ID: 1133116955

View in Genome Browser
Species Human (GRCh38)
Location 16:3582889-3582911
Sequence TAGCATGTGGGGCAGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 182}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133116946_1133116955 -2 Left 1133116946 16:3582868-3582890 CCTGCCCCAGCCAGAAATGTCTA 0: 1
1: 0
2: 0
3: 32
4: 332
Right 1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 182
1133116947_1133116955 -6 Left 1133116947 16:3582872-3582894 CCCCAGCCAGAAATGTCTAGCAT 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 182
1133116949_1133116955 -8 Left 1133116949 16:3582874-3582896 CCAGCCAGAAATGTCTAGCATGT 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 182
1133116948_1133116955 -7 Left 1133116948 16:3582873-3582895 CCCAGCCAGAAATGTCTAGCATG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 182
1133116944_1133116955 21 Left 1133116944 16:3582845-3582867 CCTGCAGGCTACGCCAGCGGGAT 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 182
1133116945_1133116955 8 Left 1133116945 16:3582858-3582880 CCAGCGGGATCCTGCCCCAGCCA 0: 1
1: 0
2: 1
3: 22
4: 240
Right 1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 182
1133116943_1133116955 22 Left 1133116943 16:3582844-3582866 CCCTGCAGGCTACGCCAGCGGGA 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133116955 Original CRISPR TAGCATGTGGGGCAGGAACC AGG Intronic
901066161 1:6495648-6495670 TAGCATCTGGCGCAGGCACCAGG - Intronic
902607647 1:17577672-17577694 TAGCCTTTGGGGCTGGAATCTGG - Intronic
905460106 1:38117109-38117131 TGGAATTTGGAGCAGGAACCTGG + Intergenic
906166748 1:43692121-43692143 TAGCATGTGGGGCTTCACCCAGG - Intronic
912060925 1:105668664-105668686 TAGACTGTGGGGAAGGAATCAGG + Intergenic
912540091 1:110408057-110408079 TAGCCTGTGGGGCAAGTACGGGG + Intergenic
913487049 1:119341212-119341234 TTTCTTGTGGGGCAGAAACCAGG - Intergenic
913526577 1:119699494-119699516 AGGCAAGTGGGGCAAGAACCAGG - Intronic
916103713 1:161414808-161414830 TAGCACGTTGGGAAGCAACCTGG + Intergenic
916564469 1:165961438-165961460 CTCCATGAGGGGCAGGAACCAGG - Intergenic
916579561 1:166095405-166095427 CAGCCAGTGGGCCAGGAACCAGG + Intronic
917515609 1:175705148-175705170 AAGAATGGGAGGCAGGAACCAGG - Intronic
918204669 1:182298194-182298216 GAGGATGTGGGGCAGGAGGCTGG - Intergenic
918446748 1:184624388-184624410 TAGCATCTGGAAAAGGAACCTGG + Exonic
921172346 1:212560695-212560717 CAGCATGAGGGGCAGGAGCTGGG - Intergenic
921651840 1:217689079-217689101 TACCATGTGGGTCAGGTACTAGG + Intronic
924281218 1:242439229-242439251 TTGCATGTGGGGAAGGAGCCGGG + Intronic
1065793920 10:29289194-29289216 CAGCCTCTGGGGCAGGCACCAGG + Exonic
1069735789 10:70653287-70653309 GAGCTTGTGGGGTGGGAACCAGG - Intergenic
1069774396 10:70918401-70918423 TAGCATCAGGGGCAGATACCAGG - Intergenic
1070700013 10:78595145-78595167 AAGCCTGTGGGGGAGGCACCAGG - Intergenic
1072577523 10:96713799-96713821 TAGCTGGTGAGGCAGGATCCAGG - Intronic
1073228240 10:101943164-101943186 GAGGATGTGGGGCAGAAAGCTGG + Intronic
