ID: 1133109140

View in Genome Browser
Species Human (GRCh38)
Location 16:3535248-3535270
Sequence ACGACTGCTTCAGTTCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133109140_1133109146 -6 Left 1133109140 16:3535248-3535270 CCCGGGGGAACTGAAGCAGTCGT 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1133109146 16:3535265-3535287 AGTCGTGAGGGGCACAGGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 231
1133109140_1133109147 20 Left 1133109140 16:3535248-3535270 CCCGGGGGAACTGAAGCAGTCGT 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1133109147 16:3535291-3535313 GTGAGTTCAACGACTCGCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133109140 Original CRISPR ACGACTGCTTCAGTTCCCCC GGG (reversed) Intronic
909407451 1:75307400-75307422 ATGAATGCTTCACTTCCCACAGG + Intronic
910763522 1:90758428-90758450 TCTACTGCTTCAGTGCCCACCGG + Intergenic
915108176 1:153547077-153547099 AGGACTGCCTGAGTTTCCCCTGG - Intronic
917774937 1:178322912-178322934 AGGACTGCTTCAGATTCCCTAGG + Intronic
921685770 1:218087687-218087709 GTAACTGCTTCAGTTCCCACAGG - Intergenic
922097583 1:222455645-222455667 ACGATTGCATCAGATCCCACAGG - Intergenic
922975502 1:229780316-229780338 ACGACTGCCTTAGTTCCCTTGGG - Intergenic
1062832197 10:613411-613433 ACAGCTGCTGCAGTTCCTCCCGG - Intronic
1063012949 10:2043629-2043651 AGGACTGGTTCAGTTCCCTGGGG - Intergenic
1065869173 10:29941363-29941385 ACTGCTGCTGCCGTTCCCCCTGG - Intergenic
1079226623 11:18611952-18611974 TCAACTGCTTCAGTTTCCTCTGG - Intronic
1089833679 11:121351080-121351102 ATGCCTGCTTCCCTTCCCCCTGG - Intergenic
1090400423 11:126445190-126445212 GAGACTGCCTCAGTTACCCCAGG - Intronic
1091050366 11:132362979-132363001 ACGCCTTGCTCAGTTCCCCCAGG - Intergenic
1091064895 11:132500470-132500492 ACAACTGCTTCAATGCCCTCTGG - Intronic
1092134401 12:6136614-6136636 AGCACTGCTTCAGCTCCACCAGG + Intergenic
1093401508 12:18752635-18752657 ACGAGTGCTTCAGTCCTCCAGGG - Intergenic
1097056691 12:56254366-56254388 ACGACTGCCTCATTTCCTCTCGG + Intronic
1101016358 12:100504927-100504949 AGGTCTGCCCCAGTTCCCCCAGG - Intronic
1102206352 12:111093590-111093612 CTGACTGCTTCAGCTCACCCAGG + Intronic
1105272610 13:18892283-18892305 ACCTCTGCTTCAGATACCCCAGG - Intergenic
1105836002 13:24212463-24212485 ACCAATGCCTCAGTTGCCCCTGG - Intronic
1106922057 13:34574357-34574379 TGGACTTCATCAGTTCCCCCAGG + Intergenic
1113071605 13:106426777-106426799 TCCACTGCTTCAGTTACTCCAGG - Intergenic
1114235715 14:20821889-20821911 AGGACAGCTTCAGTTCCCTATGG - Intergenic
1115213922 14:30996146-30996168 ACTGCTGCCTCAGCTCCCCCAGG + Intronic
1119927792 14:78512925-78512947 AGGACTGCTTCAGATCCTACGGG - Intronic
1124465862 15:29939422-29939444 GCGAATGCTTCAATTCCCTCTGG + Intronic
1131047834 15:89327213-89327235 ACGACTTCTTCATCTCCCGCTGG + Exonic
1133109140 16:3535248-3535270 ACGACTGCTTCAGTTCCCCCGGG - Intronic
1138197672 16:55063675-55063697 ACGACTGCTGCATTTCGTCCAGG - Intergenic
1140708157 16:77650303-77650325 ACAACTGATTCAGTTCCTGCTGG + Intergenic
1144326467 17:14186583-14186605 ACTACAGCATCAGTGCCCCCAGG + Intronic
1144475345 17:15583458-15583480 ACTACAGCATCAGTGCCCCCAGG + Intronic
1160136667 18:76277633-76277655 GCTACTGCTTCAGTTCCCCGAGG - Intergenic
1162729616 19:12710529-12710551 ACCAATGCCTCAGTTCTCCCTGG - Intronic
