ID: 1133103573

View in Genome Browser
Species Human (GRCh38)
Location 16:3493529-3493551
Sequence CCTCTCAGGGAGGCGGTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1068
Summary {0: 1, 1: 0, 2: 1, 3: 76, 4: 990}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133103559_1133103573 16 Left 1133103559 16:3493490-3493512 CCTTGGCTTTTATTGAGATCAGA 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG 0: 1
1: 0
2: 1
3: 76
4: 990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133103573 Original CRISPR CCTCTCAGGGAGGCGGTGGC GGG Exonic
900747592 1:4371734-4371756 GCTCTCTGTGAGGCTGTGGCAGG + Intergenic
901052093 1:6430323-6430345 CCTGCCAGGGAGGCTGTGGGTGG + Intronic
901085069 1:6605952-6605974 CCACTCAGGAAGGCTGAGGCAGG - Intronic
901377241 1:8848160-8848182 CTTCCCAGTGAGGCGGAGGCAGG + Intergenic
901395087 1:8975381-8975403 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
901484905 1:9552476-9552498 CCACTCTGGGAGGCTGAGGCAGG - Intronic
901514951 1:9738896-9738918 GCACTTTGGGAGGCGGTGGCAGG - Intronic
901517758 1:9760773-9760795 GCTCTGAGGGAGGCTGAGGCAGG - Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902430532 1:16359629-16359651 CCACTCTGGGAGGCCGAGGCAGG - Intronic
902440899 1:16429247-16429269 GCTCTTAGGGAGGCAGAGGCGGG - Intronic
902948423 1:19861084-19861106 CCTCCCAGGGAGCCAGTGGTGGG - Intergenic
903232214 1:21928859-21928881 CTACTCAGGGAGGCTGAGGCAGG - Intronic
903351358 1:22718495-22718517 CTACTCAGGGAGGCTGAGGCAGG - Intronic
903480773 1:23651741-23651763 GCTCTCAGGGAGGCAGAGGTGGG + Intergenic
903555285 1:24188229-24188251 GCTATCAGGGAGGCTGAGGCAGG + Intergenic
903575266 1:24335826-24335848 GCTCTTAGGGAGGCCGAGGCGGG - Intronic
903783044 1:25834777-25834799 TCCCTCAGGAAGGTGGTGGCTGG - Exonic
904012559 1:27398238-27398260 CCTCTCAGGGAGGCTTTTCCTGG - Intergenic
904127531 1:28252130-28252152 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
904138400 1:28331987-28332009 GCTCTCTGGGAGGCTGAGGCAGG - Intronic
904222791 1:28986681-28986703 GCTCTTAGGGAGGCAGAGGCGGG + Intronic
904323493 1:29711821-29711843 CCTCTCAGGAAGTAGGTGGAGGG + Intergenic
904639924 1:31918135-31918157 GCTATCAGGGAGGCTGAGGCAGG + Intronic
904840967 1:33371538-33371560 TCTCTGTGGGGGGCGGTGGCTGG - Intronic
905213769 1:36392407-36392429 CCACTCAGGGAGGCTGAGGCAGG + Intronic
905318899 1:37101667-37101689 CTTCACAGGGAGGCAGAGGCAGG - Intergenic
905527623 1:38651057-38651079 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
906105998 1:43293017-43293039 CCTCTCTGGGAGGCTGGGGCTGG - Intergenic
906225951 1:44121359-44121381 CCTCTTTGGGAGGCTGAGGCGGG - Intronic
906304735 1:44709724-44709746 CTACTCAGGGAGGCTGAGGCAGG + Intronic
906314001 1:44774644-44774666 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
906485887 1:46234773-46234795 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
906519416 1:46458446-46458468 CCTCTGAGGCAGGCAGAGGCTGG - Intergenic
906557194 1:46723157-46723179 CATCTCAGGGAGGAGGAGGTGGG + Intergenic
906720520 1:48001064-48001086 TCTCTCAGGGAGGCAGAGGAGGG + Intergenic
906954867 1:50365402-50365424 CCTCTCAGTGAGGCGAGGGGAGG + Intergenic
907190011 1:52640565-52640587 CCTACCAGGGAGGCTGAGGCAGG + Intronic
907739735 1:57153270-57153292 GCACTCAGGGAGGCCGAGGCAGG - Intronic
908551686 1:65214742-65214764 CCTCTAAGGAAAGTGGTGGCAGG - Intronic
909260735 1:73486442-73486464 CCTCTCAGGGGGTGGGGGGCTGG - Intergenic
911214862 1:95181706-95181728 CTACTCAGGGAGGCTGAGGCAGG - Intronic
911269517 1:95783352-95783374 CTTCTCAGGGAGACTTTGGCAGG - Intergenic
911976760 1:104507545-104507567 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
912125960 1:106538525-106538547 CATCTCGGGAAGGCGGGGGCAGG + Intergenic
912275771 1:108256727-108256749 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
912292456 1:108437627-108437649 CTACTCAGGGAGGCTGAGGCAGG + Intronic
912903622 1:113679949-113679971 GCTCTCTGGGAGGCTGAGGCTGG - Intronic
912910416 1:113753672-113753694 CCTAGCAGGGAGGCCGAGGCAGG - Intronic
914389670 1:147208683-147208705 GCACTCTGGGAGGCGGAGGCGGG - Intronic
914873841 1:151497764-151497786 GCTCTCTGGGAGGCGGAGGCAGG + Intergenic
915191195 1:154152280-154152302 CTACTCAGGGAGGCTGAGGCAGG - Intronic
915317427 1:155037006-155037028 GCTCTTAGGGAGGCAGAGGCGGG - Intronic
915762193 1:158326079-158326101 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
916751865 1:167730523-167730545 ACTCTTTGGGAGGCTGTGGCAGG - Intronic
917089033 1:171333933-171333955 CCTATCTGGGAGGCTGAGGCAGG - Intronic
917129498 1:171726294-171726316 CCTCTTTGGGAGGCCGAGGCGGG - Intronic
917754119 1:178082514-178082536 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
917867730 1:179213413-179213435 TCTCTCAGGGAGGCAGAGGCGGG - Intronic
917873093 1:179259464-179259486 GCACTCTGGGAGGCGGAGGCAGG - Intergenic
918660628 1:187083296-187083318 GCTCTTTGGGAGGCGGAGGCGGG - Intergenic
918675755 1:187283137-187283159 GCTCTCTGGGAGGCTGAGGCAGG + Intergenic
918875391 1:190034839-190034861 GCTCTTAGGGAGGCAGAGGCGGG + Intergenic
919028376 1:192206403-192206425 CCTCTTTGGGAGGCTGCGGCGGG - Intergenic
919912076 1:202117765-202117787 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
920413605 1:205782432-205782454 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
920501551 1:206488478-206488500 CCTCACAAGGATGCTGTGGCAGG + Intronic
921783340 1:219195840-219195862 CCTGTCAGGGAGGCGGTGAGAGG - Intronic
922019763 1:221691801-221691823 ACTCTCAGGGAGGCAGAGGTGGG + Intergenic
922824814 1:228510425-228510447 CCTTTCAGGGAGGAGGGGGCTGG + Intergenic
923545925 1:234923254-234923276 CCTCTCAGGGAAAAGGTGGGGGG - Intergenic
923977188 1:239276531-239276553 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
923977203 1:239276590-239276612 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
924680049 1:246221631-246221653 GCTCTCTGTGAGGCTGTGGCTGG - Intronic
924726080 1:246672074-246672096 GCACTTAGGGAGGCTGTGGCAGG + Intergenic
1063438239 10:6051628-6051650 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1063778194 10:9288634-9288656 GCTCTTAGGGAGGCAGAGGCGGG + Intergenic
1065320043 10:24500834-24500856 GCTCTTAGGGAGGCAGAGGCAGG + Intronic
1065516888 10:26532734-26532756 CCACTCTGGGAGGCTGAGGCAGG - Intronic
1065711844 10:28525636-28525658 TCCCTCAGGGAGGCTGAGGCAGG - Intergenic
1066456037 10:35573200-35573222 CGTCCCAGGGAGGCTGAGGCGGG - Intergenic
1066576111 10:36826665-36826687 CCACTCTGGGAGGCTGAGGCAGG + Intergenic
1068554509 10:58443954-58443976 CTACTCAGGGAGGCTGAGGCGGG + Intergenic
1068684843 10:59859816-59859838 CCTCTTTGGGAGGCTGAGGCGGG + Intronic
1068726609 10:60310169-60310191 CCACTCTGGGAGGCCGAGGCAGG - Intronic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1069001723 10:63274316-63274338 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1069253392 10:66300136-66300158 TCTCTTAGGGAGGCTGAGGCAGG - Intronic
1069383949 10:67867308-67867330 CCTACCCGGGAGGCTGTGGCAGG - Intergenic
1069456353 10:68557143-68557165 GCTCTCTGGGAGGCCGAGGCAGG + Intergenic
1069557681 10:69408551-69408573 GCTCTCAGGGAGGCAGAGGCGGG - Intronic
1069593067 10:69653754-69653776 GCTCTCTGGGAGGCTGTGGCTGG - Intergenic
1069718619 10:70536187-70536209 GCTATCAGGGAGGCTGAGGCAGG + Intronic
1069862470 10:71480218-71480240 ATTCTCAGGGAGTGGGTGGCCGG + Intronic
1070032614 10:72692192-72692214 CCTCTCGGGGCGGCGGCGGCGGG + Exonic
1070254801 10:74804832-74804854 CCTCCCAGGGAGGCAGAGGTGGG + Intergenic
1070565785 10:77602972-77602994 CTTCTCAGGGAAGCCGGGGCTGG + Intronic
1070607888 10:77912088-77912110 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1070708620 10:78660251-78660273 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1070910659 10:80115190-80115212 ACTCTTAGGGAGGCAGAGGCAGG - Intergenic
1071280447 10:84097167-84097189 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1071530633 10:86388418-86388440 CCTCTGAGGGAGGCGGGAGGCGG - Intergenic
1071957192 10:90771592-90771614 GCTCTCTGGGAGGCTGTGGCTGG - Intronic
1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG + Exonic
1072868888 10:99095072-99095094 CATCTTAGGGAGGCTGAGGCAGG + Intronic
1072890260 10:99317030-99317052 GCTCTTTGGGAGGCGGAGGCGGG - Intergenic
1072983081 10:100115859-100115881 GCACTTCGGGAGGCGGTGGCAGG - Intergenic
1073012283 10:100370856-100370878 CCTCCCTGGGTGGCAGTGGCAGG + Intergenic
1073168408 10:101478825-101478847 CCTCTGTGGGAGGCTGAGGCAGG + Intronic
1073190951 10:101650414-101650436 GCTCTGAGGGAGGTGGGGGCAGG - Intronic
1073304584 10:102492888-102492910 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1073512927 10:104053603-104053625 CCTCTCAGGGAGGCCTTCCCTGG + Intronic
1073785409 10:106883657-106883679 CCACTCTGGGAGGCTGAGGCGGG - Intronic
1074105994 10:110390039-110390061 GCTCTTAGGGAGGCAGAGGCGGG + Intergenic
1074131418 10:110581327-110581349 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1074556000 10:114490913-114490935 GCTCTCAGGGAGGCAGAGGCGGG - Intronic
1075104155 10:119526680-119526702 GCTCCCAGGGAGGGAGTGGCAGG - Intronic
1075187626 10:120277186-120277208 CCTGTCAGGGAGGTGGGGGGAGG + Intergenic
1075575032 10:123571756-123571778 CCTGTCAGGGTGGTGGGGGCTGG + Intergenic
1075687636 10:124375493-124375515 ACTCTCAGGGGGGTGGGGGCAGG + Intergenic
1075751571 10:124776539-124776561 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1075752280 10:124782699-124782721 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1076167448 10:128293906-128293928 CCTCACAGGGAGGCGGAAGTGGG - Intergenic
1076384756 10:130048135-130048157 GCTATCAGGGAGGAGGAGGCAGG + Intergenic
1076446099 10:130515096-130515118 GCACTCAGGGAGGCCGAGGCGGG - Intergenic
