ID: 1133102611

View in Genome Browser
Species Human (GRCh38)
Location 16:3488343-3488365
Sequence CTCGGGCTCCACCCCTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133102611_1133102621 19 Left 1133102611 16:3488343-3488365 CCTGCTCAGGGGTGGAGCCCGAG No data
Right 1133102621 16:3488385-3488407 CTCCCTGCACACACCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133102611 Original CRISPR CTCGGGCTCCACCCCTGAGC AGG (reversed) Intergenic
No off target data available for this crispr