ID: 1133117097

View in Genome Browser
Species Human (GRCh38)
Location 16:3583510-3583532
Sequence GATCCACCTGTTCCTCCGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133117097_1133117099 0 Left 1133117097 16:3583510-3583532 CCTGACGGAGGAACAGGTGGATC 0: 1
1: 0
2: 1
3: 3
4: 68
Right 1133117099 16:3583533-3583555 TCAGGACCCACCCACACAGCTGG 0: 1
1: 1
2: 2
3: 30
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133117097 Original CRISPR GATCCACCTGTTCCTCCGTC AGG (reversed) Exonic
900931709 1:5742099-5742121 GCTCAGCTTGTTCCTCCGTCAGG - Intergenic
901290643 1:8121624-8121646 GATCCGCCTGTTCCTCAGCGTGG - Intergenic
902390172 1:16099100-16099122 CCTCCACCTGTTCATCTGTCTGG + Intergenic
907458665 1:54592484-54592506 GAGGCCCCTGTTCCTCCCTCTGG + Intronic
916908578 1:169318142-169318164 GATCCAACTTTTCCTCAGGCAGG + Intronic
920444078 1:206002466-206002488 CATCCATCTGTTCATCTGTCTGG + Intronic
921925516 1:220707316-220707338 CATCCTGCTGTTCCTCAGTCAGG - Intergenic
1080012227 11:27471589-27471611 GAAACACCTGTACCTCAGTCAGG - Intronic
1083430389 11:62611262-62611284 GCTCCACCTCTGTCTCCGTCTGG + Exonic
1088920520 11:114257272-114257294 GCTGCACCTGTTCCTCCTCCTGG - Intergenic
1089897432 11:121945408-121945430 GATCCACCAGTTGCTCTTTCTGG + Intergenic
1090085100 11:123643701-123643723 GATCCACCTTTTCCTCACTTTGG + Intronic
1103320103 12:120087453-120087475 GATCCACCTGTTCCTTTTTCTGG + Intronic
1104586210 12:130049915-130049937 GATCAACTTGTACCTCCCTCAGG - Intergenic
1105840521 13:24249809-24249831 GATTGTCCAGTTCCTCCGTCTGG - Exonic
1111132632 13:83996757-83996779 TATGCAACTGTTCCTCCATCTGG - Intergenic
1115336387 14:32247421-32247443 GAACCACATGTTTCTCTGTCTGG - Intergenic
1118300415 14:64610455-64610477 TATGCACCTGTTCTTCCCTCTGG - Intergenic
1125278952 15:38024489-38024511 GATTCACCTGATCCTCCACCAGG - Intergenic
1126004882 15:44246488-44246510 CATCCTCCTGTTCATCAGTCAGG - Intergenic
1126141725 15:45444837-45444859 GATCCAACTGTTCTTCCTTTAGG - Intronic
1130901051 15:88207006-88207028 GAACCTTCTGTTCCTCCTTCAGG + Intronic
1133117097 16:3583510-3583532 GATCCACCTGTTCCTCCGTCAGG - Exonic
1135688974 16:24521142-24521164 GTTCCACCTGTTGCTCAGGCTGG - Intergenic
1141077140 16:81016957-81016979 GAGCCAGCTGTTCCTCTGCCTGG - Intronic
1141810093 16:86370243-86370265 TATCCACCTATTCCTCTGCCTGG - Intergenic
1142358571 16:89615623-89615645 GAACCAGCTGCTCCTCCCTCAGG - Intronic
1149628015 17:58093714-58093736 GAGCCACCTCTTCCTCCTTAAGG + Exonic
1159040273 18:63318369-63318391 GGTCCACCTGACCCTCCGCCAGG - Exonic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1165153582 19:33774529-33774551 GATCCAGCAGTTCCTCCACCTGG - Intergenic
1165153587 19:33774553-33774575 GATCCAGCAGTTCCTCTATCTGG - Intergenic
1165153597 19:33774601-33774623 GATCCAGCATTTCCTCCATCTGG - Intergenic