1076655061 10:132018580-132018602 GCTCTCTGTGAGGCTGTGGCTGG + Intergenic
1076744150 10:132504389-132504411 CCTGTCTGGGAGGCCGTGGGAGG - Intergenic
1077035415 11:492082-492104 GCTCTCAGGGAGGCAGAGGCAGG - Intergenic
1077048192 11:555355-555377 CCTCTGCGGGAGGCGACGGCAGG + Exonic
1077141672 11:1027540-1027562 ACTCTCCGGGAGGGGGCGGCCGG + Intronic
1077237300 11:1487923-1487945 CTGCTTAGGGAGGCGGGGGCCGG - Intronic
1078315049 11:10287982-10288004 GCTCTCTGCGAGGCTGTGGCTGG + Intronic
1078513049 11:12000315-12000337 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1078694027 11:13611536-13611558 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1079330027 11:19525637-19525659 TCTCTCAGTGAGGGGGTTGCAGG + Intronic
1079906827 11:26259401-26259423 CCTCTTTGGGAGGCCGAGGCAGG + Intergenic
1080000089 11:27337555-27337577 ACTCTGAGGGAGGCAGAGGCGGG - Intronic
1080355255 11:31436676-31436698 CCACTCTGGGAGGCTGAGGCGGG - Intronic
1080522597 11:33080472-33080494 CCACTCGGGGAGGCTGAGGCAGG - Intronic
1080615783 11:33943650-33943672 GCTCTCTGGGAGGCCGAGGCAGG - Intergenic
1080805539 11:35649716-35649738 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1080917211 11:36672473-36672495 GCTACCAGGGAGGCTGTGGCAGG - Intergenic
1082034762 11:47636014-47636036 GCTCTTAGGGAGGCTGGGGCAGG + Intronic
1082716563 11:56620849-56620871 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1082822502 11:57553580-57553602 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1082843829 11:57711598-57711620 ACACTCTGGGAGGCGGAGGCGGG - Intronic
1083286766 11:61664668-61664690 CTACTCAGGGAGGCGGAGGTGGG + Intergenic
1083386897 11:62317738-62317760 CCTCTTTGGGAGGCCGAGGCAGG + Intergenic
1083502831 11:63127126-63127148 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
1083614585 11:64019930-64019952 CCTCTCAGTGAGGTGTTGGCTGG - Intronic
1083619292 11:64040986-64041008 GCTGGCAGGGAGGCAGTGGCCGG + Intronic
1083799242 11:65036919-65036941 GCACTCTGGGAGGCGGAGGCAGG - Intronic
1083850634 11:65364510-65364532 GCACTCTGGGAGGCGGAGGCAGG - Intergenic
1083966712 11:66048010-66048032 CCTCTCAGGGAGGGGGCCACTGG + Intronic
1084357512 11:68650019-68650041 CCAAACAGGGCGGCGGTGGCTGG - Intergenic
1084399515 11:68935616-68935638 GCTGTCAGGGAGCAGGTGGCTGG + Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1084922421 11:72481958-72481980 GCTCTTAGGGAGGCAGAGGCGGG - Intergenic
1085188874 11:74600405-74600427 GCTCTCAGGGAGGCAGAAGCAGG - Intronic
1085189082 11:74602188-74602210 GCTCTCAGGGAGGCAGAAGCAGG - Intronic
1085199247 11:74691814-74691836 ACTCTGATGGAGGAGGTGGCAGG + Intergenic
1085290039 11:75391632-75391654 GATCTCAGGGAGGCAGAGGCAGG - Intergenic
1086258627 11:84910664-84910686 GCTGTCAGGGAGGCAGAGGCAGG + Intronic
1086343632 11:85872526-85872548 GCACTCTGGGAGGCCGTGGCAGG - Intronic
1087742220 11:101901121-101901143 GCACTCTGGGAGGCGGAGGCGGG - Intronic
1087749491 11:101990924-101990946 CCACTCAGGGAGGCTGAGGCAGG + Intronic
1087766536 11:102161170-102161192 CTCCTCAGGGAGGCTGAGGCAGG - Intronic
1088287856 11:108206467-108206489 CCTCACAGGGAGCCAGTGCCTGG - Intronic
1088601867 11:111486971-111486993 CCTGTCAGGGAGGAGGCGGGGGG - Intronic
1088679284 11:112225714-112225736 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1089114012 11:116079343-116079365 GCTCTCAGGGAGGCAAAGGCGGG + Intergenic
1089375480 11:117991084-117991106 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1089512142 11:119006345-119006367 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1089664121 11:120006560-120006582 CCTCTCAGGGAAGAGGTCGTTGG + Intergenic
1090061439 11:123467470-123467492 CTTCTCATGGAGGCGCTGTCAGG + Intergenic
1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG + Exonic
1090272642 11:125398639-125398661 GGTCTCAGGAAGGAGGTGGCAGG - Intronic
1090571269 11:128049174-128049196 CCTCTAAGAGACGGGGTGGCAGG + Intergenic
1090755760 11:129789791-129789813 CCACTTTGGGAGGCTGTGGCGGG + Intergenic
1091475708 12:770083-770105 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1091543484 12:1483938-1483960 GCACTCAGGGAGGCCGAGGCAGG - Intronic
1091743534 12:2976680-2976702 GCTCTCAGGGAGGTGGAAGCTGG - Intronic
1092344121 12:7701331-7701353 GCTCTCAGGGAGGCACAGGCGGG + Intergenic
1092532341 12:9354956-9354978 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1093023599 12:14224774-14224796 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
1093281919 12:17204863-17204885 GCTCTCTGTGAGGCTGTGGCTGG - Intergenic
1094549762 12:31439816-31439838 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1094577060 12:31696355-31696377 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1095462008 12:42453452-42453474 CCTCTCTGGGAGGCCGAGACAGG + Intronic
1096245214 12:49981045-49981067 CCTCTCTGGGCAGCTGTGGCAGG + Intronic
1096322946 12:50631469-50631491 CCTCTTTGGGAGGCCGAGGCAGG - Intronic
1096324181 12:50643750-50643772 GCACTCAGGGAGGCCGAGGCAGG + Intronic
1096553054 12:52386466-52386488 GCTATCTGGGAGGCGGAGGCGGG - Intergenic
1096642031 12:53002531-53002553 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1096736635 12:53660601-53660623 CCTCTTTGGGAGGCCGAGGCAGG + Intronic
1097078475 12:56412448-56412470 CCTCACATGGAGCCGGTGCCTGG - Intergenic
1097117459 12:56708255-56708277 GCTACCAGGGAGGCTGTGGCAGG - Intergenic
1097476954 12:60069986-60070008 GCTCCCAGGGAGGCTGAGGCAGG - Intergenic
1097859062 12:64499940-64499962 GCACTCAGGGAGGCCGAGGCAGG - Intronic
1097873621 12:64623065-64623087 GCACTCAGGGAGGCCGAGGCAGG - Intronic
1097977860 12:65707632-65707654 GCTCTCAGGGAGGCAGAGGTGGG + Intergenic
1097991208 12:65836111-65836133 CCTTTCTGGGAGGCAGAGGCGGG + Intronic
1098291136 12:68957839-68957861 CCTGTCAGGGGGTGGGTGGCTGG - Intronic
1098594995 12:72262082-72262104 CCTCTCAGGTTGGCAGTAGCAGG + Intronic
1099725491 12:86421663-86421685 TCACTCAGGGAGGCTGAGGCAGG + Intronic
1100182266 12:92098453-92098475 CTACTCAGGGAGGCCGAGGCAGG + Intronic
1100613853 12:96215482-96215504 GCTCTCACGTAGGCGGAGGCGGG + Intronic
1100848018 12:98679754-98679776 GCTCTCTGTGAGGCTGTGGCTGG - Intronic
1100923478 12:99516582-99516604 CCTGTCAGGGAGGCAGGGGGAGG + Intronic
1101592697 12:106138568-106138590 TCTCCCCGAGAGGCGGTGGCGGG - Exonic
1101768034 12:107721434-107721456 TCTCTTTGGGAGGCGGAGGCTGG - Intergenic
1101955879 12:109212214-109212236 CCTCCCTGGGAGGCTGTGGTGGG + Intronic
1101969895 12:109305616-109305638 CCTATTAGGGAGGCTGAGGCAGG + Intronic
1102141393 12:110618182-110618204 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1102586658 12:113928088-113928110 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1102670507 12:114614974-114614996 GCTCTCAGGGAGGAGGCGGTGGG - Intergenic
1102842721 12:116143260-116143282 GCACTCAGGGAGGCCGAGGCAGG + Intronic
1103080099 12:118016939-118016961 CCGCGCGGGGAGGAGGTGGCTGG + Intronic
1103540966 12:121666265-121666287 GCTCTCAGGGAGGCAGAGGTGGG - Intronic
1103680691 12:122691204-122691226 GCTCTTAGGGAGGCCGAGGCAGG + Intergenic
1103888129 12:124217915-124217937 CCACCCAGGGAGGCGGTGTCAGG + Intronic
1104022601 12:125003346-125003368 CCTCCCATGGAGGCGATGGCTGG + Intronic
1104847458 12:131853721-131853743 CACCTCAGGGAGGCTGAGGCGGG - Intergenic
1104892631 12:132147821-132147843 CCTCCCAGGGAGGCAGGGACTGG + Intronic
1104995722 12:132654317-132654339 GCTCTCAGGGAGGCAGAGGCGGG - Intronic
1105573627 13:21627716-21627738 CCACTCTGGGAGGCCGAGGCGGG - Intergenic
1105970544 13:25425820-25425842 GCACTCTGGGAGGCGGAGGCGGG - Intronic
1106149786 13:27088172-27088194 GCTCTCTGGGAGGCCGAGGCAGG + Intronic
1106421397 13:29589107-29589129 ACTCTCAGAGAGGCTGGGGCAGG - Intronic
1107025897 13:35800968-35800990 GCACTCTGGGAGGCCGTGGCAGG - Intronic
1107468460 13:40669020-40669042 CCTTGCAGGGAGGCCGAGGCGGG + Intergenic
1107534825 13:41318446-41318468 GCACTCAGGGAGGCTGAGGCGGG - Intronic
1107697170 13:43011646-43011668 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1108006638 13:45953841-45953863 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1108176758 13:47800470-47800492 CATGTCAGGGAGGAAGTGGCAGG - Intergenic
1108528912 13:51310566-51310588 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1108609326 13:52068857-52068879 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1109633607 13:65085201-65085223 GCTCTCTGGGAGGTTGTGGCTGG + Intergenic
1110220636 13:73068847-73068869 GCTCTTTGGGAGGCGGAGGCAGG + Intronic
1110815696 13:79857960-79857982 CCTGTCAGGGGGTCGGGGGCCGG + Intergenic
1111212176 13:85093910-85093932 GCTCTTAGAGAGGCGGTTGCTGG + Intergenic
1111738225 13:92169172-92169194 CCTGTCAGGGGTGGGGTGGCGGG + Intronic
1112566740 13:100558229-100558251 CCTCTTTGGGAGGCTGAGGCAGG + Intronic
1112698068 13:101972753-101972775 GCTCTCAGGGAGGCAGAGGCGGG - Intronic
1112716686 13:102194426-102194448 CCTGTCAGGGGGGCAGTGGGAGG - Intronic
1113512694 13:110868549-110868571 CCACTCAGGGAGGCTGAGACAGG + Intergenic
1113543054 13:111123764-111123786 CCTATAAGGGAGGTGGTGACAGG + Intronic
1113656833 13:112072816-112072838 CCCCTCCGGGCGGGGGTGGCCGG + Intergenic
1113669574 13:112166358-112166380 CCCATCATGGAGGCGGTGGGAGG + Intergenic
1114188950 14:20426381-20426403 CAACTCAGGGAGGCTGAGGCAGG + Intergenic
1114233811 14:20806759-20806781 CCACTCAGGAAGGCTGAGGCAGG + Intergenic
1114281156 14:21193274-21193296 GCTCTCTGCGAGGCTGTGGCTGG - Intergenic
1114308163 14:21442218-21442240 CATCACTGGGAGGCGGAGGCAGG + Intronic
1114309191 14:21451321-21451343 GCTCTTAGGGAGGCAGAGGCAGG + Intronic
1114431238 14:22663041-22663063 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1114518660 14:23319335-23319357 GCTCTTTGGGAGGCTGTGGCGGG - Intronic
