ID: 1133100858

View in Genome Browser
Species Human (GRCh38)
Location 16:3478758-3478780
Sequence TAGGGGAGTGGAGTGATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133100858_1133100864 14 Left 1133100858 16:3478758-3478780 CCTGGAATCACTCCACTCCCCTA 0: 1
1: 0
2: 1
3: 11
4: 261
Right 1133100864 16:3478795-3478817 GAAGTCTCACAGATTCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133100858 Original CRISPR TAGGGGAGTGGAGTGATTCC AGG (reversed) Intronic
900987244 1:6080327-6080349 TAGAGGTGGGGAGAGATTCCTGG + Intronic
901655659 1:10767873-10767895 TGGGGGACTGGGGTGATGCCAGG - Intronic
901673820 1:10871328-10871350 TAGGAGAATGGCGTGAATCCGGG - Intergenic
903181506 1:21607226-21607248 GTGGGGAGTGGAGTAGTTCCTGG - Intronic
905549167 1:38822451-38822473 TAGGGGATTTGGGTTATTCCTGG - Intergenic
906896358 1:49777741-49777763 TAGGGAAGAGGAAGGATTCCGGG + Intronic
907282899 1:53362568-53362590 TAGGGGACTGGAGTTCCTCCAGG - Intergenic
912020013 1:105096377-105096399 TAGGAGAATGGAGTGAACCCGGG + Intergenic
914796075 1:150921419-150921441 TAGGAGAGTGGAGTGAACCTGGG + Intergenic
915263786 1:154699716-154699738 TAGGGGAGGGGAGTTCTTACTGG + Exonic
918525888 1:185464549-185464571 TAGAGGAGAGAAGTGCTTCCAGG - Intergenic
918883372 1:190157104-190157126 TGGGGGAATGGAGGAATTCCTGG - Intronic
919281260 1:195492461-195492483 TAGGAGAGTTGAATGTTTCCAGG + Intergenic
919357375 1:196540971-196540993 TAGGAGAATGGAGTGAACCCGGG + Intronic
920423087 1:205849354-205849376 AAAGGGAGTGGAGTGTTCCCGGG - Intronic
920988340 1:210911879-210911901 GAGGGCAGTGGAGAGATTGCAGG - Intronic
921985000 1:221303381-221303403 TAGAGGAATGGAGTCAATCCTGG - Intergenic
922512866 1:226184096-226184118 CAGGAGAATGGAGTGAATCCGGG + Intronic
1062783996 10:245633-245655 AATGTGAGTGGAGAGATTCCAGG - Intronic
1062884834 10:1008738-1008760 TAGGGGAGAGGAGTGGGTTCAGG - Intronic
1063737737 10:8779978-8780000 TAGGGGAGTTGAGGGAGTTCAGG - Intergenic
1065079660 10:22115473-22115495 TAGGAGGGTGGAGTCTTTCCAGG - Intergenic
1066680769 10:37935462-37935484 GAGGGGAGTGGATTGACTGCCGG + Intergenic
1070321818 10:75360211-75360233 GAGGAGAGTGGCGTGAATCCAGG - Intergenic
1071141016 10:82509633-82509655 TAGGGGAGTGGCAAGACTCCAGG + Intronic
1071360647 10:84842960-84842982 TAGGGGAGTCCATTGGTTCCTGG + Intergenic
1071935065 10:90520564-90520586 TAGGGGTGTGGATTGGTTTCTGG + Intergenic
1072385267 10:94918974-94918996 TAGGTGAGTGGATTTATTTCTGG + Intergenic
1072402133 10:95114407-95114429 TAGGAGAGTGGATTTATTTCTGG + Intergenic
1072679015 10:97492380-97492402 TAGGAGAATGGTGTGATCCCAGG + Intronic
1073530518 10:104227800-104227822 TAGAATAGAGGAGTGATTCCAGG - Intronic
1073928572 10:108546369-108546391 TAGGTGAGTAGATGGATTCCTGG + Intergenic
1074099789 10:110345756-110345778 GGGGAGAGTGGAGTGACTCCTGG + Intergenic