1073469446 10:103713802-103713824 CAGCAGGTGGGGGAGGAGCCAGG + Intronic
1073651806 10:105368606-105368628 TGTCATGTAGGGCAGAAACCTGG - Intergenic
1074366229 10:112859640-112859662 TGGGAGGTGGGGCTGGAACCGGG + Intergenic
1075088305 10:119428752-119428774 GAGCCTGTAGGGCAGGACCCTGG + Intronic
1075094544 10:119462219-119462241 TGGCACGGGGAGCAGGAACCTGG - Intergenic
1075897484 10:126009729-126009751 CAGCTTGCGGGGCAGGAGCCGGG - Intergenic
1076456669 10:130604777-130604799 TATCCTGTGGGGCAGGCACGGGG + Intergenic
1076495670 10:130896061-130896083 TGGCTTGAGGGGCAGGAATCCGG - Intergenic
1077253318 11:1570245-1570267 TAGCATGTGGCACAGTGACCAGG - Intronic
1077297660 11:1833667-1833689 ATGCGTGTGGGGCTGGAACCTGG + Intronic
1077407612 11:2389624-2389646 CAGCAGCTGGGGCAGGAAGCAGG - Intronic
1077998618 11:7475249-7475271 TCACATTTGGGGCAGGAAACTGG + Intergenic
1081661317 11:44889996-44890018 GAGCCTGTGGGGCAGGACCGTGG - Intronic
1083738667 11:64695994-64696016 TAGGGGGTGGGGCAGGAACGGGG - Intronic
1084544932 11:69810476-69810498 CAGCACGCGGGGCAGGAACAGGG + Exonic
1085345157 11:75763903-75763925 CAGCATGTGGGGAAGCCACCAGG + Intronic
1088098849 11:106131855-106131877 AAGCATTTGGGTCATGAACCAGG - Intergenic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1091308202 11:134554298-134554320 CAGCCTGTGGGCCAGGTACCGGG - Intergenic
1097692143 12:62743374-62743396 TAATATTTGGGGCAGGGACCAGG - Intronic
1098951054 12:76640823-76640845 TAGCAGGTCGGACAGCAACCAGG - Intergenic
1101858767 12:108465481-108465503 CGGGAGGTGGGGCAGGAACCAGG + Intergenic
1105272920 13:18894626-18894648 CAGGATGTGGGGCAGTAGCCTGG + Intergenic
1105775145 13:23653080-23653102 TAGCACAGGGGGCAGGAAGCTGG - Intronic
1106614056 13:31310361-31310383 TTGGATGTGGGACAAGAACCTGG + Intronic
1106721071 13:32435111-32435133 TAGCATGTTGGGCAAGGACTTGG - Intronic
1110548166 13:76780168-76780190 TAGGTTTTGTGGCAGGAACCTGG - Intergenic
1111408391 13:87841242-87841264 TTGGATGTGGGACAAGAACCTGG - Intergenic
1112182281 13:97095368-97095390 CAGGATGAGGGGCAGGAAACGGG + Intergenic
1114969255 14:28005358-28005380 TACCCTATGGGGCTGGAACCAGG + Intergenic
1115470716 14:33765897-33765919 GAACTTTTGGGGCAGGAACCTGG + Intronic
1119690345 14:76666748-76666770 TAGCATGTGGGGCTGTGAGCAGG + Intergenic
1122372562 14:101236757-101236779 TGGCATGTGTGCCAGGACCCTGG - Intergenic
1123661947 15:22572241-22572263 GAGCATGTGAGGAAGGAATCAGG - Intergenic
1124262270 15:28203304-28203326 GAGCATGTGAGGAAGGAATCAGG + Intronic
1124315744 15:28666484-28666506 GAGCATGTGAGGAAGGAATCAGG - Intergenic
1124922413 15:34039235-34039257 CCGCAGGTGGGGCCGGAACCGGG + Intronic
1125610192 15:40964357-40964379 GAGCTGGTGGGGCAGAAACCTGG + Intergenic
1127257940 15:57307185-57307207 TAGTAGGTGGGGCAGGGAGCAGG - Intergenic
1127563628 15:60165253-60165275 TAGCATGTGGGCCAGGACCCCGG - Intergenic
1127865113 15:63026309-63026331 TGGCCTGAGGGGCAGGATCCTGG + Intergenic
1127899242 15:63329092-63329114 TAGGAAGTGAGGCAGGTACCAGG - Intronic