1114639863 14:24212496-24212518 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1114896088 14:26993223-26993245 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1115402147 14:32973781-32973803 GCACTCTGGGAGGCCGTGGCAGG - Intronic
1115551820 14:34511834-34511856 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1115705531 14:35994370-35994392 CCACTCTGGGAGGCTGAGGCAGG - Intergenic
1115936425 14:38558316-38558338 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1116381822 14:44278589-44278611 CTTCTCAGGGAGGCTGAGGCAGG - Intergenic
1116572161 14:46532073-46532095 CTTCTCAGGGAGGCTGAGGCAGG - Intergenic
1116698328 14:48203792-48203814 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1117015617 14:51514180-51514202 ACTCTCAGGCAGGAGGTCGCTGG + Intronic
1117251903 14:53946996-53947018 CCTCTCAGTGTGGCGCTGCCCGG + Intergenic
1117705433 14:58462497-58462519 GCTCTCTGGGAGGCTGAGGCGGG - Intronic
1117893178 14:60449029-60449051 CCTGTCAGGGAGTAGGGGGCTGG + Intronic
1118371045 14:65137433-65137455 GCTCTCAGGGAGGCAGAGGCAGG - Intergenic
1118770876 14:68941948-68941970 TCCCTCAGGGAGGAGGTGGGTGG - Intronic
1119300844 14:73570038-73570060 GCTCTTAGGGAGGCAGAGGCGGG - Intronic
1119313305 14:73669227-73669249 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1119316698 14:73702382-73702404 GCTCTTTGGGAGGCTGTGGCGGG - Exonic
1119679090 14:76578500-76578522 GCTCTCAGGGAGGCAGAGGCGGG - Intergenic
1119734404 14:76972587-76972609 GCTTTCAGGGAGGCAGAGGCAGG + Intergenic
1119792995 14:77369911-77369933 CCTGTAAGGGAGGCGGAGGCGGG + Intronic
1119889270 14:78170523-78170545 TCTCTCTGGGAGGGAGTGGCAGG - Intergenic
1120014008 14:79449741-79449763 GCTCTCTGGGAGGCCGAGGCGGG + Intronic
1120289182 14:82545231-82545253 CCACTCAGGGAGGCTGAGGCAGG + Intergenic
1120340022 14:83207864-83207886 CCACTTAGGGAGGCTGAGGCAGG + Intergenic
1120568286 14:86086234-86086256 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1120677813 14:87442189-87442211 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1120778508 14:88463957-88463979 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1120985048 14:90327301-90327323 GCACTCTGGGAGGCCGTGGCGGG + Intronic
1120996946 14:90424291-90424313 CATCTCAGGAAGGCTGGGGCAGG + Intergenic
1121073516 14:91046930-91046952 CTTCTCTGGGAGGCCGAGGCAGG + Intronic
1121255624 14:92528238-92528260 CCTAGGAGGGAGGCGGTGGGAGG - Intronic
1121342650 14:93114871-93114893 CGTTCCAGGGAAGCGGTGGCCGG - Intronic
1121726451 14:96155375-96155397 CCACTCTGGGAGGCCGAGGCGGG + Intergenic
1122238206 14:100344843-100344865 CTTCTCAGGCGGGCGGTTGCCGG - Intronic
1122467536 14:101944303-101944325 GCTCTTAGGGAGGCAGAGGCGGG + Intergenic
1122730396 14:103792958-103792980 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1123110483 14:105864795-105864817 GTTCCCAGGGAGACGGTGGCCGG + Intergenic
1202876295 14_KI270722v1_random:5092-5114 ACTCTTAGGGAGGCCGAGGCGGG - Intergenic
1123760276 15:23426408-23426430 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1123888461 15:24750028-24750050 GCTCTCTGTGAGGCTGTGGCTGG - Intergenic
1123997702 15:25730188-25730210 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1124001037 15:25760076-25760098 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1124322683 15:28726730-28726752 GCACCCAGGGAGGCGGAGGCGGG - Intronic
1124504966 15:30264729-30264751 CATCTCAGGGAGCCTGTAGCAGG - Intergenic
1124523514 15:30426864-30426886 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124523592 15:30427308-30427330 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124535075 15:30538907-30538929 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124535153 15:30539350-30539372 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124738586 15:32273906-32273928 CATCTCAGGGAGCCTGTAGCAGG + Intergenic
1124763500 15:32468247-32468269 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124763575 15:32468694-32468716 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124775051 15:32580357-32580379 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124775128 15:32580802-32580824 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1125020102 15:34975946-34975968 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1125309226 15:38360490-38360512 CCTCTTTGGGAGGCCGAGGCGGG - Intergenic
1125708474 15:41763909-41763931 CCCCTTAGGGAGGCAGAGGCAGG + Intronic
1125721410 15:41846854-41846876 CCCACCAGGGAGGCGGTGGGTGG + Intronic
1125854412 15:42935323-42935345 GCTCTTAGGGAGGCCGAGGCGGG + Intergenic
1125863193 15:43017530-43017552 GCTCTTTGGGAGGCGGAGGCGGG + Intronic
1126459040 15:48895834-48895856 CCACTTAGGGAGGCCGAGGCAGG + Intronic
1126603013 15:50447847-50447869 GCTCTCAGGGAGGCAGAGGCAGG - Intronic
1127087115 15:55434584-55434606 GCTCTCAGGGAGGCAGAGGCGGG + Intronic
1127269394 15:57387099-57387121 GCTCGCAGGGAGGGAGTGGCTGG - Intronic
1128149822 15:65355849-65355871 GCTCTGGGGGAGGGGGTGGCGGG - Intronic
1128182323 15:65614967-65614989 GCTCTTCGGGAGGCGGAGGCAGG + Intronic
1128298122 15:66542471-66542493 GCTCTTCGGGAGGCGGAGGCAGG + Intronic
1128461629 15:67872874-67872896 ACACTCTGGGAGGCTGTGGCAGG - Intergenic
1129109056 15:73327216-73327238 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1129502808 15:76056344-76056366 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1129747105 15:78030411-78030433 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1130289301 15:82582851-82582873 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1130525184 15:84699676-84699698 GCTCTTAGGGAGGCAGAGGCAGG + Intronic
1130526244 15:84709275-84709297 CTGCTCAGGGAGGCTGAGGCAGG - Intronic
1130670287 15:85906177-85906199 CCTGTCTGGGAGGTGCTGGCAGG + Intergenic
1131098621 15:89671411-89671433 CCTCTCAGGGAGGAGAGGGCAGG - Intronic
1131145850 15:90011353-90011375 ACACTCTGGGAGGCCGTGGCAGG - Intronic
1131271871 15:90952529-90952551 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1131396433 15:92090487-92090509 CCTCCCAGGGATGAGATGGCTGG - Intronic
1131508552 15:93036420-93036442 CCACTCAAGAAGGCGGTTGCCGG + Intronic
1131607589 15:93924681-93924703 TCTCTCAGGAAGGCTGTTGCTGG + Intergenic
1131640845 15:94291487-94291509 GCTATCTGGGAGGCTGTGGCAGG + Intronic
1131992069 15:98102306-98102328 CTACTCAGGGAGGCTGAGGCGGG - Intergenic
1132098596 15:99006702-99006724 CTTCTCAGGGAGGCTGAAGCGGG + Intronic
1132380657 15:101363739-101363761 GCTCTTAGGGAGGCTGAGGCAGG - Intronic
1132443461 15:101892684-101892706 CCTCTCAGGGGGACGGGGGTAGG - Intergenic
1132443890 15:101894299-101894321 CCTCTCAGGGGGACGGGGGTAGG - Intergenic
1132584329 16:699782-699804 CCTTCCAGTGAGGCTGTGGCAGG - Intronic
1133092444 16:3414649-3414671 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133116666 16:3581522-3581544 GGTCTCAGGCTGGCGGTGGCTGG + Exonic
1133196364 16:4173631-4173653 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1133225304 16:4337931-4337953 CCTCTCAGGAAGGGGGAGCCTGG - Exonic
1133281071 16:4665613-4665635 ACACTCTGGGAGGCCGTGGCAGG - Intronic
1134150719 16:11802587-11802609 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1134155573 16:11840317-11840339 GCACTCAGGGAGGCTGAGGCAGG + Intronic
1134283750 16:12841826-12841848 CAGCTCAGGGAGGCTGAGGCAGG - Intergenic
1134632586 16:15767566-15767588 GCTCTCAGGGAGGCAGAGGCGGG - Intronic
1134641869 16:15835863-15835885 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1135566608 16:23516117-23516139 CCTATTAGGGAGGCTGAGGCGGG - Intronic
1135666204 16:24337568-24337590 GCTCTTAGGGAGGCAGAGGCAGG + Intronic
1135983131 16:27164149-27164171 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1136012271 16:27371554-27371576 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1136230100 16:28880711-28880733 CCGCTGAGTAAGGCGGTGGCAGG + Intronic
1136419527 16:30123174-30123196 CGGCTCAGGGGGGCGGGGGCGGG - Exonic
1137274580 16:46925006-46925028 ACTCTTAGGGAGGCAGAGGCAGG - Intronic
1137639965 16:50020205-50020227 CTACTCAGGGAGGCCGAGGCAGG + Intergenic
1137794763 16:51206423-51206445 GCTCTCAGGGAGGCAGAGGTGGG + Intergenic
1138164689 16:54790102-54790124 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1138654849 16:58485351-58485373 CCTGTGACGGAGGTGGTGGCGGG - Intronic
1139406100 16:66718896-66718918 GCACTCTGGGAGGCGGAGGCGGG + Intergenic
1139866880 16:70069142-70069164 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1139960132 16:70712706-70712728 CTTCTGAGGGAGGAGGTGGCAGG + Intronic
1140052790 16:71497554-71497576 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1140230531 16:73113904-73113926 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1140281995 16:73563501-73563523 ACTTTCAGGGAGGCTGAGGCGGG - Intergenic
1140331028 16:74056995-74057017 CCTGTCTTGGAGGCGGGGGCAGG + Intergenic
1140442002 16:74995198-74995220 CCACTCTGGGAGGCTGAGGCAGG + Intronic
1140500663 16:75431203-75431225 GCACTCAGGGAGGCCGAGGCGGG + Intronic
1141058280 16:80839349-80839371 GCTCTCTGGGAGGCCGAGGCAGG + Intergenic
1141499090 16:84431382-84431404 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1141614692 16:85203457-85203479 CCCCTCAGGGAGGGGTTGGATGG + Intergenic
1141958698 16:87390842-87390864 GCTCTCAGGGAGGCAGAGGCTGG - Intronic
1141993350 16:87622540-87622562 CCCCTCTGTGAGGCTGTGGCTGG + Intronic
1142016641 16:87752158-87752180 GCTCTCAGGGAAGCAGAGGCAGG + Intronic
1142189387 16:88710841-88710863 CCGCGCAGGGAGGTGGAGGCGGG + Intronic
1142524267 17:527856-527878 GCACTCTGGGAGGCTGTGGCAGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142717807 17:1756564-1756586 CCACTCTGGGAGGCCGAGGCGGG - Intergenic
1142931798 17:3291640-3291662 GCTCACAGGGAGGCGGTCACTGG - Exonic
