ID: 1133112686

View in Genome Browser
Species Human (GRCh38)
Location 16:3558005-3558027
Sequence CCAGTTTACCAGTACACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 11, 3: 32, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133112686_1133112692 9 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112692 16:3558037-3558059 AAAACAAAATTTCAAAAACTGGG 0: 1
1: 1
2: 31
3: 407
4: 3399
1133112686_1133112691 8 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112691 16:3558036-3558058 AAAAACAAAATTTCAAAAACTGG 0: 1
1: 1
2: 35
3: 467
4: 4213
1133112686_1133112693 19 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112693 16:3558047-3558069 TTCAAAAACTGGGCTGTGCGTGG 0: 1
1: 0
2: 3
3: 48
4: 1007
1133112686_1133112694 22 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112694 16:3558050-3558072 AAAAACTGGGCTGTGCGTGGTGG 0: 1
1: 3
2: 83
3: 1530
4: 23375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133112686 Original CRISPR CCAGTTTACCAGTACACCAC TGG (reversed) Intronic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
905243739 1:36597892-36597914 CCGATTTACCAGCACACTACTGG + Intergenic
911310054 1:96281316-96281338 ACACTTTACCATTACACCAATGG - Intergenic
911444507 1:97973645-97973667 CCAGCTTACCAGAACACCACTGG - Intergenic
912025450 1:105164594-105164616 CCACTTTACCACTACACCCTAGG - Intergenic
912963229 1:114214413-114214435 ACAGTTTACCAGCACCCCACTGG - Intergenic
913296202 1:117323047-117323069 CCAGTTAACCAGCACACCGCTGG + Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
917657826 1:177144610-177144632 CCAGATTACCTCTAAACCACTGG - Intronic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
922241225 1:223756565-223756587 CCAGTTTCCCAGCACACCCCTGG + Intronic
1067043695 10:42971916-42971938 CCAGTGCACTAGGACACCACTGG + Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1075899922 10:126033269-126033291 CCAGTTTGCCAGCATACCATTGG + Intronic
1081909840 11:46693912-46693934 GCCATTTACCAGCACACCACTGG + Intronic
1085516463 11:77114774-77114796 GCAGTTTACCAGCACAGCACAGG - Intronic
1086949323 11:92875547-92875569 CTGGTTTACCAGCACACCCCTGG - Intronic
1087020804 11:93601144-93601166 GCAGTTTAGCAGCACACCACAGG + Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1088863310 11:113822057-113822079 CCAATTTACCAGGAGACAACAGG - Intronic
1089912568 11:122116800-122116822 CCATTTTACCAATACATCTCAGG - Intergenic
1095493702 12:42762549-42762571 TCATTTTACCAGCACACCACTGG + Intergenic
1095520855 12:43063665-43063687 GCAGGTTTCCAGTACACCACTGG + Intergenic
1095698498 12:45166418-45166440 GCAGTTTAGCAGTCCATCACTGG + Intergenic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1097747294 12:63315346-63315368 GCAGTTAACAAGTACACCTCAGG + Intergenic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1099666056 12:85630892-85630914 CCAATTTGCTAGCACACCACTGG - Intergenic
1101467921 12:104966898-104966920 CCAGTTTAGCGGTACACCACTGG - Intergenic
1102467664 12:113139391-113139413 TCAGTTTACCAATACACTACTGG + Intergenic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1102998795 12:117369515-117369537 GCAGTTTGCCAGTACATCCCAGG + Intronic
1103106594 12:118232198-118232220 TAAATTTACCAGTATACCACTGG + Intronic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1114702230 14:24690773-24690795 CCAGGTTAACATGACACCACTGG + Intergenic
1116923022 14:50601413-50601435 ACATTTTGCCAGCACACCACTGG - Intronic