1165097339 19:33416812-33416834 ACCACTCATGCAGTTCCCCCAGG - Intronic
1165128595 19:33618266-33618288 AGGTCTGCTTCAGCTCTCCCAGG - Intergenic
925902251 2:8516977-8516999 ACTACTGCTTCTGCTCCCCCAGG - Intergenic
928026212 2:27741440-27741462 ACGACTGCTTGAGTTGAGCCTGG - Intergenic
930326150 2:49921428-49921450 ACCACTGCTCCAGTTGCACCAGG + Exonic
930899414 2:56485719-56485741 ACGTATGCTTCAGTATCCCCAGG + Intergenic
938100399 2:128494036-128494058 ACGACGGCTTCACTTCGTCCTGG + Intergenic
938902358 2:135808893-135808915 CCGAATGCTGCAGTTCTCCCTGG - Exonic
942409068 2:175687673-175687695 ACATCAGCTTCAGTTCCCTCCGG + Intergenic
1170368101 20:15618982-15619004 AGGACAGCTTCAGTTCCCTATGG - Intronic
1170584908 20:17727411-17727433 ACGGCTGCTCCAGTTCACCTGGG - Intronic
1175862053 20:62155785-62155807 ACAACTGAATCAGTGCCCCCAGG - Intronic
1179214266 21:39352545-39352567 CCTTCTGCTTCTGTTCCCCCTGG + Intergenic
1180027523 21:45176291-45176313 ATGACTCCTTCAGTTCCAGCGGG + Exonic
1180181458 21:46120371-46120393 GCGACTGTTGCAGGTCCCCCGGG + Intronic
1182130136 22:27844670-27844692 CCAACTGTTCCAGTTCCCCCAGG + Intergenic
957468489 3:80626914-80626936 AGGACAGCTTCAGTTCCCTATGG - Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962404130 3:135085804-135085826 CAGACTGCTTCTCTTCCCCCAGG + Intronic
963755739 3:149233449-149233471 AGGGCTGCTTCACTGCCCCCAGG + Intergenic
970067561 4:12116313-12116335 ACTACAGCTTCAGTTCCTTCTGG - Intergenic
970707186 4:18818390-18818412 ACCATTTCTTCAGTTACCCCAGG - Intergenic
980221831 4:129927984-129928006 CCGACTGCTTCAGTTACTCATGG + Intergenic
980907342 4:138961387-138961409 ACATCTGTTTCAGTTTCCCCCGG + Intergenic
981806304 4:148719500-148719522 ACCACTGCTGCAATTGCCCCAGG + Intergenic
986043941 5:4019809-4019831 ACGACAGCTTCAGTTCAGGCTGG + Intergenic
988461169 5:31439164-31439186 TCCACTGTTTCAGTTACCCCTGG + Intronic
990953747 5:61323416-61323438 ATGACAGCTTGAGTTCACCCTGG - Intergenic
994039104 5:95237455-95237477 AGAACTGCTTCAGTTCCTCTAGG + Intronic
994296891 5:98100962-98100984 ATGACTGATTCTGCTCCCCCAGG - Intergenic
996188638 5:120511828-120511850 ACAACTGCAGCAGTTCCTCCAGG - Intronic
998428719 5:142051743-142051765 AGGACTGCTTGAGTGTCCCCAGG + Intergenic
1003292780 6:4794157-4794179 ATGACGGCTACAGTGCCCCCAGG - Intronic
1004602968 6:17168477-17168499 AATACTGCTCCAGTACCCCCAGG - Intergenic
1011887640 6:92117262-92117284 ACTACTGCTTCACTTCCCTGTGG - Intergenic
1028981952 7:96977063-96977085 ATTACAGCTTCAGTTCCCCAGGG - Intergenic
1029819219 7:103129483-103129505 AGGACTGCTTCAGTTCCTTGAGG + Intronic
1034087657 7:148334791-148334813 ATGATTGCTGGAGTTCCCCCAGG - Intronic
1039473786 8:37828939-37828961 ACAAACGCTTCAGCTCCCCCAGG - Exonic
1041208144 8:55519341-55519363 ACGATTCCTTCAGTGGCCCCAGG - Intronic
1043785305 8:84390902-84390924 ATGACTGCTTCAGTCCCTCCTGG - Intronic
1046599903 8:116304033-116304055 ACTACTGCTTCTGTTATCCCAGG - Intergenic
1054877251 9:70109865-70109887 AGGATTGATTCAGTTCCCTCTGG - Intronic
1185622699 X:1463341-1463363 ACGCATCCTCCAGTTCCCCCTGG + Exonic
1187044890 X:15637557-15637579 ACAACAGCTTCACTTCTCCCAGG + Intronic
1188574296 X:31627801-31627823 ATTACTGCAACAGTTCCCCCTGG - Exonic
1192080421 X:68042479-68042501 TCAAGTGCTTCATTTCCCCCAGG + Exonic
1196138467 X:112234906-112234928 ATGACTGCTTCTATTCACCCTGG + Intergenic