1143024126 17:3930892-3930914 CATCCCAGGGAGGCGGAGGCGGG + Intronic
1143089575 17:4441274-4441296 GCTCTTAGGGAGGCAGAGGCGGG + Intronic
1143109134 17:4543782-4543804 CCCAGGAGGGAGGCGGTGGCAGG - Intronic
1143466119 17:7137847-7137869 CCCCTCAGAGAGGCTGGGGCTGG - Intergenic
1143513347 17:7407607-7407629 CCTCCCAGGGAGGTGGGAGCTGG + Intronic
1143763954 17:9125336-9125358 CCTATCTGGGAGGCTGAGGCAGG - Intronic
1143896029 17:10136873-10136895 GCTCTCTGGGAGGCTGAGGCAGG + Intronic
1143956143 17:10670999-10671021 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1144060833 17:11582402-11582424 GCTCTCTGCGAGGCTGTGGCTGG + Intergenic
1145090446 17:19981519-19981541 GCTCTTCGGGAGGCTGTGGCAGG - Intergenic
1145238647 17:21226580-21226602 CCTAGCAGGGAGGCGAGGGCTGG - Intergenic
1145299006 17:21617231-21617253 CCACTCTGGGAGGCCGAGGCGGG - Intergenic
1145966857 17:28925294-28925316 CCTCTCAGGGATATGGTGGAGGG + Intronic
1146859059 17:36280666-36280688 GCTCTCCGGGAGGCTGTGGTGGG - Intronic
1147089381 17:38084753-38084775 GCTCTCCGGGAGGCTGTGGTGGG - Intergenic
1147107830 17:38235766-38235788 GCTCTCCGGGAGGCTGTGGTGGG + Intergenic
1147251880 17:39157541-39157563 GCACTTAGGGAGGCGGAGGCGGG + Intronic
1147909284 17:43845563-43845585 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1147993096 17:44346867-44346889 CCACTTTGGGAGGCCGTGGCAGG + Intronic
1148421563 17:47552076-47552098 GCTCTCCGGGAGGCTGTGGTGGG - Intronic
1148426002 17:47596799-47596821 ACACTCTGGGAGGCCGTGGCGGG + Intronic
1148461594 17:47841711-47841733 GCACTCTGGGAGGCGGTGGTGGG + Intergenic
1148503067 17:48106728-48106750 CCACTTTGGGAGGCGGAGGCGGG - Intronic
1148617253 17:49010426-49010448 CTTCTCGGGGAGGCTGAGGCAGG - Intronic
1148687722 17:49509855-49509877 GCTCTCAGGGAGGTGGTGTGGGG + Intronic
1148813143 17:50307623-50307645 GCACTCAGGGAGGCTGAGGCAGG - Intergenic
1148923458 17:51060956-51060978 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1148995370 17:51704849-51704871 GCTATCAGGGAGGCTGAGGCAGG + Intronic
1149771586 17:59326416-59326438 GCACTTAGGGAGGCGGAGGCAGG - Intergenic
1149785107 17:59428128-59428150 CTTCTCAGGGAAGAGGGGGCGGG - Intergenic
1149904424 17:60512347-60512369 CCTCTTTGGGAGGCCGAGGCGGG - Intronic
1149941138 17:60868133-60868155 CTTCTCTGGGAGGCTGAGGCAGG - Intronic
1149989087 17:61370631-61370653 GCTCTCTGGGAGGCCGAGGCAGG - Intronic
1149991886 17:61388012-61388034 CCTCTAAGGGGGGAGGTGGCTGG + Intronic
1150293426 17:63994719-63994741 GCACTCTGGGAGGCCGTGGCAGG - Intergenic
1150327092 17:64265901-64265923 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1150363458 17:64559657-64559679 GCACTTAGGGAGGCGGAGGCTGG + Intronic
1150529288 17:65959713-65959735 GCTCTCTGTGAGGCTGTGGCTGG - Intronic
1150951087 17:69802584-69802606 GCTCTCTGCGAGGCTGTGGCTGG - Intergenic
1150952915 17:69822533-69822555 GCTCTCTGTGAGGCTGTGGCTGG - Intergenic
1151203562 17:72488029-72488051 CCTCTCCGGGCGGCTCTGGCAGG + Intergenic
1151205817 17:72506036-72506058 GCTCTTAGGGAGGCCGAGGCAGG + Intergenic
1151332127 17:73416306-73416328 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1151387697 17:73765070-73765092 CCTCTCAGGGTCATGGTGGCAGG - Intergenic
1151452217 17:74204929-74204951 GCACTCTGGGAGGCGGAGGCAGG - Intronic
1151487402 17:74409884-74409906 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
1151817766 17:76479618-76479640 CCTCTCTGGAAGGAGGAGGCCGG - Intronic
1151880451 17:76891624-76891646 CCACTCTGGGAGGCCGAGGCGGG - Intronic
1151918731 17:77138373-77138395 CCACTCTGGGAGGCTGAGGCAGG + Intronic
1152018836 17:77769957-77769979 GCTCTCAGGGAAGCTGTGGCAGG - Intergenic
1152113967 17:78373442-78373464 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1152163716 17:78686891-78686913 GCTACCAGGGAGGCTGTGGCAGG - Intronic
1152303462 17:79508424-79508446 GCGGTCAGGGAGGCGGTGGGCGG - Intronic
1152307051 17:79527221-79527243 CCTGGCAGGGAAGAGGTGGCAGG - Intergenic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152482799 17:80566572-80566594 GCTCTTAGGGAGGCCGAGGCAGG + Intronic
1152488863 17:80615241-80615263 GCTCTTCAGGAGGCGGTGGCAGG - Intronic
1152489325 17:80618972-80618994 CCTCGCAGGGAAGGGGAGGCGGG - Intronic
1152569489 17:81115444-81115466 CCTCACTGGGAGGTTGTGGCTGG + Intronic
1152587950 17:81197486-81197508 TCTCTCAGGGTGGAGGTGGCAGG - Intronic
1152607289 17:81298535-81298557 GCTCTCAGGGAGGCAGAGGCAGG - Intergenic
1152662094 17:81547247-81547269 AGTCTCAGGGAGGTGGTGGGCGG - Exonic
1152759905 17:82102296-82102318 CCCATCGGGGAGGCGGGGGCAGG - Intronic
1152798081 17:82317684-82317706 GCTCTCAGGGAGGCAGTGCTGGG - Intergenic
1152957898 18:55343-55365 GCACTCTGGGAGGCTGTGGCGGG - Intronic
1153003012 18:473472-473494 CTTCTCGGGGAGGCTGAGGCAGG - Intronic
1153081443 18:1231090-1231112 CCACTTTGGGAGGCGGAGGCAGG - Intergenic
1153296350 18:3550470-3550492 ACTCTTAGGGAGGCTGAGGCAGG - Intronic
1153319166 18:3754631-3754653 CCACTCTGGGAGGCCGAGGCAGG + Intronic
1153980189 18:10302297-10302319 CTCCTCAGGGACGAGGTGGCTGG + Intergenic
1154385142 18:13886486-13886508 TCTGACTGGGAGGCGGTGGCTGG + Intronic
1154991071 18:21599224-21599246 CCACTCAGGGAGGCGGAGGTGGG + Intronic
1154991515 18:21601858-21601880 GTTCTCAGGGAGGCTGAGGCAGG - Intergenic
1155615491 18:27716694-27716716 ACATTCAGGGAGGCTGTGGCAGG - Intergenic
1156742573 18:40350133-40350155 CCTACCAGGGTGGTGGTGGCTGG - Intergenic
1157297117 18:46453864-46453886 GCACTCTGGGAGGCGGTGGCAGG + Intronic
1157359103 18:46962572-46962594 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157360097 18:46968499-46968521 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157360697 18:47022091-47022113 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157361686 18:47028006-47028028 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157552854 18:48593490-48593512 CTACTCGGGGAGGCGGAGGCAGG - Intronic
1159179678 18:64886300-64886322 CCTTTCAGGGGGCCGGTGGGGGG - Intergenic
1159438954 18:68453255-68453277 CCACTTTGGGAGGCGGAGGCAGG + Intergenic
1160418916 18:78731062-78731084 CCTCACAGACAGGCGGTGGGAGG - Intergenic
1160537650 18:79603674-79603696 CCTCTCAGGGCGGGGGCGGAGGG - Intergenic
1160725215 19:614805-614827 CCTCTCAGGGGGGCAGTCTCTGG + Intronic
1160802974 19:979043-979065 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1161049480 19:2155247-2155269 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1161051507 19:2166206-2166228 CCTACCAGGGAGGCCGAGGCAGG - Intronic
1161061046 19:2215102-2215124 GCTCCCAGGGAGGCTGAGGCAGG + Intronic
1161065922 19:2237169-2237191 CTGCTCAGGGAGGCCTTGGCGGG + Intronic
1161066078 19:2238266-2238288 CCACTTTGGGAGGCCGTGGCAGG - Intronic
1161080954 19:2309914-2309936 CCTCCCAGGGATGCGGTTTCTGG - Intronic
1161282569 19:3453871-3453893 CCTCCCTCGGAGGTGGTGGCGGG - Exonic
1161453759 19:4360312-4360334 CCCCTCAGGAAGGCGGTGGGTGG + Intergenic
1161459209 19:4386582-4386604 GCTCTGAGGGAGGCAGAGGCAGG - Intronic
1161584163 19:5096195-5096217 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1161655057 19:5509175-5509197 GCTCTTAGGGAGGCTGAGGCAGG + Intergenic
1161728203 19:5942914-5942936 GCTCCCAGGGAGGCTGAGGCAGG + Intronic
1162046992 19:8006413-8006435 GCTCTTTGGGAGGCGGAGGCAGG - Intronic
1162049491 19:8024173-8024195 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1162066368 19:8127735-8127757 CCTCTTTGGGAGGCAGAGGCGGG + Intronic
1162075267 19:8182536-8182558 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1162216009 19:9134692-9134714 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1162216066 19:9135078-9135100 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1162369961 19:10272674-10272696 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1162377360 19:10312642-10312664 CTGCTCTGGGAGGCGGAGGCAGG - Intronic
1162436518 19:10663314-10663336 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1162609486 19:11738412-11738434 CCTCTCAGGGAGGCGGATCTGGG + Intronic
1162890620 19:13730550-13730572 GCTCTCTGGGAGGCCGAGGCGGG - Intergenic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1163280499 19:16313779-16313801 CCACTCTGGGAGGCCGAGGCGGG + Intergenic
1163332677 19:16651122-16651144 CCTCTCAGGGAGGTAGTGACTGG - Intronic
1163343070 19:16722398-16722420 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1163670954 19:18628268-18628290 GCTCTCTGGGAGGCTGAGGCAGG + Intergenic
1163731170 19:18950134-18950156 GCTCTTTGGGAGGCGGAGGCAGG + Intergenic
1163751863 19:19082927-19082949 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1163847094 19:19643869-19643891 CCATTCAGGGAGGAGGGGGCTGG - Intergenic
1163930625 19:20387438-20387460 GCACTCAGGGAGGCAGAGGCAGG - Intergenic
1164226208 19:23248746-23248768 CCACTTAGGGAGGCTGAGGCCGG + Intronic
1164276846 19:23726773-23726795 GCTCTCAGGGAGGCAGAAGCAGG - Intergenic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1165074240 19:33272140-33272162 CCTTTCTGGGAGGCCGAGGCAGG - Intergenic
1165205602 19:34182730-34182752 GCTCTTAGGGAGGCTGAGGCAGG + Intronic
1165271950 19:34716590-34716612 GCTCTTAGGGAGGCAGAGGCGGG + Intergenic
1165387629 19:35520243-35520265 CCTGTAAGGGAGGCTGAGGCAGG + Intergenic
1165485863 19:36095545-36095567 GCACTCAGGGAGGCCGAGGCGGG + Intronic
1165537473 19:36461557-36461579 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1165612835 19:37171652-37171674 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1165736204 19:38177424-38177446 GCTCTCAGAGAGGCAGAGGCAGG + Intronic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166193264 19:41190082-41190104 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1167059093 19:47132207-47132229 CCACTTTGGGAGGCTGTGGCGGG - Intronic