1128933050 15:71722786-71722808 TAACATTTGGGACAGGAACTGGG - Intronic
1129732684 15:77941000-77941022 TAGCATGGAGGGCAGGAGGCTGG - Intergenic
1132726880 16:1342750-1342772 CAGCAGGTGGGACAGGAAGCCGG - Exonic
1132788153 16:1669683-1669705 TAGCAAGTGTGGCAGGAAGGGGG + Intronic
1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG + Intronic
1133954012 16:10423939-10423961 TAGAGTGTGGAGCAGGAATCGGG + Intronic
1134039600 16:11058216-11058238 TAGGAGTTGGGGCAGGAACCAGG + Intronic
1135249574 16:20889696-20889718 TAGGATCTCTGGCAGGAACCAGG - Intronic
1138419994 16:56892824-56892846 TGGCAGGTGGAACAGGAACCGGG - Intronic
1138572505 16:57884707-57884729 TAGGCTGTGGGGCTGGAAGCTGG + Intronic
1141678904 16:85532583-85532605 TGGCATGTAGGGCAGTAATCAGG - Intergenic
1141908245 16:87041614-87041636 CAGGATGTGGAGGAGGAACCAGG - Intergenic
1144667479 17:17111884-17111906 TAGCATGTGGGGAAGGGCCTCGG - Intronic
1147034118 17:37667349-37667371 AAGTCTGTGGGGAAGGAACCAGG + Intergenic
1147185972 17:38713237-38713259 TGGCATGGGGGGCAGGCCCCTGG + Intronic
1147793835 17:43028899-43028921 TGGCATCTGGGGCATGAACTGGG + Exonic
1147873466 17:43604091-43604113 TGGCATCTTGGGCAGGAATCAGG + Intergenic
1148855485 17:50576839-50576861 TAGCCAGTGGGGCATGAAGCTGG - Intronic
1149325708 17:55527864-55527886 TAGCAGGGGTGGCAGAAACCAGG + Intergenic
1151206289 17:72510183-72510205 TAGCATGCTGGGCAGGTTCCTGG - Intergenic
1151499972 17:74482265-74482287 TAGCAGGTGGGTCACGACCCAGG - Intronic
1152600813 17:81261239-81261261 TAGCAGGGGTGGCAGGAGCCGGG - Intronic
1157809660 18:50685540-50685562 GTGCATGTGGGGGAGGCACCGGG + Intronic
1158478171 18:57798728-57798750 TAGCAGGTGAGACAGCAACCAGG + Intronic
1159467587 18:68804545-68804567 CAGAATGTGGGGCAGCTACCAGG + Intronic
1159784594 18:72697822-72697844 TACCAGGTGGGGGAGGATCCAGG + Intergenic
1164650549 19:29887971-29887993 TTGTCTGTGGGGCAGGAGCCAGG - Intergenic
1167254393 19:48418605-48418627 TAGCATCAGGGGCAGGAGCGTGG + Intronic
1168510836 19:56972403-56972425 TAGCATGTGGGTCATTAATCAGG + Intergenic
925014887 2:515254-515276 CTGCATGTGGAGCAGAAACCAGG + Intergenic
925299236 2:2798569-2798591 TACCATGGGGGGCAGGCTCCTGG + Intergenic
926297144 2:11577251-11577273 CAGCATCTGGGGTAGGGACCAGG + Intronic
927306578 2:21580559-21580581 TAGCTGGTGGGGCTGGAGCCAGG - Intergenic
929483889 2:42338146-42338168 TTGCATGTGGGCCAGGAGCATGG - Intronic
929901315 2:46006003-46006025 GAGCATGCAGGGCAGGAGCCAGG - Intronic
930275753 2:49309331-49309353 TTGCATGAGGGGCAGCAACCAGG + Intergenic
931186740 2:59959863-59959885 TAGAAAGTGTGGCAGGAACTGGG - Intergenic
932115431 2:69042527-69042549 TAGACTGTGGGGAAGGAGCCAGG - Intronic
932233558 2:70102711-70102733 CAGCAGGTGGGGCAGGAGGCCGG - Intergenic
932432864 2:71686017-71686039 TGCCATGTGGGGGAGGACCCTGG + Intronic
933327381 2:80855370-80855392 AAGCACATGGGGCAGGATCCAGG - Intergenic
935330349 2:101973110-101973132 TAGCATGATGGGCAGGCACTGGG + Intergenic
938089767 2:128423867-128423889 TTCCATGTGGGGCAGGGACTTGG + Intergenic