1074635435 10:115310557-115310579 TAGGAGAGTTGTGTGTTTCCAGG + Intronic
1075549217 10:123379704-123379726 TGGAGGAATGGCGTGATTCCTGG - Intergenic
1076007811 10:126962088-126962110 CAGGGGAATGGATTGAATCCGGG - Intronic
1076693293 10:132234643-132234665 TTGGGGAGTGGTGGGATGCCGGG + Intronic
1076931709 10:133536370-133536392 TAGGGGAGTGGATGGATGGCTGG + Intronic
1077621482 11:3728644-3728666 CAGGAGAGTGGAGTGAACCCAGG + Intronic
1077843824 11:6002960-6002982 TGGGGCAGTGGAGTCATTGCTGG + Exonic
1080529799 11:33163631-33163653 CAGGAGAGTGGAGTGAACCCAGG - Intergenic
1081151510 11:39638859-39638881 TAGGAGAATGGAGTGAACCCGGG - Intergenic
1082946366 11:58764925-58764947 TAGGGGAGGAGAGTCTTTCCTGG + Intergenic
1083421314 11:62554772-62554794 TAGGGGAGTGAAGAGAGCCCAGG + Intronic
1084313964 11:68332857-68332879 TGGGGGAGTAGAGCTATTCCTGG + Intronic
1087884839 11:103467628-103467650 CAGGAGAATGGAGTGAATCCGGG - Intronic
1088098378 11:106126402-106126424 TAGGAGAGAGAAGTGATTCTAGG + Intergenic
1089190572 11:116650344-116650366 TAGGGGATTGCATTGATTCCTGG - Intergenic
1089477127 11:118773477-118773499 TAGGGGAATGGCGTGAACCCAGG + Intronic
1090459245 11:126875286-126875308 TAGGGGAGAAGAGTGGTTTCTGG - Intronic
1091120002 11:133049372-133049394 TGGGGTAGTGGAGTGAGCCCTGG + Intronic
1092050976 12:5470015-5470037 TAGGAGAATGGAGTGAACCCGGG - Intronic
1092446979 12:8567151-8567173 TTGGGGACTGGAGTTAGTCCAGG + Intergenic
1092480113 12:8852047-8852069 TATGGGGGAGGTGTGATTCCAGG - Intronic
1093655293 12:21687673-21687695 TAGGGGAGTGTAGTGAGCCTTGG - Intronic
1094395834 12:30004489-30004511 CGAGGGAGTGGAGTGATCCCTGG + Intergenic
1097130645 12:56808681-56808703 TCGGGGACTGGAGTTAGTCCAGG + Intergenic
1097183606 12:57184645-57184667 TGGGGGAGTGGAGAGATGCCTGG + Intronic
1098450869 12:70616875-70616897 TATGGGGGTGGATTGACTCCAGG + Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101679481 12:106951135-106951157 TAGGAGAATGGCGTGAATCCAGG + Intergenic
1101891442 12:108719573-108719595 TAGGGCATTTGAGTGACTCCTGG - Intronic
1103531466 12:121605259-121605281 CAGGGGAATGGAGTGAACCCAGG + Intergenic
1104993112 12:132637612-132637634 GAGTGGAGTGGTGTGGTTCCCGG - Intronic
1105424596 13:20283681-20283703 TTGGGGACTGGAGTTAGTCCAGG - Intergenic
1105913222 13:24890662-24890684 TGGGGGAATAGAGTGATTCGTGG - Intronic
1106726561 13:32492373-32492395 CAGGGGAATGGCGTGAATCCGGG - Intronic
1110111673 13:71755091-71755113 TAGCCAAGTGGAGTGTTTCCAGG - Intronic
1110310876 13:74047502-74047524 TAGGAGAATGGAGTGAACCCGGG + Intronic
1114039278 14:18661216-18661238 CAGGAGAGTGGCGTGAATCCAGG - Intergenic
1117657744 14:57973708-57973730 GAGGGGATTGGAGTGTTTCATGG + Intronic
1117698691 14:58392362-58392384 CAGGGGAGTGGCGTGAACCCGGG - Intergenic
1120161156 14:81145977-81145999 TATGGCTGTGGAGAGATTCCAGG - Exonic
1120297483 14:82662267-82662289 GAGGAGAGTGGAGAAATTCCAGG + Intergenic
