCTTCAGCTGG - Intergenic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1032325809 7:130927191-130927213 GTTCCCAGGGCAGCCACAGATGG - Intergenic
1032780586 7:135162315-135162337 GGCCTCCTGGAAGCCCCAGCAGG - Intronic
1032842635 7:135726507-135726529 GTCTCCAGGGCAGTGCCAGCTGG + Intronic
1034456943 7:151175751-151175773 GGCCTCAGGAGAGCCCCAGTAGG + Exonic
1034468396 7:151243166-151243188 GGGCCCAGGGGAAGCCCAGCAGG - Intronic
1034882501 7:154773207-154773229 GGCCCCAGGCCTGCCTCAGGGGG + Intronic
1034899223 7:154897201-154897223 GACCCCTGGGGAGCCCCAGCAGG - Intergenic
1035212386 7:157337464-157337486 AGCCCCAGCCGAGCCCCAGCCGG - Intronic
1035258032 7:157644397-157644419 GTCGTCACGGCAGCCCCAGCAGG + Intronic
1035327737 7:158075812-158075834 AGCCCCACGCCAGCCACAGCTGG + Intronic
1035372834 7:158390473-158390495 TGCCCCAGGACAGTCACAGCAGG + Intronic
1035415262 7:158678350-158678372 TGCCGCAGGCCAGACCCAGCTGG + Intronic
1035453998 7:158997281-158997303 TTCCCCTGGGCAGCCCCCGCGGG + Intergenic
1036454062 8:8892930-8892952 GGCCCCGGGGCAGGCCCCGGCGG + Exonic
1036579003 8:10055055-10055077 GGACCCAGGGCACCTGCAGCGGG + Intronic
1036691817 8:10949136-10949158 GGCCCCGGGGCTGCCTCTGCAGG + Intronic
1037817049 8:22117864-22117886 GACCCTAGGGGAGTCCCAGCTGG + Intronic
1037821564 8:22137610-22137632 GTCCCCAGAGCTGCCCCAGGGGG + Intergenic
1037827114 8:22165979-22166001 AGCCCCAGGGCAGCCCAGACAGG - Intronic
1038149194 8:24927672-24927694 GGCCCCAGGGCAGAAGCTGCTGG - Intergenic
1039441558 8:37598677-37598699 GGCCCCAGGGCAGCTGAAGAGGG - Intergenic
1039568029 8:38564924-38564946 GATCCCAGGGCAGCCACGGCTGG + Intergenic
1040286054 8:46100956-46100978 GCCCCCAGGGCTGTCCCAGGTGG - Intergenic
1040294491 8:46142176-46142198 GCCCCCAGGGCTGCCCCAGATGG - Intergenic
1040310782 8:46235774-46235796 TTCCCCAGGGCAGTCCCAGGAGG + Intergenic
1040312218 8:46242665-46242687 GACCCCAGGGCTGTCCCAGGTGG + Intergenic
1040314795 8:46255243-46255265 GCCCCCAGGGCTGTCCCAGATGG + Intergenic
1040325465 8:46339341-46339363 GCACCCAGGGCTGTCCCAGCGGG + Intergenic
1040329300 8:46377818-46377840 GCCCCCAGGGCTGTCCCAGGCGG + Intergenic
1040331725 8:46389060-46389082 GCCCCCAGGGCTGTCCCAGGTGG + Intergenic
1040332106 8:46390997-46391019 GCCCCCAGGGCTGTCCCAGGAGG + Intergenic
1040336878 8:46420568-46420590 GCCTCCAGGGCTGCCCCAGGCGG + Intergenic
1040338869 8:46429891-46429913 GCCCCCAGGGCTGTCCCAGATGG + Intergenic
1040397711 8:47015341-47015363 ATTCCCTGGGCAGCCCCAGCTGG + Intergenic
1044325477 8:90853075-90853097 GGCCCCATGGCAGCCTCAAGGGG - Intronic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1046690896 8:117283027-117283049 GGCCCCAGGCCTGCCACAGGAGG - Intergenic
1047731887 8:127735281-127735303 GGCCCCACGGAAGCCTGAGCAGG + Intergenic
1048468399 8:134686100-134686122 GTGCCCTGGCCAGCCCCAGCAGG + Intronic
1048919614 8:139215982-139216004 GGGCCCAGGGCAGCTCTTGCTGG - Intergenic
1048951725 8:139502042-139502064 GTCCCCAAAGCAGCCTCAGCTGG - Intergenic
1049280732 8:141742825-141742847 GGCCCATGTGCAGCCCCAGTTGG - Intergenic
1049283461 8:141762247-141762269 GGCCCCAGCCCAGCCTCAGAAGG - Intergenic
1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG + Intronic
1049491635 8:142906707-142906729 GACCTCAGCACAGCCCCAGCAGG - Intronic
1049538386 8:143193723-143193745 AGCCGCCCGGCAGCCCCAGCTGG + Intergenic
1049612273 8:143561178-143561200 GGGCCCACGGCAGCCCAAGCTGG - Intronic
1049748628 8:144273416-144273438 GGCCCCAGGCCAGCACCACGGGG + Intronic
1049813929 8:144589351-144589373 TGCCCCAGGGTAGGCCCTGCCGG - Intronic
1049960570 9:734329-734351 GGCCCCAAGCCAGCCCAGGCAGG - Intronic
1051897982 9:22008767-22008789 GGCCCCAGGGCCTCGCCGGCAGG - Intronic
