ID: 1133117913

View in Genome Browser
Species Human (GRCh38)
Location 16:3588840-3588862
Sequence CAGACTCCCCTCCACAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133117913_1133117922 24 Left 1133117913 16:3588840-3588862 CCTCCACTGTGGAGGGGAGTCTG 0: 1
1: 0
2: 1
3: 30
4: 260
Right 1133117922 16:3588887-3588909 CAGGTCAGCAGGCATTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 183
1133117913_1133117918 5 Left 1133117913 16:3588840-3588862 CCTCCACTGTGGAGGGGAGTCTG 0: 1
1: 0
2: 1
3: 30
4: 260
Right 1133117918 16:3588868-3588890 CAGCGGAAGTGTCATGCCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 84
1133117913_1133117921 23 Left 1133117913 16:3588840-3588862 CCTCCACTGTGGAGGGGAGTCTG 0: 1
1: 0
2: 1
3: 30
4: 260
Right 1133117921 16:3588886-3588908 TCAGGTCAGCAGGCATTCAGAGG 0: 1
1: 0
2: 1
3: 9
4: 179
1133117913_1133117919 13 Left 1133117913 16:3588840-3588862 CCTCCACTGTGGAGGGGAGTCTG 0: 1
1: 0
2: 1
3: 30
4: 260
Right 1133117919 16:3588876-3588898 GTGTCATGCCTCAGGTCAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133117913 Original CRISPR CAGACTCCCCTCCACAGTGG AGG (reversed) Intronic
900330269 1:2130704-2130726 CAGACTGCCCACCACAATGCAGG - Intronic
900548721 1:3243003-3243025 CAGGCTGCACTCCAGAGTGGCGG - Intronic
901265283 1:7905560-7905582 CAGATGGCCCTCCACAGTGCAGG + Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902262212 1:15235056-15235078 CAAACTGCTTTCCACAGTGGTGG - Intergenic
902311782 1:15586656-15586678 GAGGCTCCACTCCAGAGTGGAGG - Intronic
903002996 1:20279662-20279684 CAGACTCCTCACCACAGTCTTGG - Intergenic
905455256 1:38084050-38084072 CAGTCTGCCTTCCACAGTGGGGG - Intergenic
905724080 1:40233648-40233670 CAGACTTCCCACAACAGTAGTGG - Intronic
905880034 1:41457384-41457406 CATGCTCCCCTCCCCAGTGAAGG - Intergenic
906581991 1:46943059-46943081 CAAACTGCTTTCCACAGTGGCGG + Intergenic
906601718 1:47135837-47135859 CAAACTGCTTTCCACAGTGGCGG - Intergenic
907494964 1:54837582-54837604 CAGACTCTCCTGCCCAGTGGTGG + Intronic
908064985 1:60393024-60393046 CTCACTCCCCTCCACAATCGAGG + Intergenic
908098208 1:60762846-60762868 CAGACACCCCACCAGAGTGAAGG - Intergenic
909161252 1:72152545-72152567 CAGATTGCTTTCCACAGTGGTGG - Intronic
910366054 1:86466617-86466639 CAGAATCTCCTTCAAAGTGGTGG - Intergenic
912495391 1:110088411-110088433 CAGACTCCTCTCCCCAGTTAAGG - Intergenic
913027321 1:114856829-114856851 CAGCCTCCCTCCCACAGTGCTGG - Intronic
914291266 1:146275797-146275819 CTGACTCTCCTCCACAGAGTGGG - Intergenic
914552310 1:148726580-148726602 CTGACTCTCCTCCACAGAGTGGG - Intergenic
915447126 1:155980108-155980130 CAGACTCACCTCCCCTGAGGTGG + Intronic
917520015 1:175740576-175740598 CAGTCTCCCCTACACAGTGAAGG + Intronic
919187676 1:194174746-194174768 CAGACTTCCATACACAGAGGAGG - Intergenic
919350921 1:196452878-196452900 CAGACTGCCCTCCATAATGTGGG - Intronic