1116923555 14:50608496-50608518 CCAGTTTATCAGCACATCACTGG + Intronic
1117305935 14:54473119-54473141 CCAGATTACCAGCTCATCACAGG - Intergenic
1125114893 15:36079187-36079209 CCAGTGAACCAGGACATCACTGG - Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1130038225 15:80380817-80380839 AAAATTTACCAGCACACCACTGG + Intronic
1130811979 15:87389355-87389377 CCAGGTAACCAGCACACCAATGG - Intergenic
1131992775 15:98106720-98106742 CCAGTTTGCCAGCAAACCACAGG - Intergenic
1132098154 15:99003753-99003775 CCAGTTTGCCAGCAAACCACAGG + Intronic
1132294144 15:100722990-100723012 CCAATTTACCAATACACCCCTGG - Intergenic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1138542079 16:57694703-57694725 CCACTATACCAGTGCACCGCTGG + Intergenic
1139028694 16:62852408-62852430 CCAGTTTATTAGCACACCACTGG - Intergenic
1140581015 16:76231260-76231282 CCAGTTCCTCAGTCCACCACTGG - Intergenic
1141798257 16:86289053-86289075 CCAGTTTGCCAGAATACCTCAGG + Intergenic
1145011241 17:19369480-19369502 CTACTTTACCAGCACATCACTGG + Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1147401877 17:40185180-40185202 AATATTTACCAGTACACCACTGG - Intronic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1152055268 17:78020111-78020133 CCAGTTGAGCTGTACACCTCTGG - Intronic
1152546932 17:81004721-81004743 CCATTTTAAAAGTACACCTCAGG + Intronic
1153885214 18:9458399-9458421 ACATTTTCCCAGTTCACCACTGG + Intergenic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1160090285 18:75820441-75820463 CCCATTTCCCTGTACACCACCGG - Intergenic
1164665988 19:30037302-30037324 CCTGCTCACCAGTACACCAGGGG + Intergenic
1164886800 19:31785125-31785147 CCAGTTTTGCAATCCACCACAGG + Intergenic
925881144 2:8353536-8353558 CCAGTTTACTATCATACCACTGG - Intergenic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
930224845 2:48781519-48781541 CTGGTTTACCAGCACAGCACTGG - Intergenic
931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG + Intergenic
936339836 2:111621421-111621443 CCAATTGACCAGAACGCCACTGG + Intergenic
936887289 2:117327613-117327635 CCAGTTTACCAGAATACCTATGG - Intergenic
938552251 2:132393249-132393271 TCAGTTTACCAGCACACCGCTGG + Intergenic
943541754 2:189224136-189224158 CCAGTTTACCTCTTCACAACAGG - Intergenic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
947575197 2:231267991-231268013 CCATTTTACAAATACATCACAGG - Intronic
948151369 2:235747441-235747463 CCAGCTTACCTGTTCACCCCGGG - Intronic
1173048378 20:39534955-39534977 AATGTTTACCAGAACACCACTGG + Intergenic
1175505650 20:59482513-59482535 CCAGTTGACAAGTACGCCAGAGG + Intergenic
1175575832 20:60060243-60060265 CCAGTTTTCCAGTCCTCCAGAGG - Intronic
1182345956 22:29664986-29665008 CCAGTTTACTATTAAACCACTGG + Exonic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
950311902 3:11966187-11966209 TCAGTTTACCAGCAAATCACAGG - Intergenic
950659298 3:14456890-14456912 CCAGGTTACCTGTCCACCACAGG - Intronic
954955864 3:54517868-54517890 CCAGTGGACCAGGACCCCACTGG + Intronic
960237404 3:115299650-115299672 CCAGTTCACCTGAACAACACAGG - Intergenic
965836979 3:172863573-172863595 CCAGTTTTCCAGCACACCTTTGG - Intergenic
965850537 3:173017504-173017526 CCAGGTTACCAGCATACCATTGG - Intronic
973119840 4:46508591-46508613 AACATTTACCAGTACACCACTGG + Intergenic
974262731 4:59545050-59545072 TCAGTTTAACAGTAGACAACTGG + Intergenic
977782909 4:100999276-100999298 CCAGTATACCATAACACCATTGG - Intergenic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
