ID: 1133100504

View in Genome Browser
Species Human (GRCh38)
Location 16:3476378-3476400
Sequence CCTCAGGTGCAGAAGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133100490_1133100504 26 Left 1133100490 16:3476329-3476351 CCCCATCGAGTAAGTGGAGCGGA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 269
1133100492_1133100504 24 Left 1133100492 16:3476331-3476353 CCATCGAGTAAGTGGAGCGGATT 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 269
1133100491_1133100504 25 Left 1133100491 16:3476330-3476352 CCCATCGAGTAAGTGGAGCGGAT 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133100504 Original CRISPR CCTCAGGTGCAGAAGCTGGG CGG Intronic
901523560 1:9804530-9804552 TCTTAAGTGGAGAAGCTGGGTGG - Intronic
903605624 1:24573136-24573158 CCTCAGGTGTGAAGGCTGGGAGG - Intronic
903650202 1:24917340-24917362 TCTCATGGGCAGCAGCTGGGTGG - Intronic
903786390 1:25863906-25863928 CCCCACGAGCAGCAGCTGGGGGG + Intronic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
904773916 1:32895335-32895357 CCTCAGCTCCAGCAGCTGGTGGG + Exonic
905203785 1:36331197-36331219 AATCAGATTCAGAAGCTGGGTGG - Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905408440 1:37752985-37753007 CCGCAGGTGCAGCAGCGTGGCGG + Exonic
905490996 1:38343673-38343695 CCTCAGCTGCAGAAGCAAAGAGG + Intergenic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
907937540 1:59056286-59056308 CATCATGTGAAAAAGCTGGGAGG + Intergenic
908885579 1:68784895-68784917 CCACAGGAGCAAAAACTGGGAGG - Intergenic
909649269 1:77955394-77955416 CCTTGGGTGCAGGAGCTGGCAGG + Intronic
912382673 1:109255749-109255771 CCTCAGGTGCAAAGGCAGGATGG - Intronic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
914688990 1:150009180-150009202 CTTCAGGGACGGAAGCTGGGTGG - Intronic
915107331 1:153542617-153542639 GGTCAGGTGCAGAGGCTGGAGGG - Intergenic
915330789 1:155111166-155111188 CCCCAGGTTCCCAAGCTGGGTGG - Intergenic
915917013 1:159946205-159946227 CCTCAGCTGCACACGGTGGGAGG - Intergenic
916012993 1:160723772-160723794 CTTCAGGTGGAGAAAATGGGCGG + Intergenic
917345208 1:174022254-174022276 CCTCAGCAGCAGCAGGTGGGAGG - Exonic
918042964 1:180924336-180924358 CCTCAGGTGTGGGACCTGGGTGG - Intronic
918238036 1:182599155-182599177 CTTAGAGTGCAGAAGCTGGGGGG - Exonic
918288776 1:183085469-183085491 CCTCAGGTGGCTAAGGTGGGAGG - Intronic
919848139 1:201654512-201654534 CCTCAGGGTCAGAGGCTGTGAGG - Intronic
920159079 1:203982013-203982035 CCCCAGCTGCAGAACCTAGGAGG - Intergenic
920229218 1:204459558-204459580 CATCAAGTGCAGCAGCTGGGGGG + Intronic
920684871 1:208101761-208101783 CCACAGGCACTGAAGCTGGGAGG + Intronic
923103636 1:230837430-230837452 TCCCAGGTGCAGAGACTGGGGGG + Exonic
923897219 1:238284926-238284948 CCTCAGGTGCCGTTGCTGGCAGG + Intergenic
924208280 1:241737567-241737589 CTTCAGTTGTAGAAGCTGGGGGG - Intronic
1063010711 10:2019671-2019693 CCTCAGGTGAAGATGTGGGGAGG - Intergenic
1065747221 10:28853518-28853540 CTTCAGGACCAGAAGCAGGGTGG + Intronic