1120720937 14:87889113-87889135 TAGGGGAGGGGGGGGGTTCCAGG - Intronic
1122422778 14:101587954-101587976 TGGGGTAGTGGGGTGATCCCAGG - Intergenic
1122466105 14:101934638-101934660 TAGGGGAGTGGAAAGTTTTCAGG + Intergenic
1122561002 14:102614315-102614337 CAGGAGAATGGAGTGAATCCAGG - Intronic
1123430538 15:20211841-20211863 GAGGGGAGTGGACTGGTTCAGGG - Intergenic
1126181817 15:45792807-45792829 GAGAGGAGGGGAGTGATTCTAGG + Intergenic
1126859503 15:52870383-52870405 TAGGGGAGAGAGGGGATTCCAGG + Intergenic
1128597033 15:68962124-68962146 TAGGGGTGTGGCGTTATTTCAGG + Intronic
1129797157 15:78386592-78386614 TGGGGGAGTGGAGTGAGACAGGG - Intergenic
1130828263 15:87572069-87572091 TAGGGGAGTGGTGTGAATGAGGG + Intergenic
1133068251 16:3226143-3226165 TAGGAGAATGGAGTGAACCCAGG - Intronic
1133100858 16:3478758-3478780 TAGGGGAGTGGAGTGATTCCAGG - Intronic
1134363724 16:13556983-13557005 TACTGGAGGGGATTGATTCCAGG - Intergenic
1134409413 16:13991644-13991666 TGGGGGTGTGGAGGGATTCCTGG - Intergenic
1136670870 16:31855744-31855766 TAGGGGAGGGGGATGATTTCAGG - Intergenic
1136854095 16:33639369-33639391 GAGGGGAGTGGACTGGTTCAGGG + Intergenic
1138620779 16:58209591-58209613 TAGGAGAATGGTGTGAATCCGGG - Intergenic
1141050600 16:80759651-80759673 TAGGAGAGTGAAATGATACCTGG + Intronic
1141338460 16:83179557-83179579 CAGGGGAATGGAGTGAACCCGGG + Intronic
1142075967 16:88118033-88118055 CAGGGGAATGGTGTGAATCCAGG - Intronic
1142118411 16:88373342-88373364 TGGGGGAGTGGAATGAAGCCAGG + Intergenic
1142333304 16:89469996-89470018 TAGGAGAGTGGCGTGAACCCGGG - Intronic
1203115672 16_KI270728v1_random:1487808-1487830 GAGGGGAGTGGACTGGTTCAGGG + Intergenic
1143585864 17:7849911-7849933 TAGGGGGGTTGAGTTTTTCCCGG - Exonic
1143696542 17:8624513-8624535 TAGGGGAGTGGAGTGAACAGAGG - Intronic
1144800440 17:17922464-17922486 TAGTGGAGTGGAGAGACTGCAGG + Intronic
1145121725 17:20266489-20266511 TAGGGGAATGGCGTGAACCCGGG + Intronic
1146411572 17:32590216-32590238 TTGGAGAGTTGAGTGATTGCAGG - Intronic
1146495543 17:33318878-33318900 TAGGGAAGGAAAGTGATTCCAGG + Intronic
1146625151 17:34429734-34429756 TCTGGGAGAGGAGTGATTCAGGG + Intergenic
1146646835 17:34581625-34581647 AAGGGAAGTGGACTGACTCCGGG + Intronic
1147292472 17:39455033-39455055 TAGGAGAATGGTGTGAATCCGGG + Intergenic
1147315566 17:39618419-39618441 TAGTGCAGTGGAGTGATTACTGG - Intergenic
1148622333 17:49043898-49043920 CAGGGGAGTGGAGGGTTTCTGGG + Intronic
1150123738 17:62623265-62623287 TGGGGCAGTGGGGTGAGTCCAGG - Intergenic
1151774278 17:76188261-76188283 TGGGGCAGTGGAGTGATCCCAGG - Intronic
1152575004 17:81136162-81136184 GAGGGGTGTGGACTGATGCCAGG - Intronic
1152937009 17:83145033-83145055 TAGGAGAGTGGACGGATGCCAGG + Intergenic
1154428123 18:14287729-14287751 TAGGGGAGTGGGGTGAATAGGGG + Intergenic