1168468900 19:56625292-56625314 CACCCACCAGTTCCTCAGTCAGG + Exonic
926880303 2:17538158-17538180 GAGCCCGCTGTTCCTCCTTCAGG - Intergenic
927146743 2:20171142-20171164 GATGCACCTGTTCCTCCTTCGGG - Intergenic
930162750 2:48175082-48175104 GAGCAACCTCTTCCTCCTTCTGG + Intergenic
935210244 2:100933548-100933570 GATGCTCATGTTCCTCCCTCTGG + Intronic
940374463 2:152942002-152942024 GATTCACCTTATCCTCTGTCAGG + Intergenic
942704207 2:178750119-178750141 AACCCACCAGTTCCTCCCTCTGG - Intronic
946285039 2:218696592-218696614 GATCCATCTGTACCTCAGTGAGG - Exonic
1171411938 20:24953388-24953410 GATGATCCTGTTCCTCCGTGGGG + Intronic
1178334795 21:31733050-31733072 GCTCCAGCTGGTCCTCCTTCGGG - Intergenic
1178375965 21:32067716-32067738 GAGACACCTGTTCCTGCGGCAGG + Intergenic
1179284290 21:39963313-39963335 GATCCCTGTGTTCCTCCATCAGG + Intergenic
1184322528 22:43753396-43753418 GATCCACCTGGTCCTGGCTCTGG - Intronic
1184859111 22:47163181-47163203 GGTCCTCCTGTCCCTCTGTCTGG - Intronic
951243536 3:20314410-20314432 GATCCCATTGTTCCTCCGTTTGG + Intergenic
953167029 3:40474634-40474656 CATCCCCCTGTTCCTCCTCCAGG - Intergenic
953798272 3:46001959-46001981 GAACCACATGTTTCTCTGTCTGG + Intergenic
959870525 3:111322122-111322144 GAACCACCTGCTCCTCCCGCAGG - Intronic
960940258 3:122928736-122928758 GATCCACCTGTCCCGACGTCCGG + Intronic
962376488 3:134862803-134862825 GACCCTCCTGTTCCTCCTCCTGG + Intronic
964543059 3:157801125-157801147 AATTCAGCTGTTACTCCGTCTGG + Intergenic
976966860 4:91053935-91053957 GATCCACATGTCCCTCCATAGGG - Intronic
982454455 4:155592039-155592061 GATCCAGCCTTTCCTCCGCCTGG - Intergenic
992484361 5:77180787-77180809 GCTGGACCTGTTTCTCCGTCGGG + Intergenic
994561801 5:101383197-101383219 CAACCACCTGTTCCTCCTTGAGG - Intergenic
998153962 5:139773832-139773854 GATCCACCAATTCCCCCATCTGG - Intergenic
998863652 5:146472543-146472565 GATCTAACTGTTCCACCGACCGG + Intronic
1002271638 5:178076200-178076222 GATCCTCCTCTTCCCCCGTCAGG - Intergenic
1005868582 6:29956750-29956772 GCTCTGCCTGTTCCTCCGCCAGG - Intergenic
1016996696 6:149966055-149966077 GACCCGCCTGTTCTTCCGACTGG + Intronic
1020941777 7:14548483-14548505 CATCCACCTTTTCCTCATTCAGG - Intronic
1023346782 7:39278857-39278879 CATCCACATGTTCCTCAGGCTGG + Intronic
1029017451 7:97329068-97329090 TATCTTCCTGTTCCTCTGTCTGG + Intergenic
1029592604 7:101517249-101517271 CCTTCACCTGTTCCTCCGTTGGG + Intronic
1035167852 7:157002414-157002436 GAGCCCCCTGGGCCTCCGTCTGG + Intronic
1045296387 8:100874948-100874970 GATCCATCAGTTTCTCCATCTGG - Intergenic
1047747240 8:127854172-127854194 GATCTACCTGTCCCTGCGCCAGG - Intergenic
1060911120 9:127351896-127351918 AATCCACCTGTCACTCTGTCAGG + Intronic
1061088685 9:128414033-128414055 GCTCTACCTGTTCCTGCATCTGG + Intronic
1062420415 9:136478207-136478229 GATCCCCCTGTTGCTCAGGCTGG - Intronic