1068326222 10:55491348-55491370 CCTTACGTGGACAAGCTGGGTGG - Intronic
1069570814 10:69493258-69493280 CCCCCGGGGCAGAAGTTGGGTGG - Intronic
1069800352 10:71078071-71078093 CCTAGGGTGCAGAAGCTGTGGGG - Intergenic
1071960434 10:90804503-90804525 GAGCAGGTGCAGGAGCTGGGGGG - Intronic
1073423161 10:103440528-103440550 CCACAGGCGCAGAAGCGGGGCGG + Exonic
1074296196 10:112191856-112191878 CTTCAGATGCAGAACCTTGGAGG + Intronic
1074820620 10:117175487-117175509 CCTCCGGAGCTGATGCTGGGTGG + Intergenic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1076857934 10:133126756-133126778 CCTCAGGGGAAGAAGGTCGGAGG - Intronic
1076871674 10:133197795-133197817 TGTCAGGTGCAGGAGCTGGTGGG - Intronic
1077548591 11:3188844-3188866 TGTCAGGTCCAGCAGCTGGGAGG - Intergenic
1078002166 11:7505720-7505742 ACTCAGGAGGAGAAGGTGGGGGG + Intronic
1078084205 11:8224155-8224177 CTTTAGGGGAAGAAGCTGGGAGG - Intergenic
1078357965 11:10647014-10647036 CCTCAGGAGCACAAGCTCGTGGG - Intronic
1080689091 11:34540943-34540965 CTTCAGGGGCAGAAGCAGAGAGG - Intergenic
1087848032 11:102995379-102995401 CTTGAGGTGCAGTAGCTGGCTGG - Intergenic
1089348057 11:117804236-117804258 CCTCAGTTACAGAATCTGAGAGG + Intronic
1089633458 11:119797499-119797521 CCTCAGGATCAGGAGCTTGGGGG - Intergenic
1089653903 11:119933269-119933291 CGGCAGTGGCAGAAGCTGGGAGG - Intergenic
1090053362 11:123400607-123400629 CCTCATGTGCAGAAGTGGTGAGG + Intergenic
1090394200 11:126408099-126408121 CCTCAGGTGCCGCCGCTGTGTGG + Exonic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1090983332 11:131743651-131743673 CCACAGGTGCAGTAGCTTGCAGG - Intronic
1091264997 11:134263406-134263428 CCTCTGGAGCAGAAGCTCTGGGG - Intronic
1091873164 12:3912034-3912056 CCCCATGTGCAGAAGCTTGAGGG + Intergenic
1094199328 12:27780475-27780497 CCGGAGGTGCAGCAGCTGCGCGG + Exonic
1096084057 12:48853338-48853360 TCTCTGGAGTAGAAGCTGGGAGG - Intergenic
1098501935 12:71202944-71202966 CCACAAATGCAAAAGCTGGGTGG + Intronic
1100285114 12:93157773-93157795 CCACAGGGGCTGAAGCTGGATGG + Intergenic
1100287165 12:93177925-93177947 GCTCAGGCACAGAAGGTGGGGGG + Intergenic
1100376277 12:94018844-94018866 CCTCAGTTGGAGAACCTAGGAGG + Intergenic
1102218845 12:111180694-111180716 CCACAGCTGCAGGAGCTGAGAGG - Intronic
1103414808 12:120736980-120737002 GCCCAGGTGAAGAAGATGGGCGG + Exonic
1104836591 12:131795888-131795910 CCTCTGCTGCAGAAGCTGCCAGG - Intronic
1107828210 13:44350101-44350123 CCCCAGGCAGAGAAGCTGGGAGG - Intergenic
1107890803 13:44912568-44912590 TCTCGGGTGGGGAAGCTGGGAGG + Intergenic
1108699369 13:52930634-52930656 CCTGAGGTGCAGACGCTTGTGGG + Intergenic
1109378367 13:61525792-61525814 GCTCAGGTGCCCAAGCTGAGAGG + Intergenic
1111902629 13:94218626-94218648 CAGCAGGTGCAGAAGCCTGGGGG - Intronic
1112269512 13:97955630-97955652 CCTCAGACGCCGGAGCTGGGAGG + Intronic
1113638585 13:111939843-111939865 CCTCACGTGCAGACGATGAGGGG - Intergenic
1113744010 13:112730245-112730267 CCTCCGGTACAGAAGCTCTGCGG - Intronic