1167073420 19:47233929-47233951 GCACTGAGGGAGGCGGAGGCAGG - Intergenic
1167325303 19:48820754-48820776 GCTCTCAGGGAGGCAGAGGCGGG + Intronic
1167345159 19:48940926-48940948 GCTCTCGGGGAGGCAGAGGCGGG - Intronic
1167467718 19:49658866-49658888 GCTCACAGGGAGGCAGGGGCCGG + Intergenic
1167708875 19:51098377-51098399 GCTCTGAGGGAGGAGGGGGCTGG - Exonic
1167781565 19:51601907-51601929 GCTCTGAGGGAGGAGGGGGCTGG + Intergenic
1168002373 19:53459372-53459394 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1168031624 19:53684260-53684282 GCTCTTAGGGAGGCAGAGGCAGG + Intergenic
1168100399 19:54138259-54138281 CCACGCGGGGAGGCGGCGGCGGG - Intronic
1168103092 19:54151455-54151477 GCTCTTAGGGAGGCAGAGGCGGG + Intronic
1168215546 19:54922529-54922551 CCACTCTGGGAGGCTGAGGCGGG + Intergenic
1168619876 19:57869696-57869718 CCACTCTGGGAGGCTGAGGCAGG + Intronic
925267767 2:2579135-2579157 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
925387533 2:3472531-3472553 CCTCACAGGGTGGCAGGGGCTGG - Intronic
925695657 2:6575354-6575376 GCTGTCAGGGAGGCAGAGGCAGG + Intergenic
925731153 2:6920094-6920116 CCACTCTGGCAGGCGGCGGCAGG + Intronic
925884968 2:8387444-8387466 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
926018486 2:9474673-9474695 CCCCGCAGGGAGGCCGGGGCGGG - Intronic
926453824 2:13040184-13040206 CTGCTCAGGTAGGCGGCGGCTGG + Intergenic
926618245 2:15021119-15021141 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
927327144 2:21818251-21818273 CCTCTGAGGGAGTTGGTGTCAGG - Intergenic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927533745 2:23836257-23836279 GCTCTCTGTGAGGCTGTGGCTGG + Intronic
927565994 2:24113628-24113650 CCACTTTGGGAGGCGGAGGCGGG + Intronic
927757156 2:25718172-25718194 CCTGTAAGGGAGGCTGAGGCAGG - Intergenic
927871242 2:26625462-26625484 GCTATCTGGGAGGCGGAGGCAGG - Intronic
927911323 2:26901948-26901970 CCTCTGAAAGAGGCTGTGGCAGG + Intronic
928109876 2:28497963-28497985 GCTCTCTGGGAGGCCGAGGCAGG - Intronic
928129435 2:28638950-28638972 CTACTCAGGGAGGCTGAGGCAGG + Intronic
928888384 2:36176508-36176530 GCTCTTAGGGAGGCCGAGGCGGG + Intergenic
929174939 2:38966890-38966912 TCTCTCAGGCAGGCAGTGGCTGG - Intronic
929606419 2:43237507-43237529 CTACTCAGGGAGGCTGAGGCAGG - Intronic
930225028 2:48783517-48783539 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
930957367 2:57218311-57218333 TCTCTCTGTGAGGCTGTGGCTGG - Intergenic
931436296 2:62250210-62250232 GCTCTCTGGGAGGCTGAGGCAGG + Intergenic
931672694 2:64662992-64663014 CCACTCTGGGAGGCCGAGGCGGG + Intronic
931780949 2:65579026-65579048 GCTCTTAGGGAGGCAGAGGCAGG + Intergenic
932259704 2:70316958-70316980 ACTCTCAGGGGTGTGGTGGCAGG + Intergenic
932324472 2:70848155-70848177 CCTCTCAGGGAGTGGGGAGCTGG + Intergenic
932478385 2:72023508-72023530 GCTCTCTGGGAGGCCGAGGCAGG - Intergenic
932488674 2:72104576-72104598 GCTCTTTGGGAGGCGGAGGCGGG - Intergenic
933101719 2:78268061-78268083 GCACTCTGGGAGGCGGAGGCGGG - Intergenic
933211312 2:79572503-79572525 ACTCTCTGGGAGGCCGAGGCGGG + Intronic
933670975 2:85006987-85007009 CCACTCAGGAAGGCTGAGGCAGG + Intronic
933723554 2:85413331-85413353 ACACTCTGGGAGGCCGTGGCGGG + Intronic
933757419 2:85650700-85650722 CCTATCTGGGAGGCTGAGGCAGG + Intergenic
934658140 2:96127683-96127705 CTACTCAGGGAGGCTGAGGCAGG - Intronic
934999578 2:99000396-99000418 CTACTCAGGGAGGCTGAGGCAGG + Intronic
935403849 2:102687888-102687910 CTACTCAGGGAGGCTGAGGCAGG - Intronic
935479809 2:103572411-103572433 GCTCTTAGGGAGGCCGAGGCGGG - Intergenic
935551726 2:104464965-104464987 GCTCTTAGGGAGGCTGAGGCGGG - Intergenic
935636653 2:105254318-105254340 CCTCACAGGCAGGCTGTGTCAGG + Intergenic
936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG + Intronic
936049386 2:109211754-109211776 CTACTCAGGGAGGCTGAGGCAGG - Intronic
936094396 2:109520818-109520840 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
936704387 2:115054664-115054686 CCACTTAGGGAGGCTGAGGCAGG + Intronic
937246551 2:120497592-120497614 CAGCTCAGGGAGGTGGTGTCAGG + Intergenic
937487609 2:122332023-122332045 ACTCTTAGGGAGGCAGAGGCGGG + Intergenic
937907841 2:127061038-127061060 CCCCTCAGGAAGGAGGTGGAGGG - Intronic
938141340 2:128797168-128797190 CCTGTCAGTGTGGTGGTGGCAGG + Intergenic
938715166 2:134012835-134012857 CCACTCAGGGAGGCTGAGGCAGG + Intergenic
938734843 2:134176459-134176481 CTACTCAGGGAGGCTGAGGCAGG + Intronic
938819135 2:134936640-134936662 CTTCTCAGGGAGGCTGAGGCAGG + Intronic
939492057 2:142888209-142888231 GCACTTAGGGAGGCGGAGGCTGG + Intronic
939526806 2:143305316-143305338 CCTGTCAGGGGGTCGGGGGCTGG + Intronic
939574499 2:143879924-143879946 CCTCTCAGGGAAGCTGTGATAGG + Intergenic
939888401 2:147706446-147706468 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
940200922 2:151149736-151149758 GCTCTTAGGGAGGCAGAGGCAGG + Intergenic
940219307 2:151335027-151335049 ACACTCAGGGAGGCTGAGGCGGG + Intergenic
940653875 2:156465095-156465117 GCACTCTGGGAGGCCGTGGCGGG - Intronic
940703325 2:157073595-157073617 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
942443932 2:176065880-176065902 CTGCTCAGGGAGGCTGAGGCAGG + Intergenic
942566283 2:177267312-177267334 CTACTCAGGGAGGCTGAGGCAGG + Intronic
943738758 2:191388035-191388057 ACACTTAGGGAGGCGGAGGCAGG + Intronic
943940851 2:193994265-193994287 GCTCTTAGGGAGGCTGAGGCGGG + Intergenic
944195422 2:197048337-197048359 CCTGTCAGGGAGTGGGGGGCAGG - Intronic
944699945 2:202238106-202238128 CCTCCCAGGGAGGTGGAAGCGGG + Intronic
944711376 2:202337749-202337771 GCTGTCAGGGAGGCAGAGGCCGG - Intergenic
944827672 2:203501938-203501960 CTACTCAGGGAGGCTGAGGCAGG - Intronic
944909481 2:204295895-204295917 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
944917813 2:204378770-204378792 CCACTCGGGGAGGCTGAGGCAGG - Intergenic
945917749 2:215721881-215721903 CCTGTCAGGGAGTCGGGGGAGGG + Intergenic
946367551 2:219258574-219258596 GCACTCAGGGAGGCTGAGGCAGG - Intronic
946403863 2:219482831-219482853 CCTCTCCCGGCGGAGGTGGCAGG + Exonic
946850070 2:223897488-223897510 CTACTCAGGGAGGCTGAGGCAGG - Intronic
947837865 2:233188321-233188343 CCACCCTGGCAGGCGGTGGCAGG - Intronic
947847520 2:233257273-233257295 CCTCTCTGGGAGGCCGAGGCGGG - Intronic
948233912 2:236372856-236372878 GCACTCTGGGAGGCGGAGGCAGG - Intronic
948365715 2:237453208-237453230 CCCCTCAGGGATGGGGTGGGAGG + Intergenic
948637458 2:239348691-239348713 CCCCTCAGGGAGGGTGTGGAGGG + Intronic
948888651 2:240896474-240896496 CCTGGCAGGGAGGCTGGGGCAGG - Intronic
1168927084 20:1590735-1590757 CCGCACAGTGAGGCTGTGGCAGG + Intronic
1169061830 20:2666079-2666101 GCTACCAGGGAGGCGGAGGCAGG - Intergenic
1169123648 20:3111966-3111988 GTTCTCAGGGATGCGGAGGCAGG - Intronic
1169293970 20:4376669-4376691 ACACTCAGGGAGGCCGAGGCAGG - Intergenic
1169328718 20:4699369-4699391 CACCTCAGGGCGGTGGTGGCTGG + Exonic
1169380434 20:5102115-5102137 CCTATAGGGGAGGTGGTGGCAGG - Intronic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1169428366 20:5513536-5513558 CCACTTAGGGAGGCCGAGGCAGG - Intergenic
1169435955 20:5590292-5590314 GCACTCTGGGAGGCTGTGGCGGG + Intronic
1169769656 20:9187084-9187106 TCCCTCAGGGAGGCTGAGGCAGG - Intronic
1170039592 20:12025923-12025945 ATTCTCAGGGAGGCAGAGGCAGG - Intergenic
1170737480 20:19024278-19024300 GCACTCAGGGAGGCCGTAGCAGG + Intergenic
1171174373 20:23040432-23040454 CTTTTCAGGGAGGGGTTGGCAGG + Intergenic
1172067222 20:32230139-32230161 GCACTCAGGGAGGCCGAGGCAGG + Intronic
1172439044 20:34952544-34952566 CTACTCAGGGAGGCTGAGGCGGG - Intronic
1173502671 20:43565463-43565485 CCTCTCAGGGAAGCCTGGGCTGG + Intronic
1173789448 20:45818206-45818228 GCACTCTGGGAGGCGGAGGCAGG + Intergenic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1173892130 20:46520845-46520867 ACACTCAGGCAGGTGGTGGCTGG - Intergenic
1173898149 20:46566431-46566453 CCTCTCTGGGGGGCGGCAGCTGG - Intronic
1174292038 20:49516125-49516147 CTTCTTTGGGAGGCTGTGGCAGG - Intronic
1174808624 20:53627006-53627028 GCTCTCAGGGAGGCAGAGGCAGG - Intergenic
1175138667 20:56843493-56843515 CCTCGCAGGGAGCTGGTGCCTGG + Intergenic
1175145561 20:56893466-56893488 GCTCACAGGAAGGCTGTGGCAGG - Intergenic
1175152546 20:56946491-56946513 TCTCTCAGGGAAGTGGTGGAGGG + Intergenic
1175222624 20:57426096-57426118 GCTCTTAGGGAGGCAGAGGCGGG - Intergenic
1175330412 20:58159911-58159933 CCTGCCGGTGAGGCGGTGGCAGG - Intronic
1175360563 20:58408035-58408057 CCACCCATGGAGGTGGTGGCAGG + Intronic
1175482149 20:59319274-59319296 CCCAGCAGGGAGGCGGGGGCGGG + Intronic
1175529445 20:59664398-59664420 GGTCACAAGGAGGCGGTGGCAGG - Intronic
1175607314 20:60321502-60321524 CCACTGAGGGAGATGGTGGCAGG + Intergenic
1175720325 20:61281741-61281763 CCTCCAGGGGAGGAGGTGGCGGG - Intronic
1175743599 20:61437571-61437593 CCTCTCAGGGAGGGAGATGCTGG + Intronic
1175834237 20:61983036-61983058 GCTCTGAGTGAGGCGGAGGCGGG + Intronic
1176185073 20:63773848-63773870 CCTTTCCAGGAGGCGGTGGCAGG - Intronic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1176670730 21:9732899-9732921 CCCTTCAGGTAGGCTGTGGCAGG + Intergenic
1176905144 21:14491352-14491374 CCACTCTGGGAGGCTGAGGCAGG - Intronic
1177044778 21:16155973-16155995 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1178037824 21:28604255-28604277 CCTCTCAGGGAGTGAGGGGCTGG + Intergenic
1178232688 21:30804851-30804873 CCTGTCAGGGAGTGGGGGGCAGG + Intergenic
1178445709 21:32639642-32639664 CCTCTTTGGGAGGCTGAGGCAGG - Intronic
1179043765 21:37827972-37827994 CCTCACAGCTAGGAGGTGGCTGG + Intronic
1179367046 21:40768322-40768344 CCCCTCAGGGTGGGGGTGGGGGG - Intronic
1179583882 21:42362659-42362681 GCTCTCTGGGAGGCTGAGGCGGG + Intronic
1179654645 21:42837698-42837720 CCCCTCGGGGAGACGGGGGCGGG - Intergenic
1180180262 21:46115788-46115810 CCTCTCAGAGGAGCTGTGGCAGG + Intronic