919739198 1:200972315-200972337 GAGACTCCCCGGCCCAGTGGGGG + Intronic
921456357 1:215376656-215376678 CAGACTGCCCTTCACTTTGGTGG - Intergenic
923095253 1:230770380-230770402 CAGATTGCCCTCCCCAGTGTAGG - Intronic
923388470 1:233489645-233489667 CTGAGTCCCCTTCAGAGTGGAGG - Intergenic
1064370988 10:14751404-14751426 CAGACTCCCCTTCTCAGTGGTGG - Intronic
1064563875 10:16620443-16620465 CTAACTCACCTCTACAGTGGGGG + Intronic
1065090139 10:22223819-22223841 CAGATTGCCCTCCCCAGTGTGGG + Intergenic
1065474337 10:26117946-26117968 CAGACTCCCACCAACAGTGTAGG + Intronic
1066101336 10:32121350-32121372 CAAATTCCTCTCCACAGTGCTGG - Intergenic
1066187664 10:33026009-33026031 GATACTGCTCTCCACAGTGGTGG + Intergenic
1066479161 10:35778852-35778874 CACACAACCCTCCACACTGGGGG - Intergenic
1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG + Intergenic
1067713779 10:48671594-48671616 AAGGCTCCTCTCCACCGTGGAGG + Intergenic
1068522399 10:58092451-58092473 CAGATTACCCTCTACAGTGTGGG - Intergenic
1070304719 10:75233534-75233556 CAGCCTCACCTCTCCAGTGGAGG - Intergenic
1071834266 10:89404268-89404290 CAGACTCCCCTCCCCTCTTGCGG + Intronic
1075270741 10:121047945-121047967 CAGACTGCCCTCCCCAGAGCTGG - Intergenic
1075646565 10:124100683-124100705 CAGACTGCCCTCCCCAGGGAGGG - Intergenic
1076731423 10:132440884-132440906 CAGAGTCTGCACCACAGTGGTGG - Intergenic
1078397100 11:10990914-10990936 CAGATTGCCCTCCCCAGTGTGGG + Intergenic
1080180128 11:29415887-29415909 CACACTCTCTTCCACAATGGAGG + Intergenic
1083036152 11:59639435-59639457 CAGGATCCCTTCAACAGTGGTGG - Intronic
1083565871 11:63715701-63715723 CTGACTCCACCCCACAGGGGAGG - Intronic
1087735588 11:101828961-101828983 CAGACTGCCCTCCGCAATGTGGG - Intronic
1088361049 11:108990407-108990429 CAGGCTGCCCTCCACAGTGTGGG + Intergenic
1089063748 11:115646384-115646406 CAGACACCCCTGCACAGTCAAGG - Intergenic
1089860473 11:121586111-121586133 CAAATTGCCCTCCCCAGTGGTGG + Intronic
1090199681 11:124845426-124845448 CATCCCCCCCTCCACTGTGGGGG + Intergenic
1090409832 11:126500351-126500373 CAGGCTGCCCTACATAGTGGTGG - Intronic
1090927961 11:131268342-131268364 CACACTGCCTTCCACAATGGTGG + Intergenic
1091248368 11:134119707-134119729 CAGACTGCCCTCCATAATGAGGG - Intronic
1092282402 12:7108256-7108278 CAGAGTCCCCTGCACAGTCCTGG + Exonic
1092367749 12:7891017-7891039 CTGACTCTTCTCCAGAGTGGAGG + Exonic
1092852494 12:12643134-12643156 AATGCTTCCCTCCACAGTGGAGG - Exonic
1093805188 12:23423346-23423368 CAAATTTCCCACCACAGTGGTGG + Intergenic
1093940400 12:25048037-25048059 CACACTGCCTTCCACAATGGAGG + Intronic
1095341778 12:41098105-41098127 CACACTGTCCTCCACAATGGAGG - Intergenic
1095698546 12:45167012-45167034 CAGACCCCACTCCAGACTGGGGG + Intergenic
1095960908 12:47833680-47833702 CAGCCTCCCCTCAACACTGTGGG + Intergenic
1099040682 12:77650307-77650329 CACCCTCTCCTCCACAGTAGAGG - Intergenic