1115238341 14:31230113-31230135 TCTGAGGTGCAGAGGCTGAGAGG + Intergenic
1119260453 14:73235231-73235253 TCTCAGGTGCAGACACTGAGTGG + Intergenic
1119430901 14:74567451-74567473 CCTCAGGGGCAGAGGCGGGGTGG + Intronic
1119788810 14:77331225-77331247 CCACAGGAGCAGAAGCTGGGTGG + Exonic
1120744797 14:88143620-88143642 ACCCAGGTGCCCAAGCTGGGAGG - Intergenic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121255996 14:92530877-92530899 ACCCAGGTGAAGAACCTGGGAGG + Intronic
1121476467 14:94211474-94211496 CCTAAGGTGAAAGAGCTGGGTGG + Intronic
1122862646 14:104589398-104589420 CTTCAGGTGTAGAAGCCGAGGGG + Exonic
1123049256 14:105532700-105532722 CCGCAGGTGCAGCAGCCTGGAGG + Intergenic
1125921179 15:43526864-43526886 TCTCAGGTGGGGAAGCTGGAGGG - Exonic
1125957731 15:43802009-43802031 CCTCATGTGCAGATGCTAGGTGG + Exonic
1126697711 15:51340340-51340362 CCTCAGGTGCTGAAACAGTGTGG + Intergenic
1126802754 15:52315257-52315279 CCACACTTGCAGAAACTGGGAGG + Intronic
1127757168 15:62103973-62103995 CCTCAGGTGCAGAATTTCAGAGG + Intergenic
1128236605 15:66071900-66071922 CGTCAGATGCTGATGCTGGGTGG - Intronic
1128860976 15:71071753-71071775 CCACTGGGGCAGAAGTTGGGTGG + Intergenic
1129609103 15:77038825-77038847 CCCCAGGTGGAGGAGCTGGAGGG + Intergenic
1132463959 16:69076-69098 TCTGAGGGGCAGGAGCTGGGGGG + Intronic
1132538878 16:498280-498302 CCTCAGGAGGAGGAGGTGGGAGG - Intronic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1133291670 16:4726542-4726564 CCTCTCGTGCCGAAGCAGGGTGG + Intronic
1133338248 16:5020586-5020608 GCTGGGGAGCAGAAGCTGGGTGG - Intergenic
1133988011 16:10683262-10683284 CCTCAGGATCAGGAACTGGGTGG + Intronic
1137774827 16:51045980-51046002 CCCCAGAAGCAGAAGCTGGGAGG + Intergenic
1137910664 16:52374551-52374573 CCTCAAGTTCCAAAGCTGGGAGG + Intergenic
1139611342 16:68061212-68061234 CCTCAGGGAGAGAAACTGGGTGG - Intronic
1139649994 16:68357460-68357482 CCTCAGAAGCACAAGCAGGGGGG - Exonic
1139671115 16:68492964-68492986 CCTCAGGGGCAGAGGATGTGGGG + Intergenic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141510097 16:84506268-84506290 TCTCAGGTGCAGGTACTGGGGGG + Intronic
1141579671 16:84988598-84988620 CCGCAGGAGCAGGAGCGGGGTGG + Intronic
1141648021 16:85377824-85377846 CCACATGTGCAGGAGCTGGGGGG + Intergenic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1143097917 17:4488298-4488320 CCTGAAGTGGGGAAGCTGGGGGG + Intergenic
1143497860 17:7322718-7322740 CCCCAGGTGCGGCAGCAGGGCGG - Exonic
1144657681 17:17047943-17047965 GAGCAGGTGCAGAGGCTGGGAGG + Intronic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1146886565 17:36474765-36474787 GCCCAGGTGCCGTAGCTGGGAGG + Intergenic
1148778731 17:50110101-50110123 TCTCAGGTGCAGATGCACGGCGG - Exonic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1151305854 17:73262298-73262320 CCTCATGGGAAGAAGCGGGGAGG - Intronic
1152406329 17:80100121-80100143 CCACAGGTCCACAAGCTGGTGGG + Exonic