981354230 4:143768695-143768717 TGAGTTTATCAGCACACCACCGG - Intergenic
981443241 4:144806792-144806814 CCATTTTCCCAGTCCATCACTGG + Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
984133683 4:175910006-175910028 TCAGCTTACTAGCACACCACTGG - Intronic
987714136 5:21544843-21544865 CTAGTCTCCCAGTACAGCACTGG - Intergenic
996601924 5:125274094-125274116 CCCATTTACCAGCATACCACCGG - Intergenic
999869833 5:155737897-155737919 CCACTGTCCCATTACACCACAGG - Intergenic
1003055220 6:2812263-2812285 CCAACATACCAGTACACCAACGG - Intergenic
1004521033 6:16360844-16360866 CCATTATCCCAATACACCACTGG + Intronic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1007507666 6:42348739-42348761 CCAGTGTACCATTAGACCAAAGG - Intronic
1009002593 6:57737231-57737253 CTAGTCTCCCAGTACAGCACTGG + Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1015617087 6:135088750-135088772 CTGGCTTACCAGTTCACCACTGG - Intronic
1015953839 6:138580464-138580486 CCAGTTTACTAACACACCACTGG - Intronic
1016322915 6:142866950-142866972 CCTGTTCACCAGTTTACCACAGG - Intronic
1018335820 6:162787860-162787882 CCAGGTTACTAGTCCAACACTGG - Intronic
1018357776 6:163035944-163035966 CACATTTGCCAGTACACCACTGG + Intronic
1020017967 7:4842518-4842540 CCAGTTTCCCTGTGCACCCCCGG - Intronic
1021565882 7:22015879-22015901 ACAGTTTACCAGGACAATACAGG + Intergenic
1022642324 7:32199742-32199764 CCAGTTTGTCATTATACCACAGG + Intronic
1032617522 7:133490740-133490762 CCATATCACCAGTACACCATTGG - Intronic
1033451429 7:141465422-141465444 CCAGTTTGCCACCAAACCACAGG + Intronic
1033538561 7:142334727-142334749 CCAGTTTACAAGGACATCACTGG + Intergenic
1033540960 7:142355689-142355711 TCAGTGTACCAGCACATCACTGG + Intergenic
1033552184 7:142457635-142457657 CCAGTTTATCAGCACATCCCTGG + Intergenic
1033554453 7:142476572-142476594 CCAGTTTATCAGCACATCACTGG + Intergenic
1034133568 7:148743446-148743468 CCAATTTACCAGTATACCACTGG + Intronic
1037391760 8:18400292-18400314 CCAGTTAACAAATACAGCACTGG + Exonic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1040685671 8:49869498-49869520 CCAGTTTATGAATACACCAAAGG - Intergenic
1041394329 8:57375850-57375872 CCATTTTACCACTACTCCAGTGG - Intergenic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1042435485 8:68759889-68759911 CCAGATTCCCAGTACCTCACAGG - Intronic
1045415527 8:101962961-101962983 CCAATTTACTACTACATCACAGG - Intronic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1049263116 8:141650439-141650461 CCAGTTCACCAGCACACAACTGG - Intergenic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1058645711 9:107129952-107129974 CTATTTTTGCAGTACACCACGGG + Intergenic
1059731451 9:117061012-117061034 TCAGTTTACCAGCATACCACTGG + Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1061912667 9:133733321-133733343 CCAGTTTGCCAGGACACCCATGG + Intronic
1186673958 X:11795906-11795928 CCAATTTTGCAGTACATCACAGG - Intergenic
1188022068 X:25170036-25170058 CCAATTTACCAGCGCACCACTGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1195507707 X:105677687-105677709 GCTGTTTAGTAGTACACCACTGG + Intronic
1197163236 X:123346931-123346953 CCAGTTTTCCAGCATACCACTGG - Intronic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic
1199042157 X:143126814-143126836 GCATTTTACCACTACTCCACAGG + Intergenic
1199544778 X:148996294-148996316 ACATTTTACCAGCACACCACTGG - Exonic
1200207488 X:154327861-154327883 CCTGTTTACCATTAAACCTCTGG + Exonic