1099394359 12:82119945-82119967 CAAACTGCTTTCCACAGTGGCGG + Intergenic
1101492667 12:105223588-105223610 CAGCCTCCCATGCAAAGTGGAGG + Intronic
1102814591 12:115854367-115854389 CAAACTGCTTTCCACAGTGGCGG - Intergenic
1105404059 13:20119035-20119057 CAGCCTCCCTTCCACAGGGGCGG - Intergenic
1105419536 13:20240092-20240114 CAGATGCCCCTCCACCTTGGGGG - Intergenic
1107172862 13:37363547-37363569 CAGACTCACATCCACAGAGAAGG + Intergenic
1108194498 13:47979083-47979105 CACACTGTCCTCCACAATGGTGG - Intronic
1109112287 13:58336647-58336669 CAAACTCTTCTCCATAGTGGTGG + Intergenic
1113684747 13:112275210-112275232 CAGACTGCCCTCCCTAATGGGGG + Intergenic
1113911312 13:113842721-113842743 CAGACATCCCTCCATGGTGGGGG - Intronic
1115284270 14:31700768-31700790 CAGCCGCCCCTCCACAGGGCAGG + Intronic
1117837056 14:59818738-59818760 CACACTCCTTTCCACAGTGGTGG + Intronic
1119324287 14:73750462-73750484 CAGTTTCCCCTCCAGACTGGGGG + Intronic
1123931050 15:25171814-25171836 CGGACTCACCTCCAGGGTGGTGG + Intergenic
1124099484 15:26680090-26680112 CAGATTCCCCTCCACGATGAAGG + Intronic
1124356602 15:29000060-29000082 CAGACGGCCCTCCTCAGTGTAGG - Intronic
1127917454 15:63466950-63466972 CAGCCTACCCTCCACAAAGGTGG + Intergenic
1128435743 15:67645804-67645826 CAGCCTCCCTTCCAGAGTGCTGG + Intronic
1128613285 15:69090477-69090499 GACACTCCCCTCCCCAGTGTGGG - Intergenic
1128816697 15:70615146-70615168 CAGATTGCCCTCCATAGTGTTGG - Intergenic
1129066484 15:72908707-72908729 GAGACTCCCCTCCAGGGTGCCGG + Intergenic
1131662443 15:94532351-94532373 CAGACTGCCCTCTCCAGTGTGGG + Intergenic
1132138645 15:99369617-99369639 CAGATTACCCTCCATAGTGTGGG - Intronic
1133117910 16:3588832-3588854 CCGGCTCTCCTCCACTGTGGAGG + Intronic
1133117913 16:3588840-3588862 CAGACTCCCCTCCACAGTGGAGG - Intronic
1136597761 16:31263424-31263446 CAGATCCCCCTCTACAGTGGTGG + Intronic
1137637667 16:50001211-50001233 CAGACTGCCCTCCACCATGTGGG + Intergenic
1138584277 16:57960301-57960323 CAGAATCCCCTCCCCAGTCCAGG - Intronic
1138824346 16:60300902-60300924 CAGACTGCCCTCCATTGTGTGGG + Intergenic
1140843297 16:78862789-78862811 CAGACTGCCCTTCCCAGTGTGGG - Intronic
1140890437 16:79280291-79280313 CAGACTCACCTCAACATTTGTGG + Intergenic
1141509604 16:84504222-84504244 CAGACTCGCCTCCTCCGTGGAGG + Intronic
1142570830 17:872957-872979 CAGACTGCTCTCCCCAGTGTGGG + Intronic
1143150085 17:4802311-4802333 CAGACCCATCTCAACAGTGGAGG + Intergenic
1144945144 17:18965927-18965949 TCCACTCCACTCCACAGTGGGGG - Intronic
1146709254 17:35026667-35026689 CATCCTCCCCTCCACCTTGGTGG - Intronic
1152887251 17:82859722-82859744 AAGATTCCAGTCCACAGTGGGGG + Intronic
1152912821 17:83015064-83015086 GACGGTCCCCTCCACAGTGGTGG - Intronic
1152912842 17:83015141-83015163 GACGGTCCCCTCCACAGTGGTGG - Intronic
1152912863 17:83015218-83015240 GACGGTCCCCTCCACAGTGGTGG - Intronic
1152912873 17:83015256-83015278 GACGGTCCCCTCCACAGTGGTGG - Intronic