1152727950 17:81956866-81956888 CATCAGGTGCCGCAGCGGGGAGG - Exonic
1153692439 18:7607034-7607056 ACTCAGGTGCCTAACCTGGGAGG + Intronic
1153851235 18:9097050-9097072 CTTCAGCTGCAGAAGCTGCTAGG + Intergenic
1154195771 18:12265419-12265441 CCTCAGGGACAGATGCTGGGAGG + Intronic
1154348803 18:13566065-13566087 CCCCAGGAGCAGGGGCTGGGAGG - Intronic
1154401842 18:14046223-14046245 CCTTGGGTGGGGAAGCTGGGAGG - Intergenic
1155422204 18:25667589-25667611 CCTTAGGTGCAGATGCAGGCAGG - Intergenic
1156527254 18:37778594-37778616 CCTCAGGTGCAGAAGGGAGGTGG - Intergenic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1158896189 18:61915934-61915956 CCTCTGGGGGAGAAGGTGGGTGG - Intergenic
1159950278 18:74478054-74478076 CCTCAGGTGCTGGAGCTGACAGG - Intergenic
1160740081 19:681555-681577 GCGCAGGTGCAGACGCAGGGCGG + Exonic
1161062310 19:2221446-2221468 CCTCATTGGCAGAAGCAGGGAGG + Intronic
1161347610 19:3776086-3776108 CCTCATGAGCAGCTGCTGGGAGG - Intergenic
1161348210 19:3778320-3778342 CCTCATGAGCAGCTGCTGGGAGG - Exonic
1164468037 19:28504947-28504969 CCTCTAGAGCAGAAGGTGGGAGG - Intergenic
1165004188 19:32790958-32790980 TCTCAGTTGCAGAAGCTGAAGGG + Intronic
1165782822 19:38443791-38443813 CAACAGGTGCAGCAGCTGGAGGG + Exonic
1166416152 19:42596053-42596075 TCTCATGTACACAAGCTGGGGGG - Intronic
1168136401 19:54355237-54355259 CCTCAGGTGCAGAGGCCAGGTGG + Exonic
1168153362 19:54460610-54460632 CCTGAGGTGGGGAGGCTGGGAGG + Intronic
1168246302 19:55114489-55114511 CCCCAGGTGGAGAAACTGGCCGG + Intronic
925611567 2:5706368-5706390 ACTGGGGTGGAGAAGCTGGGAGG + Intergenic
925611596 2:5706456-5706478 GCTGGGGTGGAGAAGCTGGGAGG + Intergenic
926118044 2:10225628-10225650 GCTCAGGTGCTGCAGCTGGGAGG - Intergenic
926153290 2:10436234-10436256 GCCCAGGAGCAGAAGCTGGCTGG + Intergenic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
932144971 2:69308454-69308476 CCTCAGGAGCAGCCGCTGTGGGG + Intergenic
932748349 2:74354119-74354141 CATCAGTTGCAGCAGCTGGATGG - Intronic
935698331 2:105789090-105789112 CCTCAGCTGAGGAAGGTGGGTGG - Intronic
937870378 2:126782011-126782033 ACCCAGGTGCAGAAGGAGGGAGG - Intergenic
938364824 2:130726678-130726700 CCTTGGGTGCAGACGCGGGGTGG - Intergenic
939081988 2:137673684-137673706 CCTCAGGAGGAGGAGCTGAGGGG - Intronic
939823397 2:146984188-146984210 CATCAGGGGCAGGAGCTAGGGGG + Intergenic
941717311 2:168777539-168777561 CCTCAGGCACAGAAGCTGAGGGG + Intergenic
942917122 2:181324156-181324178 CATCAGGTGAAGATGCTGAGTGG + Intergenic
946178039 2:217933788-217933810 GCACACGGGCAGAAGCTGGGTGG + Intronic
947726889 2:232406744-232406766 CTTCAGGTCAAGAGGCTGGGCGG + Intergenic
948436976 2:237960539-237960561 TCTGAGGGGCAGAAGCTGAGAGG - Intergenic
948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG + Intergenic
948628145 2:239283357-239283379 CCTGAGGTACAGGAGCTGCGGGG + Intronic
1170255193 20:14334642-14334664 CCTCTGGGGCAAAAGGTGGGGGG + Intronic
1171135423 20:22690819-22690841 CCTCAGGTGGAGAAGCTTCAGGG - Intergenic