1154967765 18:21376710-21376732 CAGGAGAGTGGTGTGAATCCGGG + Intronic
1156671409 18:39474287-39474309 TAGGAGAGTGGCGTGAACCCGGG - Intergenic
1157563574 18:48664713-48664735 GAGGGAAATGGAGGGATTCCAGG - Intronic
1161728409 19:5944242-5944264 CAGGGGTGTGGAGTGAGTCCTGG + Intronic
1161805415 19:6440624-6440646 GCAGGGAGTGGAGTGGTTCCAGG + Exonic
1162599983 19:11661575-11661597 CAGGAGAATGGAGTGAATCCGGG - Intergenic
1165261716 19:34624642-34624664 TTGGGGACTGGAGTTAGTCCAGG + Intronic
1165619617 19:37234479-37234501 CAGGAGAGTGGCGTGAATCCGGG - Intronic
1165739220 19:38195738-38195760 TAGGGGAAGGGAGGGCTTCCTGG - Intronic
1166462236 19:42998397-42998419 TAGGAGAATGGTGTGAATCCAGG - Intronic
1166973472 19:46588157-46588179 TTGGGGGGTGGGGTGCTTCCAGG - Intronic
1167372090 19:49088944-49088966 GATGGGAGTGGAGTGATGGCAGG - Intronic
1168484243 19:56747545-56747567 TAGGAGAGCTGAGTGATTCGTGG - Intergenic
1202653003 1_KI270707v1_random:23757-23779 TCTGGGAGTGGAGAGATGCCAGG - Intergenic
926736193 2:16074834-16074856 CAGGAGAGTGGAGTGAACCCCGG + Intergenic
927360542 2:22227759-22227781 CAGGAGAATGGAGTGAATCCAGG - Intergenic
928639520 2:33283527-33283549 TAGGAGAATGGCGTGAATCCGGG - Intronic
929689056 2:44059550-44059572 TAGGGGAATGGCTTGAATCCAGG + Intergenic
931504751 2:62912457-62912479 TAGGGGAATGGCTTGAATCCGGG + Intronic
935997869 2:108793687-108793709 CAGGAGAGTGGCGTGAATCCGGG - Intronic
937553091 2:123119360-123119382 TTGGGAAGTGGTGTGTTTCCAGG - Intergenic
938316963 2:130336541-130336563 TGGGGGAGTGGAGTCAAGCCCGG + Intergenic
940042171 2:149372024-149372046 TAGGAGAGCGGAGGCATTCCAGG + Intronic
940482455 2:154252447-154252469 CAGGGGAATGGCGTGAATCCGGG - Intronic
940502685 2:154513846-154513868 TAAGAGAGTGGACTGATTTCAGG + Intergenic
942305886 2:174607308-174607330 TAGGAGAATGGAGTGAACCCAGG + Intronic
942399247 2:175583881-175583903 GAGGGGAGTGGTATGGTTCCTGG + Intergenic
942514496 2:176737676-176737698 CAGGTGAGTGGAATGACTCCAGG - Intergenic
942987749 2:182162770-182162792 TAGGGGAGTCAGGTGATTCATGG + Intronic
945955616 2:216083194-216083216 TAGTAGAGTTAAGTGATTCCTGG - Intronic
946074788 2:217064838-217064860 GGGGGGAGTGGAGTGAAGCCAGG - Intergenic
946726343 2:222665258-222665280 TAGGAGAGTGGCGTGAACCCGGG - Intergenic
946829540 2:223713868-223713890 TATGGGAGGGGATTGGTTCCAGG + Intergenic
947610545 2:231522586-231522608 TAGGGGAGGGGAGTGACTGCAGG - Intergenic
948315737 2:237027065-237027087 TGGGGGAGTGCAGTGTGTCCAGG + Intergenic
1169400269 20:5273812-5273834 AAGTGGAGAGGAGGGATTCCTGG - Intergenic
1171059491 20:21942640-21942662 TAGGAGAATGGAGTGAGTCATGG - Intergenic
1172800011 20:37569249-37569271 TAGTGGTGTGGAGTGATTCCAGG + Intergenic
1176154738 20:63613052-63613074 CAGGGGAATGGCGTGAATCCGGG - Intronic
1176718221 21:10372431-10372453 CAGGAGAATGGAGTGAATCCGGG + Intergenic