1180539618 22:16431725-16431747 CCTATCAAGGGGGCGGGGGCAGG + Intergenic
1180675170 22:17581614-17581636 GCTCTTACTGAGGCGGTGGCGGG - Intronic
1180837451 22:18937279-18937301 GCACTCTGGGAGGCGGAGGCGGG - Intergenic
1180845981 22:18982610-18982632 GCTCTTAGGGAGGCTGAGGCAGG + Intergenic
1180850013 22:19013416-19013438 GCTCTTAGGGAGGCTGAGGCAGG - Intergenic
1181128769 22:20717297-20717319 CTTCCCATGGAGGCGGTGGGGGG + Intronic
1181480425 22:23195479-23195501 CTACTCAAGGAGGCTGTGGCAGG + Intronic
1181578546 22:23812974-23812996 GCTATCAGGGAGGCTGAGGCAGG - Intronic
1181815805 22:25436048-25436070 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1182090089 22:27588610-27588632 CACCTCTGGGAGGCAGTGGCTGG + Intergenic
1182395195 22:30030619-30030641 GCTCTCAGCGAGGAGGGGGCGGG + Intronic
1182418622 22:30237720-30237742 CCACTCAGTGAGGCTTTGGCTGG - Intergenic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1183098062 22:35566208-35566230 GCACTCTGGGAGGCGGAGGCGGG + Intergenic
1183184345 22:36283288-36283310 GCTCTCTGGGAGGCCGAGGCGGG + Intronic
1183264624 22:36817588-36817610 CGACGCAGGGAGGAGGTGGCAGG + Intronic
1183430155 22:37761073-37761095 GCTCTCAGGAAGGCATTGGCTGG + Intronic
1183490195 22:38111816-38111838 GCCCTCAGGGAGGCTGGGGCTGG + Exonic
1183562858 22:38590166-38590188 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1183657027 22:39192220-39192242 ACTCTCTGGGAGGCCGAGGCGGG - Intergenic
1183838255 22:40475423-40475445 GCTACCAGGGAGGCTGTGGCAGG + Intronic
1184002541 22:41685717-41685739 CCTCTTTGGGAGGCTGAGGCAGG + Intronic
1184214245 22:43055989-43056011 GCTCTTAGGGAGGCAGAGGCAGG - Intronic
1184379946 22:44138976-44138998 CCTCTCAGGAAGGCAGTGCATGG + Intronic
1184440068 22:44505599-44505621 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1184565429 22:45288990-45289012 ACCCACAGGGAGGCGGTGGGGGG - Intronic
1184747212 22:46463267-46463289 GCTCTCTGGGAGGCTGAGGCGGG + Intronic
1185100005 22:48835114-48835136 GCACTCTGGGAGGCCGTGGCAGG + Intronic
1185102696 22:48850201-48850223 CCACTCAGGGAGTCGTGGGCAGG + Intronic
1185327092 22:50231746-50231768 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1185417871 22:50720081-50720103 CCTCTGTGGGAGGGGGTTGCCGG + Intergenic
1203287544 22_KI270734v1_random:162578-162600 GCACTCTGGGAGGCGGAGGCGGG - Intergenic
949359546 3:3216984-3217006 CCTCACAGGGAGGCAGTTGCGGG - Intergenic
949747473 3:7311703-7311725 CTACTCAGGGAGGCTGAGGCAGG - Intronic
949985924 3:9541049-9541071 CTACTCAGGGAGGCTGAGGCAGG - Intronic
950034047 3:9871739-9871761 CCACTCAGGAAGGCTGAGGCAGG - Intronic
950372699 3:12544427-12544449 CCACTCTGGGAGGCTGAGGCAGG + Intronic
950406870 3:12810310-12810332 CCCCTTACCGAGGCGGTGGCCGG - Exonic
950714886 3:14840938-14840960 ACTCTCAGCCAGGCGGTGGTAGG + Intronic
951262285 3:20523956-20523978 CATCTCAGGGAGGCTGCAGCAGG + Intergenic
951915468 3:27796602-27796624 CCACTCTGGGAGGCTGAGGCAGG - Intergenic
952783290 3:37126138-37126160 CTACTCAGGGAGGCTGAGGCAGG - Intronic
953324975 3:42005335-42005357 CCACTTTGGGAGGCTGTGGCAGG - Intergenic
953913660 3:46905118-46905140 CCTCGCAGGGAGATGGTGACAGG + Intergenic
953966839 3:47314577-47314599 GCTCTCAGGGAGGCAGAGGTGGG - Intronic
954162292 3:48731415-48731437 ACTCTTAGGGAGGCAGAGGCGGG + Intronic
954164319 3:48744104-48744126 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
954399495 3:50311907-50311929 CCCCTCACGGATGGGGTGGCTGG + Intronic
954462174 3:50633589-50633611 CCCCTCAGGGAGGGGTTGTCTGG + Intronic
954737476 3:52718224-52718246 ACTCTCTGGGAGGCCGAGGCAGG + Intronic
955327553 3:58020960-58020982 CCTCCTAGGGAGGCCGGGGCAGG + Intronic
955638488 3:61056173-61056195 GCTCTCAGGGAGGCAGAGGCGGG + Intronic
955740278 3:62083345-62083367 GCTCTTAGGGAGGCAGAGGCAGG - Intronic
955777862 3:62452865-62452887 GCACTCAGGGAGGCTGAGGCAGG + Intronic
955912065 3:63867448-63867470 GCACTCTGGGAGGCTGTGGCAGG - Intronic
956707440 3:72011509-72011531 CCACCCAGGGAGTCTGTGGCTGG - Intergenic
956760601 3:72440276-72440298 ACTCTCTGGGAGGCTGAGGCGGG + Intronic
957417998 3:79930249-79930271 GCTCTGAGTGAGGCTGTGGCTGG - Intergenic
959066475 3:101662376-101662398 GCTCTCTGGGAGGCTGAGGCAGG + Intronic
959225804 3:103582906-103582928 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
959419224 3:106111564-106111586 CCTGTCCGGGAGGAGGTGGGGGG - Intergenic
959603202 3:108212318-108212340 GCTCTTCGGGAGGCGGTGGGAGG - Intronic
960900558 3:122550323-122550345 GCACTCTGGGAGGCGGAGGCAGG - Intronic
961605989 3:128095866-128095888 ACTCTCTGGGAGGCTGAGGCGGG - Intronic
961652669 3:128424932-128424954 TTTCTCAGGGAGGCAGTGGCGGG + Intergenic
961725027 3:128922229-128922251 GCTCTCAGGGAGGCTGAGGCAGG + Intronic
962770877 3:138609080-138609102 CATCTCTGGGCGGCGGCGGCGGG + Intronic
963019950 3:140863496-140863518 CCTGGCAGGGGGGCAGTGGCAGG + Intergenic
963929999 3:150993946-150993968 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
964264697 3:154880979-154881001 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
964960265 3:162413994-162414016 GCTCTCAGGGAGGCAGAGGCGGG + Intergenic
965260282 3:166473894-166473916 GCACTTTGGGAGGCGGTGGCGGG + Intergenic
965405772 3:168266559-168266581 GCACTCAGGGAGGCCGAGGCAGG - Intergenic
965534597 3:169812086-169812108 GGTCTCCGGGAGGGGGTGGCGGG - Intronic
966729327 3:183137205-183137227 CTACTCAGGGAGGCTGAGGCAGG + Intronic
966747555 3:183292306-183292328 GCTCTTAGGGAGGCAGAGGCAGG + Intronic
967278075 3:187795882-187795904 CCTGGCAGAGAGGTGGTGGCCGG - Intergenic
967493654 3:190120428-190120450 CCTCGCCGGGGGGCGGGGGCGGG + Exonic
967910435 3:194538160-194538182 GCACTCTGGGAGGCTGTGGCAGG + Intergenic
967932509 3:194700560-194700582 CATCTCAGGGGGGCCGTGGCAGG - Intergenic
968711346 4:2121186-2121208 GCACTCTGGGAGGCGGAGGCAGG + Intronic
969690344 4:8700828-8700850 CCCACCAGGGAGGGGGTGGCTGG - Intergenic
969956777 4:10898594-10898616 GCACTCAGGGAGGCTGAGGCAGG + Intergenic
970438964 4:16063348-16063370 CCACTCTGGGAGGCCGAGGCAGG + Intronic
971332725 4:25695475-25695497 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
971678813 4:29670198-29670220 CCTCTTTGGGAGGCCGAGGCGGG - Intergenic
972418725 4:38867660-38867682 CCTCGCAGCGTGGGGGTGGCCGG + Intronic
973685501 4:53365790-53365812 CGTCTCCTGGAGGCGGTGGGGGG - Exonic
974114082 4:57559430-57559452 CCTGTCAGGGGGTCGGGGGCTGG - Intergenic
974420247 4:61663399-61663421 GCTCCCAGCGAGGCTGTGGCTGG - Intronic
974894967 4:67927406-67927428 TCTCTCTGTGAGGCTGTGGCTGG - Intronic
974911290 4:68123972-68123994 GCACTCTGGGAGGCGGAGGCAGG + Intronic
975087172 4:70355908-70355930 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
975209938 4:71688459-71688481 GCTCTTAGGGAGGCCGAGGCGGG - Intergenic
975321432 4:73012786-73012808 GCTCTCTGTGAGGCTGTGGCTGG - Intergenic
975673326 4:76803090-76803112 CATCTCAGGGAGGAGGAGGGAGG - Intergenic
976292217 4:83431402-83431424 CCTCTTAGGGAGGCTGAGACAGG - Intronic
976532804 4:86174460-86174482 CCTGTCAGGGGGGTGGTGGAAGG + Intronic
976910117 4:90294263-90294285 GCTCTTAGGGAGGCAGAGGCAGG + Intronic
976938345 4:90667490-90667512 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
978582296 4:110244357-110244379 CCACTCTGGGAGGCTGAGGCAGG - Intergenic
979476103 4:121158993-121159015 CCACTCTGGGAGGCCATGGCAGG + Intronic
980334769 4:131457203-131457225 CCTGTCATGGAGTCGGGGGCAGG + Intergenic
980335953 4:131473703-131473725 CCTATCAGGGAGTTGGGGGCAGG - Intergenic
980912024 4:139002475-139002497 CCTCTTTGGGAGGCTGAGGCAGG - Intergenic
980912270 4:139004685-139004707 GCACTCTGGGAGGCGGAGGCGGG + Intergenic
981877744 4:149568538-149568560 CCACTTAGGGAGGCTGCGGCAGG + Intergenic
982150660 4:152452934-152452956 CCACTCTGGGAGGCTGAGGCAGG + Intronic
982750335 4:159153298-159153320 CCTCTCAGGTGGGGGGTGGGTGG - Intronic
983000473 4:162408541-162408563 CCTCCCTGAGAGGCTGTGGCTGG + Intergenic
983135416 4:164073489-164073511 CCTGTCAGGGAGTGGGGGGCAGG + Intronic
983246963 4:165298694-165298716 GCACTTAGGGAGGCGGAGGCAGG + Intronic
983332453 4:166347980-166348002 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
983453405 4:167933837-167933859 GCTCTTAGGGAGGCCGAGGCAGG - Intergenic
983753895 4:171310135-171310157 CCTGTCAGGGGGTGGGTGGCTGG - Intergenic
983903677 4:173163401-173163423 CCTCACTGGCAGGCGGTGGGAGG - Intergenic
983948550 4:173613401-173613423 CCTGTCAGGGGGGAGGGGGCTGG - Intergenic
984561865 4:181280607-181280629 GCTCTTTGGGAGGCGGAGGCGGG + Intergenic
984599578 4:181710793-181710815 GCTCTCAGGGAGGCAGAGGCGGG - Intergenic
984837224 4:184033305-184033327 GCTCTTAGGGAGGCTGAGGCGGG - Intergenic
985575111 5:670276-670298 CCTCTCTGAGGGGCGGGGGCCGG + Intronic
985604496 5:851136-851158 CCTCTCAGGGAGGATCTGGCAGG - Intronic
985666106 5:1182258-1182280 CCTCTTAGGGAGGCTGAGGCAGG - Intergenic
985833238 5:2251491-2251513 CCTCTCATGGAGCCGCAGGCTGG + Intergenic
985849065 5:2375160-2375182 CAACTCAGGGAGGCTGAGGCAGG + Intergenic
986482371 5:8202336-8202358 CATCTCAGGGAGGCCCTGGGAGG - Intergenic
987645074 5:20659896-20659918 GCTCTTTGGGAGGCCGTGGCAGG - Intergenic
987804226 5:22742068-22742090 CTACTCAGGGAGGCTGAGGCAGG + Intronic
988093123 5:26568563-26568585 GCTCTCTGTGAGGCTGTGGCAGG + Intergenic
988122400 5:26982929-26982951 ACACTCTGGGAGGCGGAGGCGGG - Intronic
988197543 5:28024821-28024843 CCACTCAGGGAGGCCAAGGCGGG + Intergenic
988348433 5:30069970-30069992 GCACTCAGGGAGGCGGGGGGCGG - Intergenic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
989302872 5:39915083-39915105 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
989612391 5:43307317-43307339 CCACTTTGGGAGGCTGTGGCGGG - Intronic
990200840 5:53371419-53371441 CCTCTCAGGGGAGAGGTGGGAGG + Intergenic