1171388103 20:24783798-24783820 CCTAACGTGCAGAAACTGTGTGG - Intergenic
1172234316 20:33359735-33359757 CCTCAGAACCAGAAGCTGGCAGG - Intronic
1172597971 20:36163569-36163591 CCTCAGGTGAAGCATCTGAGTGG - Intronic
1173132558 20:40408373-40408395 CCTCAGAGGAAGAACCTGGGTGG - Intergenic
1173403510 20:42745283-42745305 CGCCAGGTGCAGAAACTGGATGG - Intronic
1173591348 20:44227544-44227566 CCTCAGGGGCAGAACCTCAGAGG - Intergenic
1173649739 20:44655583-44655605 ACTAAGGTGCAGAGGCTGGAGGG - Intergenic
1174132393 20:48355191-48355213 TCTCAGGTTCAGAAAATGGGTGG + Intergenic
1175893627 20:62326546-62326568 GCCCAGGAGCAGAAGCGGGGTGG - Intronic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1179321919 21:40300461-40300483 CCAGAGGTGCTGAAGCCGGGTGG - Intronic
1179438437 21:41377585-41377607 TCACAGGGGCAGATGCTGGGAGG - Intronic
1179494085 21:41760739-41760761 CCCCAGGAGGAGCAGCTGGGGGG + Intronic
1180059550 21:45377701-45377723 CCTCAGGAACAGAACCTGAGGGG + Intergenic
1180065232 21:45409004-45409026 GGTCAGGTGCAGAGGCTGGCAGG + Intronic
1181670752 22:24424515-24424537 CCCCAGGTGGAGGAGCCGGGCGG + Intronic
1183319098 22:37154261-37154283 CCTCAGATGGAGAGGCAGGGAGG + Intronic
1183830338 22:40415560-40415582 CCTGTGGTGCCGATGCTGGGTGG - Intronic
1184471912 22:44701199-44701221 CCACAGCTCCAGGAGCTGGGAGG - Intronic
1184667889 22:45998061-45998083 CCTCAGGGGCAGGGACTGGGGGG + Intergenic
1185028656 22:48430049-48430071 GCTCAGGTACAAAAGCTGTGTGG + Intergenic
1185244337 22:49765277-49765299 TCTCAGAGGCAGGAGCTGGGGGG + Intergenic
1185313974 22:50170843-50170865 CTTCAGCTGCAGAAGCAGCGCGG - Exonic
1185408517 22:50671258-50671280 CCTGAGGTCCTGAAGGTGGGTGG + Intergenic
952220584 3:31320287-31320309 TCTCAGGTGCAGAAGTTGAAAGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954702502 3:52457660-52457682 GGTCAGGTGCAGAGGCTGGTGGG + Intronic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
957206428 3:77204987-77205009 CGGCAGGTGCAGGAGCCGGGCGG + Intronic
958993866 3:100878768-100878790 GCACAGGTGGAGAAGCTGGTGGG - Intronic
960101470 3:113747022-113747044 CCTCAGCTGCACAGGTTGGGGGG - Exonic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961825396 3:129596607-129596629 CTTCAGGGGAGGAAGCTGGGAGG - Intronic
962588007 3:136861837-136861859 CTTCAGGTGCAGAAACCAGGGGG + Intergenic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
964485760 3:157183924-157183946 ACCCAGGTGCAGAAGGTGAGTGG - Intergenic
964870724 3:161311341-161311363 CCGCAGGTGCAGAGGCTCAGGGG + Intergenic
968480345 4:830425-830447 CCTGAGGTGTTGAGGCTGGGAGG - Intergenic
968661906 4:1802132-1802154 CTTCGGGGGCAGAAGCTGTGGGG + Intronic
968816217 4:2823224-2823246 CCTCAGGCGCAGGACCTTGGGGG + Intronic
968920265 4:3518798-3518820 CCTCAGGTGCAGGAGGGGTGGGG + Intronic
969438521 4:7202815-7202837 CATCAGAAGCAGAAGCTGGGAGG - Intronic
970609058 4:17708965-17708987 GCTCAGGTCCGGAAGCTGGAAGG - Exonic
971131933 4:23820998-23821020 CCATAGGTGCAGCAGGTGGGTGG - Intronic