1176999074 21:15589612-15589634 TAGGGACCTGGAGGGATTCCTGG - Intergenic
1178341638 21:31790378-31790400 TGGGGGTGGGGAGTGGTTCCAGG + Intergenic
1179108877 21:38427836-38427858 TAAGAAAGAGGAGTGATTCCTGG + Intronic
1179262951 21:39774770-39774792 TTGTGGAATGTAGTGATTCCTGG + Intronic
1180219696 21:46350732-46350754 TGGGGGTGTGGAGTGAGCCCCGG - Intronic
1180367861 22:11957062-11957084 TCTGGGAGTGGAGAGATGCCAGG - Intergenic
1180419279 22:12799007-12799029 TCTGGGAGTGGAGAGATGCCAGG - Intergenic
1181669319 22:24418813-24418835 AGGGAGAGTGGAGAGATTCCAGG + Intronic
1182436690 22:30335362-30335384 AAGGGGAGTGGAGTGATATCTGG - Intronic
1182611819 22:31554399-31554421 TAGGAGAATGGCGTGAATCCGGG - Intronic
951991084 3:28676975-28676997 TAGGGGTTTGGAGAGTTTCCAGG - Intergenic
952100902 3:30011914-30011936 TAGGAGAATGGCGTGATCCCGGG - Intergenic
952788962 3:37183371-37183393 TATAGGAGAGGAGTGGTTCCCGG + Intronic
954207066 3:49067473-49067495 CAGGAGAATGGTGTGATTCCAGG + Intronic
954796323 3:53162965-53162987 TAAGGGAGGGGACTGATCCCTGG + Intronic
954947085 3:54435191-54435213 CAGGGGAGTGGAGTGCTGACTGG - Intronic
954992660 3:54854595-54854617 GAGGGCAGTGTTGTGATTCCTGG - Intronic
958862886 3:99466531-99466553 TAGGGGTTTGGAGAGCTTCCAGG - Intergenic
959218955 3:103490739-103490761 CAGGAGAATGGAGTGAATCCAGG - Intergenic
959292868 3:104496633-104496655 CAGGGGAATGGCGTGAATCCGGG + Intergenic
960497658 3:118394758-118394780 GCAGGGAGTGGAGTGGTTCCAGG + Intergenic
961367732 3:126411638-126411660 TAGGAGAGTTGTGTGTTTCCAGG + Intronic
961493732 3:127275523-127275545 TTGGGGACTGGAGTTAGTCCAGG - Intergenic
962509181 3:136081700-136081722 TAGGGGAGTACAGTGAGTCAGGG + Intronic
964975989 3:162621338-162621360 TTGGGGAGTGGGGTGATTTTGGG - Intergenic
965005732 3:163019925-163019947 CAGGAGAATGGAGTGAATCCAGG - Intergenic
966324613 3:178740209-178740231 TAGGGGAATGGTGTGAACCCAGG - Intronic
966334597 3:178854188-178854210 AAGGGCAGTGGAGAGATTGCAGG - Intergenic
969452610 4:7283484-7283506 CGGGGGTCTGGAGTGATTCCAGG + Intronic
970957936 4:21837008-21837030 CAGGAGAATGGAGTGAATCCGGG - Intronic
971456659 4:26851458-26851480 AAGGAGAGTGGACTGATTCCAGG + Intergenic
972788285 4:42347095-42347117 GAGGGGAGTGCAGTGGTGCCTGG - Intergenic
973362507 4:49178266-49178288 TCTGGGAGTGGAGAGATGCCAGG + Intergenic
973398594 4:49618595-49618617 TCTGGGAGTGGAGAGATGCCAGG - Intergenic
974252541 4:59405535-59405557 TAGGGGAATGGCGTAAATCCGGG - Intergenic
975259780 4:72284350-72284372 TAGGAGAGTGGCGTGAACCCAGG + Intronic
977183766 4:93910606-93910628 TAGGTGTGTGGACTTATTCCAGG + Intergenic
982582474 4:157196218-157196240 TAGGGAAGGGGAGTGAGCCCAGG - Intergenic
986301072 5:6478912-6478934 GAGGGGAGTGGAGGGGTGCCAGG - Intronic
987354210 5:17048325-17048347 TAGGGGAATGGCGTGAACCCGGG + Intergenic
987778896 5:22406340-22406362 TAGGGTAGTGAAGAGATTACAGG - Intronic