1153747324 18:8193278-8193300 CATCCTCCCCTCCACAGTAAAGG - Intronic
1154028022 18:10725716-10725738 CCGACTTCTCTCCACAGTGGCGG + Intronic
1154134315 18:11762306-11762328 CCGCTTCCCCTCCACAGTGCTGG - Intronic
1155450633 18:25959350-25959372 GAGACTCCACTCCTCAATGGGGG + Intergenic
1156957909 18:42991323-42991345 CACACTCCCATACACAGTGGTGG + Intronic
1157281982 18:46352164-46352186 CAGGCTCCCCTCCTCCTTGGGGG + Intronic
1158503875 18:58028735-58028757 CAGACCCCCAGCCACAGTGATGG - Intergenic
1158544093 18:58381235-58381257 TAGACTCCCACCCACAGTGAAGG + Intronic
1158607821 18:58911477-58911499 CAGCCTCCCCTCCCAAGTGCTGG - Intronic
1159448043 18:68564559-68564581 CAGATTGCCCTCCCCAGTGTGGG - Intergenic
1160100078 18:75912446-75912468 CAGACCCCTCTCCCCAGTGTGGG + Intergenic
1160207368 18:76845969-76845991 CAGAGACCCCTGCACAATGGAGG + Intronic
1160869586 19:1271123-1271145 CTCTCTCCCCTGCACAGTGGTGG + Exonic
1161391176 19:4021392-4021414 CTGCCTCGCCTCCACAGTGCTGG + Intronic
1161628454 19:5339854-5339876 CAGTCTCCCCTCCGCGCTGGGGG - Intronic
1161801893 19:6421000-6421022 CAGAGTCCCCACCCCAGCGGAGG + Intronic
1162834596 19:13308040-13308062 CACAGTCCCCTCCACCGTGCAGG - Intronic
1163717142 19:18879207-18879229 CCGGCTCTCCTCCACAGTGGCGG - Intronic
1165407336 19:35638938-35638960 TAGACTTCCAGCCACAGTGGTGG - Intergenic
1165878383 19:39025591-39025613 CAGCCTCCCCTCCAAAGCTGAGG + Intronic
1166251750 19:41576231-41576253 CAAGCTCCTCTCCACAGAGGAGG + Exonic
1166255235 19:41599691-41599713 CAAGCTCCTCTCCACAGAGGAGG + Intronic
1166260986 19:41640626-41640648 CAAGCTCTTCTCCACAGTGGAGG - Intronic
1166496129 19:43304555-43304577 CAGGCTCATCTCCACAGAGGAGG - Intergenic
1166806369 19:45489548-45489570 CCCCCACCCCTCCACAGTGGCGG - Exonic
1168307885 19:55445405-55445427 CAAACTCTCTTCCACAGTGTGGG - Intergenic
925561659 2:5202903-5202925 CAGACTGCCTTCCACAGTGTGGG + Intergenic
927551966 2:24009227-24009249 CACACTCCCCTCCCAAGTGCTGG - Intergenic
928317502 2:30257480-30257502 CCGTCTGCCCTCCATAGTGGTGG + Exonic
929790376 2:45018102-45018124 CATTCTCCCATCCAGAGTGGGGG - Intergenic
930881379 2:56274559-56274581 CAGATTGCCCTCCACAATGTGGG - Intronic
932794964 2:74686446-74686468 CACACTGTCCTCCACAATGGTGG - Intergenic
933846529 2:86331427-86331449 CAGAGTCCCCTACAAAGAGGGGG + Intronic
934922087 2:98352667-98352689 CAGATTGCCCTCCCCAGTGTTGG + Intronic
935364797 2:102277900-102277922 CAGAGTCCCCAGCACAGTTGTGG - Intergenic
936376540 2:111946043-111946065 GAGGCTTCCCTCCACATTGGTGG - Intronic
937857546 2:126683383-126683405 CAAAGTCCTCTCCCCAGTGGTGG + Intronic
938091615 2:128438204-128438226 CAGGCTGCGCTCCACACTGGGGG - Intergenic
938204291 2:129404152-129404174 CAGATTGCCCTCCCCAGTGTGGG + Intergenic
938244211 2:129764885-129764907 CAGACCACCCTCCATAGTGTAGG + Intergenic
943561358 2:189467056-189467078 CAGTCTCCCTTTAACAGTGGGGG + Intronic