972757535 4:42063835-42063857 CATGAGATGCAGAAGCTGAGAGG - Intronic
975983494 4:80183915-80183937 TCTCTGCTGCAGCAGCTGGGAGG - Intronic
979557293 4:122063323-122063345 CCTCAGGTGCAGAATTTAAGGGG + Intergenic
984864943 4:184273315-184273337 GCTCAGGAACAGAAGGTGGGAGG - Intergenic
985480259 5:105859-105881 CGGCAGCTGTAGAAGCTGGGGGG + Intergenic
985563157 5:602089-602111 CCGCAGCTGCAGGAGCTGGGCGG - Intergenic
985667370 5:1188037-1188059 CCACAGCTGCTGAAGCTGGCGGG - Intergenic
985835554 5:2269569-2269591 CCTCCTGTGCCTAAGCTGGGTGG + Intergenic
985844645 5:2335196-2335218 CCACAGGTGCAGGGGCGGGGAGG - Intergenic
988496236 5:31748556-31748578 CCCCAGCAGCAGAAGCTGTGGGG + Intronic
991736224 5:69632856-69632878 CCTCTGCTGCAGATGCTAGGGGG - Intergenic
991812721 5:70488495-70488517 CCTCTGCTGCAGATGCTAGGGGG - Intergenic
994494165 5:100488811-100488833 CCACAGGTGGAGTAGCTGGGAGG + Intergenic
998156987 5:139792555-139792577 CCTCAGGTGAGGAGGCGGGGTGG + Intergenic
998392725 5:141797703-141797725 CCTCAGATGCAGGAGCTCTGGGG + Intergenic
1002523443 5:179803631-179803653 CCTCAGATGGACAGGCTGGGTGG + Intronic
1002761463 6:205731-205753 ACTCAGGAGCAGATGCCGGGAGG - Intergenic
1003051533 6:2785119-2785141 CCTCAGGTGCAGGGGCACGGGGG - Exonic
1003361053 6:5425559-5425581 CCAAAGGTGCAGAAGTCGGGAGG + Intronic
1003373315 6:5550024-5550046 CTTCAGGTGCAAAAGTGGGGAGG - Intronic
1004863326 6:19829046-19829068 CAGCATGTGCAGAAGCTTGGAGG - Intergenic
1005352407 6:24949457-24949479 CTTCACGTGCAGAGGCTGAGAGG - Intronic
1005585492 6:27272782-27272804 TCCTAGGTACAGAAGCTGGGAGG + Intergenic
1006390836 6:33757329-33757351 CATCAGCTGCACAAGCAGGGAGG - Intergenic
1010032770 6:71288449-71288471 CCTCAGCTCCAGGAGCTGGGCGG + Intergenic
1011488613 6:87868668-87868690 CCCCAGGTGGAAAAGTTGGGTGG - Intergenic
1013978752 6:116105218-116105240 ACTCAGGTTCAGAAACTGAGGGG - Intronic
1014013299 6:116501266-116501288 CCTGAGATGCTGAAGCTTGGCGG + Intronic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1018818733 6:167356254-167356276 CTTCAGGAGCAGCACCTGGGTGG + Intronic
1020029079 7:4920353-4920375 GGACAGGTGCAGCAGCTGGGTGG + Intronic
1021174994 7:17440146-17440168 CCACAGCTGGAGCAGCTGGGAGG + Intergenic
1024423780 7:49202002-49202024 CCTCAGTTATACAAGCTGGGAGG + Intergenic
1025968379 7:66297353-66297375 CCTGAGAGGCAGAAGCTAGGTGG + Intronic
1026661590 7:72307669-72307691 CCTCTGGTGCAGATGCCGTGGGG + Intronic
1026854387 7:73743334-73743356 ACTCAGGTTCAAAATCTGGGAGG - Intergenic
1028506072 7:91571592-91571614 CCTCAGGTGCAGTCCCTGTGTGG - Intergenic
1029278422 7:99421317-99421339 CCTCAGGTGGCTAAGGTGGGAGG + Intronic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029432357 7:100539437-100539459 CGTCGGGTGCGGGAGCTGGGTGG + Exonic
1029704173 7:102267116-102267138 CTACAGGTGCAGAGGCAGGGAGG + Intronic
1031031575 7:116741242-116741264 CTTCAGGTGCAGGACTTGGGGGG - Intronic
1034489435 7:151385489-151385511 CCTCAGGGGAAGCAGCTGAGGGG - Intronic