991047779 5:62240808-62240830 GAGGGGAGTGGACTGGTTCAGGG - Intergenic
991298628 5:65106039-65106061 TGGGGGAATGGAGTGCTGCCAGG - Intergenic
991583267 5:68178189-68178211 CAGGAGAGTGGCGTGAATCCAGG + Intergenic
993773791 5:91965437-91965459 TATGGGAGTGAAGTGATTTTGGG - Intergenic
994584056 5:101682970-101682992 CAGGAGAATGGAGTGAATCCGGG + Intergenic
995355700 5:111235821-111235843 TAGTGGAGGGGAGTGATCCTCGG + Intronic
1000234031 5:159341140-159341162 GAGGAGAGTGATGTGATTCCAGG + Intergenic
1001355577 5:171019453-171019475 TCAGGGATTGGAGTTATTCCTGG + Intronic
1002285054 5:178156800-178156822 CAGGAGAATGGCGTGATTCCAGG - Intergenic
1005044518 6:21629171-21629193 CAGGGGAATGGAGTGAACCCGGG - Intergenic
1005251184 6:23948329-23948351 TAGGGGAATAGATTGATTTCTGG - Intergenic
1007036963 6:38683792-38683814 CAGGAGAATGGAGTGAATCCGGG + Intronic
1007842139 6:44725322-44725344 TAGGGAAGTGGGGTGACTGCAGG - Intergenic
1007862747 6:44930286-44930308 TAGGAGAATGGCGTGAATCCGGG + Intronic
1008185425 6:48384104-48384126 TAGGGGAGTTGTATGTTTCCAGG + Intergenic
1008509837 6:52266074-52266096 AAGTGGAGTTGAGTGAATCCAGG - Exonic
1009650873 6:66476836-66476858 CAGGAGAGTGGCGTGAATCCAGG - Intergenic
1010405166 6:75496639-75496661 CAGGAGAGTGGAGTGAACCCGGG - Intergenic
1012549652 6:100455349-100455371 CAGGGCAGTGGAGTCACTCCGGG - Intronic
1012909202 6:105100415-105100437 CAGGAGAGTGGCGTGAATCCAGG + Exonic
1013067108 6:106694564-106694586 TAGGGGAGAGAAGTGACTCTTGG + Intergenic
1013415480 6:109920843-109920865 TAGAGGAGAGGAGGGCTTCCTGG - Intergenic
1013881698 6:114910627-114910649 TTAGGGAGTGCAGTGATTCTGGG - Intergenic
1014622913 6:123691571-123691593 TAGGGGAATGGCGTGAACCCGGG - Intergenic
1014914702 6:127132088-127132110 TGGGGGAGAGGGGAGATTCCTGG - Intronic
1015033674 6:128626993-128627015 CAGGAGAATGGAGTGAATCCGGG - Intergenic
1015895723 6:138014592-138014614 AAGGGGACTGGACTGATTCGGGG + Intergenic
1017125711 6:151062343-151062365 TAGGAGAATGGCGTGAATCCGGG + Intronic
1017358214 6:153534953-153534975 TAGGAGAATGGCGTGAATCCGGG + Intergenic
1017497389 6:154994439-154994461 AAGGCGAGGAGAGTGATTCCAGG + Intronic
1021410299 7:20322543-20322565 TAGGAGAATGGAGTGAACCCGGG - Intergenic
1022044306 7:26611049-26611071 AAGGGGAGAGGAGTGAGCCCAGG - Intergenic
1022293504 7:29026739-29026761 TAGGGGAATGGATAAATTCCTGG + Intronic
1022357791 7:29632105-29632127 CAGGAGAATGGAGTGAATCCGGG + Intergenic
1022798501 7:33752688-33752710 TAGGGCAGTGGGGTGGTTCCAGG - Intergenic
1024058966 7:45684046-45684068 GAGGGAAGTGCAGTGATTCACGG + Intronic
1024115126 7:46185480-46185502 TGGGAGAGTGAAGTGACTCCAGG - Intergenic
1026766918 7:73165974-73165996 GAGGGGGGTGGAGGGATCCCAGG - Intergenic
1026829319 7:73601389-73601411 CAGGGGAGGGGACTGCTTCCTGG - Intronic
1029448559 7:100627982-100628004 AAGGGGAGGGGAGGGATGCCAGG + Intronic
