ID: 1133112686

View in Genome Browser
Species Human (GRCh38)
Location 16:3558005-3558027
Sequence CCAGTTTACCAGTACACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 11, 3: 32, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133112686_1133112693 19 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112693 16:3558047-3558069 TTCAAAAACTGGGCTGTGCGTGG 0: 1
1: 0
2: 3
3: 48
4: 1007
1133112686_1133112692 9 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112692 16:3558037-3558059 AAAACAAAATTTCAAAAACTGGG 0: 1
1: 1
2: 31
3: 407
4: 3399
1133112686_1133112691 8 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112691 16:3558036-3558058 AAAAACAAAATTTCAAAAACTGG 0: 1
1: 1
2: 35
3: 467
4: 4213
1133112686_1133112694 22 Left 1133112686 16:3558005-3558027 CCAGTGGTGTACTGGTAAACTGG 0: 1
1: 1
2: 11
3: 32
4: 96
Right 1133112694 16:3558050-3558072 AAAAACTGGGCTGTGCGTGGTGG 0: 1
1: 3
2: 83
3: 1530
4: 23375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133112686 Original CRISPR CCAGTTTACCAGTACACCAC TGG (reversed) Intronic