990376217 5:55173345-55173367 CCTCGGCCGGAGGCGGTGGCGGG - Intergenic
990390124 5:55310359-55310381 CCACTTTGGGAGGCGGAGGCTGG + Intronic
990529704 5:56660919-56660941 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
990860793 5:60324524-60324546 GCTATCAGGGAGGCTGAGGCGGG + Intronic
991347626 5:65686603-65686625 GCTCTTAGGGAGGCAGAGGCGGG - Intronic
991577012 5:68115212-68115234 CCACTTAGGGAGGCTGAGGCAGG - Intergenic
991696243 5:69275725-69275747 GCTCTTAGGGAGGCGGAGGCGGG + Intronic
992237902 5:74731057-74731079 CCTCTTTGGGAGGCCGAGGCAGG - Intronic
992478206 5:77124341-77124363 GCTCTCTGGGAGGCTGAGGCGGG + Intergenic
992694308 5:79269975-79269997 CCCCTCTGGGAGGCAGAGGCAGG - Intronic
992725766 5:79605855-79605877 CCACTCTGGGAGGCTGAGGCAGG + Intergenic
992817685 5:80461727-80461749 GCTCTTAGGGAGGCTGAGGCAGG + Intronic
993295266 5:86130629-86130651 CTACTCAGGAAGGCTGTGGCAGG - Intergenic
993538771 5:89122090-89122112 CCACTTTGGGAGGCGGAGGCGGG - Intergenic
994498520 5:100543699-100543721 CCACTCGGGGAGGCTGAGGCAGG - Intronic
995254706 5:110033214-110033236 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
996457251 5:123698965-123698987 CCTGTCAGGGAGGTGAGGGCAGG - Intergenic
996761601 5:126991607-126991629 CTACTCAGGGAGGCTGAGGCAGG + Intronic
997531265 5:134582694-134582716 CCTCTGAGGGAGAAAGTGGCAGG - Exonic
997804654 5:136905220-136905242 GCACTCAGGGAGGTGGAGGCAGG - Intergenic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
998529177 5:142869316-142869338 CTACTCAGGGAGGCTGAGGCAGG - Intronic
998618813 5:143771846-143771868 CCACTCAGGGAGGAGGAGGAAGG + Intergenic
999451324 5:151680480-151680502 CCTCTTTGGGAGGCTGAGGCGGG - Intronic
999757680 5:154677213-154677235 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
999938738 5:156516884-156516906 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1000214843 5:159145530-159145552 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
1000860558 5:166451338-166451360 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1001386954 5:171347676-171347698 GCTCTCAGGGAGGCAGAGGCAGG + Intergenic
1001863131 5:175077738-175077760 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1001911981 5:175528029-175528051 CTTCTCAGAGAGGCTGAGGCAGG - Exonic
1002038044 5:176488531-176488553 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1002072312 5:176687539-176687561 GCTCTCTGTGAGGCTGTGGCTGG + Intergenic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002385477 5:178862612-178862634 GCACTCCGGGAGGCTGTGGCTGG - Intronic
1003115087 6:3278254-3278276 CCTCTCATGCAGGCTGTGACAGG + Intronic
1003462149 6:6339522-6339544 GCTCTTCGGGAGGCTGTGGCTGG - Intergenic
1003591998 6:7444470-7444492 GCTCTTAGGGAGGCTGAGGCAGG + Intergenic
1003657564 6:8027585-8027607 GCACTCTGGGAGGCCGTGGCGGG + Intronic
1004157560 6:13183665-13183687 TTTCTCACTGAGGCGGTGGCGGG + Intronic
1004723007 6:18284787-18284809 CCACTTAGGGAGGCAGAGGCGGG + Intergenic
1005755622 6:28923220-28923242 CCGCTCGAGGAGGCGGTGGAGGG - Exonic
1005756288 6:28927457-28927479 CCACTCTGGGAGGCTGAGGCGGG + Intergenic
1006541524 6:34743985-34744007 GCTCTTAGGGAGGCTGAGGCAGG + Intergenic
1006844254 6:37051566-37051588 CGTCTCAGGGACACCGTGGCAGG - Intergenic
1006860680 6:37170062-37170084 CCTCTCCGGGAGGCCAAGGCGGG - Intergenic
1006999457 6:38295800-38295822 GCTCTTTGGGAGGCGGAGGCAGG + Intronic
1007351058 6:41273816-41273838 CCTCCCTGGCAGGTGGTGGCAGG - Intronic
1007724550 6:43907178-43907200 GCTCTGAGGGAGGCTGTGGGAGG - Intergenic
1007763723 6:44149107-44149129 TCTCTCAGGGGGAAGGTGGCAGG - Intronic
1007781556 6:44257480-44257502 CCGCTCCTGGAGGCGGCGGCGGG - Exonic
1007882926 6:45187166-45187188 ACACTCTGGGAGGCGGAGGCAGG + Intronic
1007901010 6:45412854-45412876 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1009753099 6:67898549-67898571 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1010230237 6:73528007-73528029 GCTCTCAGGGAGGCAGAGGCGGG + Intergenic
1010233448 6:73555377-73555399 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1010978746 6:82346130-82346152 CCTCTTTGGGAGGCTGAGGCAGG - Intergenic
1011175931 6:84560081-84560103 GCTCTCTGGGAGGCTGAGGCAGG + Intergenic
1012254190 6:97014058-97014080 CCACTTTGGGAGGCCGTGGCGGG + Intronic
1012766607 6:103375012-103375034 GCTATCAGGGAGGCTGAGGCAGG - Intergenic
1013082172 6:106822337-106822359 GCTCTCAGGGAGGCAGAGGCAGG + Intergenic
1013605195 6:111740860-111740882 CCTCTTTGGGAGGTGGAGGCAGG + Intronic
1013706460 6:112840693-112840715 CCACTTTGGGAGGCCGTGGCGGG + Intergenic
1013790508 6:113831368-113831390 GCTCTTAGGGAGGCAGAGGCAGG + Intergenic
1014280308 6:119435487-119435509 CTTCTCAGGGAGGCTGAGGCAGG + Intergenic
1014289410 6:119540582-119540604 GCTCTCTGCGAGGCTGTGGCTGG - Intergenic
1015244180 6:131059358-131059380 CCTCTTTGGGAGGCTGAGGCGGG - Intronic
1015718686 6:136217993-136218015 CCTCCAAGGGAGGCCATGGCAGG + Intergenic
1015772904 6:136787114-136787136 GCTCTTAGGGAGGCAGAGGCAGG + Intronic
1016102603 6:140120730-140120752 CCTCTCAGGGAGTGGGGGTCTGG + Intergenic
1016317891 6:142809838-142809860 GCACTCTGGGAGGCTGTGGCAGG - Intronic
1016954350 6:149611886-149611908 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1017117375 6:150990965-150990987 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1017180696 6:151549149-151549171 CCACTCTGGGAGGCTGAGGCGGG - Intronic
1017284477 6:152658451-152658473 GCCCTCAGGGAGGCTGAGGCAGG + Intergenic
1017460919 6:154649474-154649496 GCACTCTGGGAGGCGGAGGCGGG + Intergenic
1017863650 6:158423028-158423050 GCTCTCAGGGAGGCAGAGGCCGG + Intronic
1018255399 6:161913060-161913082 CCTCCCAGGGAGGCTGAGGCAGG + Intronic
1018314156 6:162540559-162540581 GCACTCAGGGAGGCTGAGGCAGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018669156 6:166165742-166165764 GGTCTCAGGGAAGCAGTGGCTGG + Exonic
1019468379 7:1203192-1203214 GCACTTAGGGAGGCGGAGGCAGG - Intergenic
1019475828 7:1243830-1243852 CCTCTCCTGGCGGCGGGGGCGGG + Intergenic
1019709654 7:2512406-2512428 TCTCTCAGGGCGGCAGAGGCTGG - Intergenic
1019725438 7:2599731-2599753 GCACTCCGGGAGGCGGAGGCAGG - Intronic
1019917002 7:4140073-4140095 GCTCCCAGGGAGGTGGTGACAGG - Intronic
1020059044 7:5138756-5138778 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1020075977 7:5259208-5259230 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1020078031 7:5271377-5271399 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1020161253 7:5773677-5773699 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1020165236 7:5802427-5802449 GCACTCTGGGAGGCTGTGGCAGG + Intergenic
1020341954 7:7121371-7121393 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1020796017 7:12679621-12679643 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1021245941 7:18261054-18261076 ACTCTCTGGGAGGCCGAGGCAGG + Intronic
1021387498 7:20049953-20049975 GCACTCTGGGAGGCGGAGGCAGG + Intergenic
1022459890 7:30595060-30595082 CTGCTCCGGGAGGCGGCGGCGGG - Exonic
1023104993 7:36755480-36755502 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1023221257 7:37921430-37921452 ACACCCAGCGAGGCGGTGGCAGG + Intronic
1023422403 7:39995759-39995781 GCTCTCTGGGAGGCCGAGGCAGG + Intronic
1023440494 7:40180362-40180384 CCACTTTGGGAGGCGGAGGCGGG - Intronic
1024053651 7:45645979-45646001 AATCTCAGGGAGGGGGTGGGAGG + Intronic
1024490494 7:49976854-49976876 GCACTCTGGGAGGCGGAGGCGGG + Intronic
1024539961 7:50468138-50468160 CCTCGCGGGCAGGGGGTGGCTGG + Intronic
1025080029 7:55973728-55973750 GCTCTCTGGGAGGCCGAGGCAGG - Intronic
1025200864 7:56960796-56960818 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1025203105 7:56974353-56974375 CTACTCAGGGAGGCTGAGGCGGG - Intergenic
1025668839 7:63602573-63602595 CTACTCAGGGAGGCTGAGGCGGG + Intergenic
1025671079 7:63616136-63616158 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1025941380 7:66078163-66078185 CCGCTGGGGGAGGCGGTGCCAGG + Intronic
1026153849 7:67810682-67810704 ACTCTCTGGGAGGCCGAGGCAGG - Intergenic
1026556418 7:71412481-71412503 CCTCTCAGCGGGGCTGAGGCAGG - Intronic
1026587614 7:71669267-71669289 GCTCTCTGGGAGGCCGAGGCTGG + Intronic
1026630149 7:72030978-72031000 GCACTTTGGGAGGCGGTGGCAGG - Intronic
1026742124 7:72985346-72985368 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1026801968 7:73405770-73405792 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1026817592 7:73524107-73524129 CGTCTCAGGGAGGCGGGGGGGGG + Intergenic
1026998952 7:74638400-74638422 CCACTCTGGGAGGCCGAGGCAGG - Intergenic
1027028246 7:74870093-74870115 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1027050135 7:75016587-75016609 CCTCTCAGGGAGGCTCTGGGTGG - Intronic
1027057193 7:75057909-75057931 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1027101611 7:75379731-75379753 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1027122663 7:75533103-75533125 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
1027907019 7:84197984-84198006 CCACTATGGGAGGCGGAGGCCGG - Intronic
1028136499 7:87228511-87228533 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
1028316221 7:89406066-89406088 CCTGTCAGGGAGTGGGGGGCAGG - Intergenic
1028569412 7:92269954-92269976 CCTGTCAGGGGGTCGGTGGGGGG - Intronic
1028881430 7:95884685-95884707 GCTCTCAGGGAGGCAGAGGCGGG + Intronic
1028899083 7:96075837-96075859 CCTCTCAAGGGGCTGGTGGCTGG - Intronic
1029327739 7:99824197-99824219 GCTCTCTGTGAGGCTGTGGCTGG - Intergenic
1029417440 7:100451869-100451891 CCTATCTGGGAGGCTGAGGCAGG - Intergenic
1029459991 7:100688846-100688868 CCTCTCTGGGAGGCTGAGACAGG + Exonic
1029495833 7:100895235-100895257 CCGCTCAGGGCGGCGGGGGCTGG - Intronic