1030957184 7:115868646-115868668 TAGGGGCATGGAGTATTTCCGGG + Intergenic
1030973086 7:116086232-116086254 AAGGGGATTGGAGTGAATTCTGG - Intronic
1031042445 7:116852520-116852542 CAGGAGAATGGAGTGAATCCGGG - Intronic
1031376349 7:121031361-121031383 GAGGGCAGTGGCGTGATCCCAGG + Intronic
1031783208 7:125996941-125996963 TGGGGGTATGAAGTGATTCCAGG + Intergenic
1032176144 7:129628134-129628156 TAGGAGAATGGAGTGAACCCAGG - Intronic
1034640783 7:152600814-152600836 TAGGGCAGTGGTGTGATCTCGGG + Intergenic
1036524372 8:9521156-9521178 CAGGGGAATGGAGTGAACCCGGG + Intergenic
1037696944 8:21231673-21231695 CAGGGGAGTGAAATGACTCCTGG + Intergenic
1043535310 8:81196820-81196842 TGGGGGGGTGGGGAGATTCCAGG - Intergenic
1044076077 8:87822979-87823001 TAGGAGAATGGTGTGAATCCTGG + Intergenic
1046002016 8:108432767-108432789 TGGGGGAGGCGAGTGATTCGGGG - Intronic
1046012778 8:108570765-108570787 TTGGGGAGTGGTGTAAGTCCTGG + Intergenic
1046759926 8:118010277-118010299 CAGGAGAATGGAGTGATCCCGGG + Intronic
1048603374 8:135942727-135942749 GAGGGGAGGGGATGGATTCCAGG + Intergenic
1050669734 9:7982295-7982317 CAGGAGAATGGCGTGATTCCCGG + Intergenic
1051099151 9:13501218-13501240 TAGGGGAGAGGTTTGAGTCCTGG - Intergenic
1052793370 9:32899330-32899352 TGGGGAAGTGGAGTGACTCAGGG + Intergenic
1053226309 9:36361242-36361264 TAGGAGAGTGGTGTGATCCCAGG - Intronic
1055103840 9:72492488-72492510 CAGGAGAATGGAGTGATCCCAGG - Intergenic
1056303954 9:85270875-85270897 TAGGAGAATGGTGTGAATCCGGG - Intergenic
1056690480 9:88804120-88804142 CAGGGGAGGGGTGTGTTTCCAGG + Intergenic
1058872667 9:109216129-109216151 GAGGGGAGGGGAGTGATGGCTGG - Intronic
1061487055 9:130925310-130925332 TAGGGAAGTGGCCTGAGTCCTGG - Intronic
1061806961 9:133142109-133142131 TAGGGGACTGGCTTGATGCCGGG + Intronic
1062125062 9:134855754-134855776 GACGGGAGTGGTGTGTTTCCAGG - Intergenic
1062391669 9:136336357-136336379 TGGGGGTGTGGAGGGATTCGGGG - Intronic
1186153768 X:6704358-6704380 TAGGAGAATGGAGTGAACCCGGG + Intergenic
1186551738 X:10513409-10513431 GAGGGGAATGGAATGATTGCAGG - Intronic
1186646215 X:11509909-11509931 GAGGTGAGAGGAGTTATTCCTGG - Intronic
1187378326 X:18777610-18777632 CAGGAGAATGGAGTGAGTCCGGG - Intronic
1187897302 X:23994385-23994407 TAGGTGATTGGAGTTATCCCAGG - Intronic
1187915903 X:24151520-24151542 TAGGGGAGTGGTGGGAATTCAGG + Intronic
1189409159 X:40754863-40754885 TAGTGGAGTGGACTATTTCCAGG + Intergenic
1190044189 X:47099270-47099292 GAGAGGAGTGGAATGGTTCCAGG + Intergenic
1190322976 X:49189095-49189117 GAGGGGAGTGGAGTGAGGGCAGG + Exonic
1190797617 X:53759627-53759649 TTGGGGAGAAGAGTGATTCAAGG - Intergenic
1195133551 X:101878989-101879011 AAGGGGTGGGGAGTGGTTCCGGG + Intergenic
1199493058 X:148422617-148422639 TAGGAGAGTTGAGGGTTTCCAGG - Intergenic
1200934081 Y:8723172-8723194 TAGTGGAGTGGATTGATACTGGG - Intergenic