939873741 2:147553513-147553535 TTGCATATGGGGCAGGAGCAGGG + Intergenic
941806718 2:169717243-169717265 GTGGATGTGGGGCAGGAAACTGG + Intronic
943360993 2:186919222-186919244 TAAGATGTGAGGCAGGTACCTGG + Intergenic
943720430 2:191198520-191198542 TAGCACGTGAGGCAGGGACTGGG - Intergenic
946525037 2:220509168-220509190 TAGCATTTGGGGTAATAACCTGG + Intergenic
1168816077 20:737972-737994 CAGCATGTAGGGCAGGGTCCAGG + Intergenic
1171492029 20:25526709-25526731 TGGCATGTGGGGAAGGCACCAGG + Intronic
1172837716 20:37883609-37883631 TAGCATCACGGGCAGGAAGCTGG + Intergenic
1174155392 20:48512503-48512525 TAGTTTGTGGGTCAGGAATCTGG - Intergenic
1174541662 20:51294558-51294580 TTGCAGGTGGAGCAGGAGCCTGG + Intergenic
1175158678 20:56991943-56991965 TAGCATGGTGGGAAGGAAGCAGG - Intergenic
1175553917 20:59834286-59834308 CAGCATGGGGGCCAGGAATCTGG + Intronic
1176218431 20:63958951-63958973 AGGCATGTGGGGCAGGAAGCTGG - Exonic
1176222237 20:63975216-63975238 CAGCATGTGGGGCAGCTGCCTGG - Exonic
1176241678 20:64078481-64078503 TAGAGTGTGGGGGAGGACCCTGG - Intronic
1176809842 21:13526179-13526201 CAGGATGTGGGGCAGTAGCCCGG - Intergenic
1177484602 21:21740895-21740917 TAGAATGTGGGGAAAGAAACAGG - Intergenic
1179656670 21:42850267-42850289 TGCCAGGTGGGGCAGGAACATGG + Intronic
1181030847 22:20148310-20148332 TAGGATGTGGGGTGGGAAGCCGG + Intergenic
1183007754 22:34917361-34917383 AAGAATGTGGAGGAGGAACCAGG + Intergenic
1185086222 22:48742421-48742443 GAGCAGGTGGGGCAGGAGACGGG + Intronic
1185281655 22:49972341-49972363 CTGCCTGAGGGGCAGGAACCTGG - Intergenic
953060772 3:39427234-39427256 TAGCCTGTGGGGTAAGAACTTGG + Intergenic
955505245 3:59626238-59626260 GAGGTTGTGGAGCAGGAACCTGG + Intergenic
955981491 3:64531909-64531931 GAGAACGTGGGGCAGAAACCCGG - Intronic
956711721 3:72044152-72044174 TAGGATGTGGCGCAGCATCCTGG + Intergenic
957632901 3:82740886-82740908 TAGCATCTTGGCCAGGAACCAGG + Intergenic
958908427 3:99966942-99966964 TAGCATGTGGGGCAGTACAGAGG - Intronic
960254882 3:115501380-115501402 TACCATGTGGGGCAGGGGACAGG + Intergenic
962708422 3:138066790-138066812 TAGTATGTGGGGAAGAAACTGGG - Intronic
965322678 3:167267913-167267935 AAGGATCTGGGGCAGGATCCAGG - Intronic
968449384 4:668020-668042 TGGCCTGTGGGGCAGGGACTCGG + Intronic
968870249 4:3238485-3238507 TAGAAACTGGGGCAGGATCCTGG - Exonic
969664581 4:8549752-8549774 CAGCAGGTGGGGCAGGGACAAGG - Intergenic
971145903 4:23976173-23976195 TATAATGTGGGGCAGGAAAGAGG + Intergenic
977010791 4:91629752-91629774 TAGCATGTGGGGCATGCTACGGG + Intergenic
978871699 4:113586126-113586148 TAGCTTGTGGAGCTGGAAACAGG - Intronic
981017553 4:139989606-139989628 TTGCATGTGGGATAGGAAGCAGG - Intronic
982481504 4:155917495-155917517 CAGCATGTGGGGAAGCAACATGG - Intronic
985730809 5:1547478-1547500 TAGGGTGTGGGGCAGGCACCAGG + Intergenic
988784965 5:34558170-34558192 TCTCAGGTGGAGCAGGAACCTGG - Intergenic
994041380 5:95263459-95263481 TAGAATTTGTGGCAGCAACCTGG - Intronic
994114678 5:96048955-96048977 CAGCGTGTGGGGCTGGAGCCAGG + Intergenic