1030035847 7:105407847-105407869 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1030106681 7:105993421-105993443 GCACTCAGGGAGGCAGAGGCAGG + Intronic
1030697255 7:112599355-112599377 ACTCTCCGGGAGGCTGAGGCAGG + Intergenic
1031005346 7:116464222-116464244 CTACTCAGGGAGGCTGAGGCGGG - Intronic
1031008940 7:116503716-116503738 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1031135685 7:117881493-117881515 GCACTCTGGGAGGCTGTGGCAGG - Intergenic
1031805296 7:126300480-126300502 GCTCTAAGGTAGGTGGTGGCGGG - Intergenic
1032131946 7:129236585-129236607 CCTCTTTGGGAGGCTGAGGCGGG - Intronic
1032291239 7:130591377-130591399 CCTGTCTGGGAGGAGGTGGGGGG + Intronic
1032327639 7:130946238-130946260 CCACTCTGGGAGGCTGAGGCAGG + Intergenic
1032384427 7:131511700-131511722 GCTCTGAGGGAGGCAGAGGCGGG - Intronic
1032783421 7:135182572-135182594 CCCCTCAAGGTGACGGTGGCGGG - Intergenic
1034101691 7:148456602-148456624 CCTCGCAGGGAGCTGGTGTCTGG - Intergenic
1034172330 7:149071899-149071921 CTGCTGCGGGAGGCGGTGGCTGG + Exonic
1034356422 7:150453897-150453919 GCTCTTAGGGTGGCAGTGGCGGG + Intronic
1034649311 7:152676724-152676746 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1036188394 8:6646176-6646198 GCTCTCTGGGAGGCTGAGGCGGG + Intergenic
1036382764 8:8248614-8248636 ACTCACAGGGAGGCTGAGGCAGG + Intergenic
1036823680 8:11959386-11959408 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1038190467 8:25315206-25315228 CCTCACAGTGAGGGGGTGTCTGG - Intronic
1038309958 8:26438945-26438967 CCACTCTGGGAGGCCGAGGCAGG - Intronic
1039486020 8:37910470-37910492 GCACTCTGGGAGGCGGAGGCGGG - Intergenic
1039864987 8:41492413-41492435 GCACTCTGGGAGGCCGTGGCGGG + Intronic
1039918855 8:41878950-41878972 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1039922943 8:41905991-41906013 CCTGTCAGGGAGTCGGGGGGAGG + Intergenic
1039983688 8:42429849-42429871 CATCTCAGGGACGCTGTGGCTGG + Intronic
1041288878 8:56289198-56289220 CCTCTTTGGGAGGCCGAGGCAGG - Intergenic
1042246459 8:66712968-66712990 ACTCTCCGGGAGCCGGGGGCTGG - Intronic
1042566256 8:70115260-70115282 CTTCTCCGGGAGGCTGAGGCAGG - Intronic
1042687744 8:71461394-71461416 GCTCTCTGTGAGGCTGTGGCTGG + Intronic
1043527383 8:81111779-81111801 CGACTCAGCGAGGCGGCGGCTGG + Exonic
1044222595 8:89686766-89686788 CCTCTCAGGGTTGTGGTGGGGGG - Intergenic
1044895337 8:96885740-96885762 AATCTCAGGGAGGCCGAGGCGGG + Intronic
1045211679 8:100106094-100106116 CCGCCCAGGGAGGCCGAGGCCGG + Exonic
1045509960 8:102806546-102806568 CCTCCGGGGGAGGCGGGGGCGGG - Intergenic
1045768097 8:105700835-105700857 GCGCTTTGGGAGGCGGTGGCTGG - Intronic
1046992242 8:120471547-120471569 GCACTCTGGGAGGCGGAGGCAGG - Intronic
1047964763 8:130038438-130038460 GCACTTTGGGAGGCGGTGGCGGG + Intergenic
1048476013 8:134742895-134742917 CCTCTGGGTGAGGCGCTGGCAGG - Intergenic
1048913840 8:139163385-139163407 CCACTTTGGGAGGCCGTGGCAGG - Intergenic
1049129006 8:140820209-140820231 CTACTCAGGGAGGCTGGGGCAGG - Intronic
1049239793 8:141531399-141531421 GCACTCTGGGAGGCCGTGGCGGG - Intergenic
1049467115 8:142756652-142756674 CTTATCAGGGAGGCGGTGGGCGG + Intergenic
1049513025 8:143039331-143039353 CCTGTCAGGGAAGCTGAGGCTGG - Exonic
1049769755 8:144374441-144374463 GCTCTCGGGGAGGCTGAGGCGGG - Intronic
1050473670 9:6019027-6019049 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1050550989 9:6748052-6748074 CCTATGAGGGAGGCTGAGGCAGG + Intronic
1050854990 9:10343125-10343147 CCTGTCAGGGGGTCGGGGGCTGG - Intronic
1052020553 9:23520677-23520699 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1054204932 9:62122376-62122398 CCACTTTGGGAGGCGGAGGCAGG - Intergenic
1054594472 9:67050934-67050956 GCACTCTGGGAGGCGGAGGCCGG - Intergenic
1054890942 9:70251017-70251039 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
1055510388 9:76990539-76990561 GCTCTCAGAGAGGCAGAGGCAGG - Intergenic
1055842166 9:80518777-80518799 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1056065281 9:82927175-82927197 GCTCTCCGGGAGGCTGAGGCAGG - Intergenic
1056095363 9:83247958-83247980 CCCCTCAAGGAGTGGGTGGCTGG - Exonic
1056108288 9:83369463-83369485 CTACTCAGGGAGGCTGAGGCAGG + Intronic
1056389335 9:86126205-86126227 GCACTCTGGGAGGCGGGGGCGGG + Intergenic
1056564890 9:87762673-87762695 GCTATCAGGGAGGCTGAGGCAGG - Intergenic
1056992755 9:91425722-91425744 ACTACCAGGGAGGCTGTGGCCGG - Intergenic
1057135984 9:92688235-92688257 GCACTCAGGGAGGCCGAGGCAGG - Intergenic
1057218833 9:93244779-93244801 TCTCACAGGGAGGCCGAGGCAGG - Intronic
1057397154 9:94690389-94690411 GCTCTCAGGGAGGCAGAGGCAGG - Intergenic
1057497487 9:95572318-95572340 CCACTTAGGGAGGCTGAGGCAGG - Intergenic
1057599402 9:96444086-96444108 CCTATTAGGGAGGCTGAGGCAGG + Intergenic
1057764297 9:97902546-97902568 GCACTCTGGGAGGCGGAGGCGGG - Intergenic
1058507640 9:105682329-105682351 GCACTCTGGGAGGCGGAGGCAGG - Intergenic
1059259079 9:112958856-112958878 GCACTTAGGGAGGCAGTGGCAGG - Intergenic
1060097881 9:120809523-120809545 GCACTCAGGGAGGCCGAGGCAGG - Intergenic
1060299036 9:122363274-122363296 CAGCTCAGGGAGGCTGAGGCGGG - Intergenic
1061124873 9:128668287-128668309 GCACTCTGGGAGGCGGAGGCGGG - Intergenic
1061168272 9:128937165-128937187 GCTCTCAGGGAGGCAGAGGTGGG + Intronic
1061220280 9:129246612-129246634 CCTCTAAGGGTGGGGGTGGGGGG - Intergenic
1061544667 9:131297630-131297652 GCACTTTGGGAGGCGGTGGCAGG - Intronic
1061625943 9:131840714-131840736 CCTCTCAGGGAAGCACCGGCAGG - Intergenic
1061811098 9:133163258-133163280 CCTCTCCGGGAGGCAGGGCCCGG + Intronic
1061844767 9:133381248-133381270 CCACTCAGGAAGGCTGAGGCAGG - Intronic
1061956702 9:133966786-133966808 GCACTCTGGGAGGCCGTGGCGGG + Intronic
1062120267 9:134830341-134830363 CTTGTCAGGGTGGCGGGGGCTGG - Intronic
1062120425 9:134831145-134831167 CCACCCAGGGAGGCTGGGGCTGG - Intronic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062444864 9:136589356-136589378 CCTCTCAGGGAGGCCTCGTCAGG - Intergenic
1062475674 9:136725788-136725810 CATCCCAGGGGGGCGGGGGCGGG - Intergenic
1062659367 9:137620637-137620659 GCACTTAGGGAGGCGGAGGCAGG - Intronic
1062666142 9:137673666-137673688 GCCCTCAGGGAGGCTCTGGCCGG + Intronic
1185506987 X:638967-638989 ACTGTCAGGGAGGTGGTGGTGGG + Intronic
1185608309 X:1379869-1379891 CTACTCAGGGAGGCTGAGGCAGG - Intronic
1185731179 X:2463202-2463224 CTACTCAGAGAGGCTGTGGCAGG + Intronic
1185833011 X:3319510-3319532 CCTCTCTGGGCAGGGGTGGCTGG - Intronic
1186153654 X:6703380-6703402 GCTCTCTGGGAGGCGGAGGTAGG - Intergenic
1186310239 X:8309829-8309851 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1187693835 X:21898340-21898362 GCTCTTAGGGAGGCAGAGGCAGG + Intergenic
1188178287 X:27021933-27021955 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1188513977 X:30965356-30965378 CTACTCAGGGAGGCTGGGGCAGG + Intronic
1188837325 X:34974410-34974432 CCCCTCAGGGAGGCTATGCCTGG + Intergenic
1189250734 X:39599176-39599198 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1189455211 X:41181693-41181715 GCACTCAGGGAGGCGGAGGTGGG - Intronic
1189727501 X:43982909-43982931 GCTACCAGGGAGGCGGAGGCAGG + Intergenic
1189792247 X:44615004-44615026 CTACTCAGGAAGGCGGAGGCAGG + Intergenic
1189807751 X:44752379-44752401 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1190237766 X:48630528-48630550 GCACTCTGGGAGGCGGAGGCGGG + Intergenic
1190286165 X:48962659-48962681 CCTCCCCTGGCGGCGGTGGCAGG - Exonic
1190715766 X:53101886-53101908 CTACTCAGGGAGGCTGAGGCAGG + Intergenic
1190816480 X:53934306-53934328 GCTCTCAGGGAGGCAGAGGCGGG - Intergenic
1190841870 X:54152947-54152969 GCACTCTGGGAGGCGGAGGCTGG + Intronic
1190862046 X:54354524-54354546 CCTGTCAGGGAGGCGGAAGGAGG + Intronic
1191734018 X:64369607-64369629 CCTATCATGGAGGAGGGGGCAGG + Intronic
1191797157 X:65033840-65033862 GCTCTTCGGGAGGCGGAGGCGGG + Intronic
1191843121 X:65527099-65527121 CTTCTCGGGGAGGCTGAGGCAGG + Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1192068288 X:67910077-67910099 CCTCACAGGGATGTCGTGGCTGG + Intergenic
1192544140 X:71998728-71998750 ACTCTCAGGGAGGAGGTGTCTGG + Intergenic
1192816651 X:74600763-74600785 GCACTCTGGGAGGCGGAGGCAGG + Intronic
1193233256 X:79074230-79074252 GCTCTGAGGGAGGCTGAGGCAGG + Intergenic
1194656623 X:96581342-96581364 GCTCTTAGGGAGGCCGAGGCAGG - Intergenic
1195152456 X:102085815-102085837 GCTCTTAGGGAGGCAGAGGCAGG - Intergenic
1195238464 X:102926335-102926357 CCTCTCAGGGAGGTAGAGGATGG + Intergenic
1195309902 X:103622216-103622238 GCACTCTGGGAGGCGGAGGCGGG - Intronic
1195751245 X:108163352-108163374 TCTCTCAGGGCTGGGGTGGCTGG + Intronic
1196344952 X:114644094-114644116 GCTCTTTGGGAGGCGGAGGCAGG + Intronic
1196971286 X:121111439-121111461 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1197185890 X:123587220-123587242 GCTCTTAGGGAGGCAGAGGCGGG - Intergenic
1197220116 X:123904181-123904203 GCTCTCAGGGAGGCAGAGGCGGG - Intronic
1197576356 X:128216937-128216959 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1198197427 X:134378856-134378878 GCTCTCAGGGAGGCAGAGGCGGG - Intronic
1198695491 X:139332538-139332560 CCTCACATGGAGGTGGTGACAGG - Intergenic
1198946349 X:142019596-142019618 CCACTTTGGGAGGCGGAGGCAGG + Intergenic
1199804594 X:151285499-151285521 GCTCTTAGGGAGGCAGAGGCGGG - Intergenic
1199830547 X:151545376-151545398 CTGCTCAGGGAGGCTGAGGCAGG - Intergenic
1200821912 Y:7594585-7594607 CTACTCGGGGAGGCTGTGGCAGG - Intergenic
1201191866 Y:11451090-11451112 CCACTCAGAGAGGCTGAGGCAGG + Intergenic
1201345545 Y:12980514-12980536 GCACTTAGGGAGGCGGAGGCAGG - Intergenic
1201637169 Y:16136679-16136701 GCACTCAGGGAGACGGAGGCAGG - Intergenic
1201899364 Y:19032595-19032617 CTACTCAGGGAGGCTGAGGCAGG - Intergenic
1202238391 Y:22739431-22739453 CTACTCGGGGAGGCTGTGGCAGG + Intergenic