1052731460 9:32291228-32291250 TGCCCCACAGCAGCCCCAGCAGG - Intergenic
1052893133 9:33721864-33721886 GGCCGCAGGGCGGCCTCGGCAGG - Intergenic
1053435227 9:38069455-38069477 GGCGCCAGGGCAGCCGCGGGAGG - Intergenic
1055187534 9:73474383-73474405 GGCCCCAGTGAGGCCCCATCTGG - Intergenic
1056237247 9:84607250-84607272 GGCCCCAGAGCAGAGTCAGCAGG + Intergenic
1056329713 9:85511319-85511341 GGCCCTGGCCCAGCCCCAGCTGG + Intergenic
1056750671 9:89348746-89348768 TGCCCCATGGCAACCCCACCAGG + Intronic
1056921017 9:90789395-90789417 GGCCCAAGGCCTGCCCCTGCTGG - Intergenic
1057131264 9:92656071-92656093 GACCCCAGGACAGCCCCAGCAGG + Intronic
1057147130 9:92765502-92765524 GGCCCCTGGGCGCCCCCTGCTGG - Intergenic
1057385384 9:94601860-94601882 TCCCAGAGGGCAGCCCCAGCTGG + Intergenic
1057551491 9:96054011-96054033 GGGGCCGGGGGAGCCCCAGCAGG - Intergenic
1059433829 9:114264934-114264956 GACCCCAGGGCAGACCGGGCCGG + Exonic
1059437333 9:114284607-114284629 GGTCCCAGCTCTGCCCCAGCTGG - Intronic
1059921654 9:119167218-119167240 GGCCCCGGGGAAACCCCAGCTGG - Exonic
1060544123 9:124450489-124450511 GGCGCCAGGCCAGCCATAGCGGG + Intergenic
1060796036 9:126513847-126513869 GGCCACGGGGAAGCCCCACCAGG + Intergenic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1060915125 9:127384397-127384419 TGCCCCAGGGCAGCCAGGGCAGG + Intronic
1060937906 9:127526672-127526694 GCCCTCAGGGAAGCCCCACCTGG - Intronic
1061006233 9:127929816-127929838 GGCGCCAGAGAAGCCCCCGCCGG + Exonic
1061061087 9:128250816-128250838 CCCCCCAGGGCGGACCCAGCAGG - Exonic
1061235334 9:129339077-129339099 GGCCCCAGAGCTGCCCCACTAGG + Intergenic
1061309531 9:129753127-129753149 CGCCCCACGGCAGCGGCAGCAGG + Intergenic
1061359553 9:130132323-130132345 CTCCCCAGGGCAGCCTGAGCAGG + Intronic
1061662855 9:132141769-132141791 AGCTCCACGGCAGCTCCAGCTGG + Intergenic
1061991233 9:134159775-134159797 GGCCCCAGGACCCCCACAGCAGG - Exonic
1062095830 9:134702747-134702769 GGCCTCAGGGCAAGCCCACCTGG + Intronic
1062212314 9:135371808-135371830 GGCCCCAGAGCAGCCCACGGAGG + Intergenic
1062277207 9:135736678-135736700 GGCCCGGGGGGCGCCCCAGCCGG + Intronic
1062326303 9:136014150-136014172 TGGCCAAGGCCAGCCCCAGCAGG + Intronic
1062340327 9:136091208-136091230 GCCCCCAGGCCAGCCCCAGCCGG + Intronic
1062389527 9:136328355-136328377 GGGCCCAGGGCAGCCCCTGGGGG - Intronic
1062390581 9:136332099-136332121 GGCCCACGGGCAGCAGCAGCGGG - Intronic
1062442998 9:136579408-136579430 GGGCCCAGGGCAGCCCTGGCAGG + Intergenic
1062449404 9:136609240-136609262 GCCCCCAGGGCAGGGCCAGGCGG + Intergenic
1062452945 9:136623156-136623178 GCTCTCAGGGCAGCCCCGGCCGG + Intergenic
1062541579 9:137043986-137044008 GGAGCCAGGGGAACCCCAGCAGG + Intronic
1062586228 9:137251161-137251183 GGGCCCGGGGCAGCCCCTCCAGG + Intergenic
1062718822 9:138024197-138024219 GGCCCAAGGGAAGCCTGAGCAGG + Intronic
1185786095 X:2892209-2892231 GACCCCAGGCCAGGCACAGCAGG + Intergenic
1186792248 X:13010649-13010671 GGCCCCAGTGAGGCCCCAGGTGG - Intergenic
1187571806 X:20511637-20511659 GGCCAATGGGAAGCCCCAGCAGG + Intergenic
1190054950 X:47175932-47175954 GGCCCCAGGGCTGCCTCTGCCGG - Intronic
1190332208 X:49242932-49242954 GGACCCAAGGCAGTGCCAGCTGG - Exonic
1191650224 X:63529273-63529295 GGCACCAGCTCAGCCACAGCAGG + Intergenic
1193017249 X:76749620-76749642 GGCCTCAGGTCAGACCCACCTGG + Intergenic
1193300358 X:79881606-79881628 GGCCCCAGGGAAGCAGCAGTGGG - Intergenic
1197929233 X:131678295-131678317 GGCCCCAGGCCAGGCCCTGATGG - Intergenic
1198583804 X:138096735-138096757 GGCCCCAGGGCAGCATATGCTGG - Intergenic
1200098238 X:153674018-153674040 GGCCCTGGGGCCGGCCCAGCCGG - Exonic
1200119795 X:153784863-153784885 GGGCACAGGGCAGCCCGGGCGGG - Intronic
1200138566 X:153886332-153886354 GGCCCCCGGGCAGCCCACTCCGG + Intronic