995182170 5:109239423-109239445 AAGCATGAGGGCCAGGAGCCTGG + Intergenic
995717540 5:115094672-115094694 TAGAATGTAAGGCAGGCACCAGG - Intergenic
995879548 5:116828778-116828800 TAGGATGTGGGGAATGAGCCTGG + Intergenic
998373035 5:141673192-141673214 TAAAATCTGGGGCAGGACCCAGG - Intronic
998785406 5:145703468-145703490 TAGCATGTGTGGCTTGAAACTGG - Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1002539276 5:179895301-179895323 TTGCATGTCTGGAAGGAACCAGG - Intronic
1003218894 6:4139076-4139098 TAACATGTGGGGCTGGAAAGAGG - Intergenic
1003474577 6:6469675-6469697 CAGTATGAGGGGCATGAACCAGG - Intergenic
1007720865 6:43884806-43884828 CAGCAGCTGGGGCAGGCACCAGG - Intergenic
1008417495 6:51259967-51259989 TATGATGTGGAGCAGGAAACTGG - Intergenic
1012409042 6:98935341-98935363 TAGCATGTTGGGCAGGAAGAGGG - Intronic
1018910545 6:168098797-168098819 GAGCATGTGGGCGAGGCACCAGG - Intergenic
1021576485 7:22110009-22110031 TGGGGTGTGGGGCAGGAACAGGG + Intergenic
1024719274 7:52116877-52116899 TCCCCTGTGAGGCAGGAACCAGG - Intergenic
1026873114 7:73865220-73865242 TGGCATGTGGGGCAGCACCAAGG + Exonic
1027054951 7:75043416-75043438 GGGCATGTCGGGCAGGAACATGG + Intronic
1027847020 7:83392993-83393015 TAGGATGTGGAGGTGGAACCTGG + Intronic
1031986910 7:128169158-128169180 TAGCCTTTGGGGAAGGAATCTGG - Intergenic
1033637418 7:143225220-143225242 TAGCATGTGGAGCAGGTAAGGGG + Intergenic
1034198504 7:149266071-149266093 TAGCCTGTAGGACAGGAGCCGGG + Intronic
1034254920 7:149719690-149719712 CAGCACGTGTGGCAGGAGCCTGG + Intronic
1034833307 7:154328722-154328744 TGGTATTAGGGGCAGGAACCAGG + Intronic
1040358013 8:46638405-46638427 AAACATGTTGGGCAGAAACCAGG - Intergenic
1041020198 8:53631336-53631358 TAGAAGGTGGGGCAGGGAGCTGG - Intergenic
1041728031 8:61036383-61036405 CTGCAGGTGGGGCAGCAACCTGG + Intergenic
1047526609 8:125639086-125639108 GAGCAGGTGGGCCAGGACCCTGG + Intergenic
1047542850 8:125787175-125787197 AAGCATGTGGGGAAGAAACATGG + Intergenic
1049454991 8:142682223-142682245 TAGGATGTGCCTCAGGAACCAGG - Exonic
1051746455 9:20299295-20299317 TAGCATGTGGGAAAGGAGCTTGG + Intergenic
1057151086 9:92796625-92796647 TTCCCTGTGGGGCTGGAACCTGG - Intergenic
1057263155 9:93597514-93597536 CAGGCTGTGGGGCAGGAAGCGGG + Intronic
1057478682 9:95426920-95426942 CAGGAAGCGGGGCAGGAACCAGG - Intergenic
1058402474 9:104634487-104634509 TTGATTGTGGGACAGGAACCCGG - Intergenic
1060518934 9:124282977-124282999 CAGCCTGTGGGGCAGGAAGGAGG + Intronic
1061676356 9:132218164-132218186 TGGCCTGTGTGGCAGGAGCCGGG - Intronic
1062607904 9:137356232-137356254 TGGCCTGTGGGGCAGGAATGTGG + Intronic
1186511730 X:10134857-10134879 TGACCTGTGGGGCAGGAAGCAGG + Intronic
1187960567 X:24563259-24563281 TAGCAAGTGGGGCTGGGAGCAGG + Intronic
1190110795 X:47587761-47587783 GAGTATGAGGGGCAGGAGCCAGG - Intronic
1194007451 X:88513617-88513639 TAGCATGTGGGGCAATATCCAGG - Intergenic
1195666068 X:107432529-107432551 TAGAATGTAGCCCAGGAACCAGG + Intergenic
1200218868 X:154380843-154380865 GAGCAAGTGGGCCAGGAGCCTGG - Intronic