1034959344 7:155355352-155355374 CAGCAGATGCAGAAGATGGGAGG + Intergenic
1035253696 7:157613143-157613165 CCTCAGCCGCAGAACCTCGGTGG + Intronic
1036789310 8:11707888-11707910 CCACAGGCGCAGAAGCTGCTAGG - Exonic
1039406308 8:37315708-37315730 CCTCAGGTGGCGAAGCATGGTGG + Intergenic
1039433161 8:37541546-37541568 CCGCAGGTGCAGAAGATGTTTGG - Intergenic
1039549152 8:38430527-38430549 CGTCAGATGCACATGCTGGGGGG + Intronic
1041143297 8:54845107-54845129 CCAAAGGGCCAGAAGCTGGGTGG + Intergenic
1045004542 8:97906545-97906567 CCTCAGCTTCAGTAGCTGGTTGG - Intronic
1047895694 8:129363982-129364004 CTTCAGATGGAAAAGCTGGGGGG + Intergenic
1047920280 8:129628321-129628343 CCTGTGGTGGAGAAGGTGGGAGG - Intergenic
1048648658 8:136450659-136450681 GCGCAGGTGCAGAGGCTGTGGGG + Intergenic
1048790861 8:138102029-138102051 CTTCAGGTTCAGAATCTGGATGG + Intergenic
1049603123 8:143517286-143517308 CCTCAGGTGCAGGGGAAGGGAGG + Intronic
1049934094 9:484097-484119 TCACAAGTGCAGAAGCAGGGAGG - Intronic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1052353093 9:27476993-27477015 CCCCAGGTGAAGAAGACGGGAGG - Intronic
1053436949 9:38082076-38082098 GCCCAGGTCCAGGAGCTGGGTGG - Intergenic
1053473127 9:38360836-38360858 CTTCAGGGGCAAGAGCTGGGTGG + Intergenic
1055082129 9:72277854-72277876 ACTCAGGTGTAGAACATGGGAGG + Intergenic
1055275906 9:74615398-74615420 GCTCAGGCGCAGAAGGTGGGAGG - Intronic
1056722259 9:89082276-89082298 CCTCTGGTGTGGATGCTGGGAGG - Intronic
1056803968 9:89713619-89713641 CCTGACTTGCAGAAACTGGGTGG - Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1057321614 9:94018188-94018210 CCTAATGTTCAGAAGCAGGGAGG - Intergenic
1059184812 9:112258625-112258647 GCTCAGGTCCAAAATCTGGGAGG + Intronic
1060629541 9:125143368-125143390 CCCCAGGTGCGGGGGCTGGGTGG - Exonic
1060748770 9:126155125-126155147 CCTCAGGTTCAGCAGCAGCGAGG + Intergenic
1061087195 9:128405986-128406008 TCTCAGCAGCAGGAGCTGGGTGG + Intergenic
1061158815 9:128881841-128881863 GGTCAGGTGCCGAGGCTGGGAGG - Intronic
1061297766 9:129686270-129686292 CCTCAGGAGCAGAGGCAAGGAGG + Intronic
1061681565 9:132245055-132245077 CCCCTGGTGCAGAAGGTGGGCGG + Intergenic
1062340262 9:136090950-136090972 GCACAGGGGCAGGAGCTGGGCGG + Intronic
1062399643 9:136366747-136366769 CCTCACTTGGGGAAGCTGGGAGG + Intronic
1186957357 X:14698252-14698274 CCTCAGGGGCAAAATCTGAGGGG - Intronic
1188047437 X:25442697-25442719 CCTCTGCTGAAGAAGCAGGGAGG + Intergenic
1191188554 X:57640109-57640131 CCACAGCTGGAGCAGCTGGGAGG - Intergenic
1196229219 X:113202427-113202449 CTTCAGGTGCAGGGGCAGGGTGG - Intergenic
1196761444 X:119204209-119204231 CCCCAGCTGCTGAGGCTGGGAGG + Intergenic
1197680432 X:129377128-129377150 CCACAGCTGGAGAAGGTGGGAGG - Intergenic
1198236670 X:134742016-134742038 TCACAGGTGCAGGGGCTGGGTGG + Intronic
1199079008 X:143555744-143555766 CCTGAGGTGCAGATGCATGGAGG - Intergenic
1200110033 X:153736339-153736361 CCTCAGGTGACGGAGCTGGCTGG + Exonic