944317604 2:198300205-198300227 AAGACCGCCCTCCCCAGTGGGGG - Intronic
944506432 2:200417186-200417208 CAGTCTACCCTTCCCAGTGGGGG + Intronic
946790579 2:223297145-223297167 CAGCCTCCCACCCCCAGTGGTGG + Intergenic
947106198 2:226670242-226670264 CAGACTCCCACCCACAGTCAGGG + Intergenic
948094833 2:235325251-235325273 AAGACTCCCCTCCCCCATGGAGG - Intergenic
948877863 2:240839747-240839769 CACACTCCCCCTCACAGTGCGGG - Intergenic
1169413867 20:5398999-5399021 AAGACTTCCCTACATAGTGGGGG - Intergenic
1172111583 20:32548661-32548683 CAGACTGCCCTCCACAGACAGGG - Intronic
1172606044 20:36214786-36214808 CAGCCTCACCTTCAGAGTGGAGG - Intronic
1174110842 20:48196776-48196798 TGGAGTGCCCTCCACAGTGGGGG - Intergenic
1174171862 20:48622677-48622699 CAGCCTCTCCTCCACCCTGGGGG - Intergenic
1174220388 20:48949719-48949741 CAGTCTTCCTCCCACAGTGGTGG + Intronic
1175724916 20:61311024-61311046 CCCACTCCACTGCACAGTGGAGG + Intronic
1176227556 20:64010305-64010327 CAGACTCACCTCCACGCTGGTGG - Exonic
1178884194 21:36472544-36472566 CAGATTGCCCTCCATAGTGTGGG + Intronic
1179539860 21:42077139-42077161 CCCACATCCCTCCACAGTGGGGG - Intronic
1179969634 21:44827542-44827564 CCTACTCCCCGCCACAGTGGTGG - Intergenic
1179993991 21:44965570-44965592 CAGAATCCTCTGCACACTGGTGG + Intronic
1180074929 21:45457457-45457479 CAGCCTCCCTGCCACAGTGGGGG + Intronic
1180784768 22:18540753-18540775 CAGAGGCCCCTCCACAGGGGTGG - Intergenic
1181128348 22:20714808-20714830 CAGAGGCCCCTCCACAGGGGCGG - Intronic
1181241672 22:21480110-21480132 CAGAGGCCCCTCCACAGGGGTGG - Intergenic
1181631331 22:24153119-24153141 CACACCCCCCACCCCAGTGGTGG - Intronic
1182124391 22:27805812-27805834 CACACACCCCTCCATAGTGTGGG + Intergenic
1182783083 22:32883289-32883311 CAGTTTCCTGTCCACAGTGGAGG - Intronic
1182853630 22:33498248-33498270 AACCCTCCCCTCCACCGTGGGGG - Intronic
1184677201 22:46050210-46050232 GAGCCTCCCCTCCACTGCGGAGG - Exonic
1184911819 22:47540300-47540322 CAGACTCCCCTCCTCACGGGAGG + Intergenic
949098306 3:112939-112961 CAGATTGCCCTCCATAATGGAGG + Intergenic
950113920 3:10438355-10438377 CAGCCTGCCCTCCTCAGTGTGGG + Intronic
952009582 3:28885123-28885145 AAAACTGCCTTCCACAGTGGAGG + Intergenic
952216843 3:31286701-31286723 CAGACTGCCCTCCATAATGTGGG + Intergenic
954458856 3:50614684-50614706 CAGCATCCCCTCCACAATGATGG - Intronic
954590181 3:51776342-51776364 CACTCTCCCCTCCTCAGTAGGGG - Intergenic
954595059 3:51817577-51817599 CACACTTCCTGCCACAGTGGTGG + Intergenic
955228577 3:57079786-57079808 CATTCTCACCTCCACCGTGGAGG - Intergenic
956684885 3:71816929-71816951 CAGAATCCCCTCCTCCGCGGGGG + Intergenic
957189649 3:76990903-76990925 CAGGCTCCCCTCCCAAGTGCTGG + Intronic
957426841 3:80051028-80051050 CCGCCTCCTCCCCACAGTGGTGG - Intergenic
958928874 3:100187962-100187984 AAGGCTGCACTCCACAGTGGGGG - Intronic
959221696 3:103529561-103529583 CAGACTACCCTCCTCAATGTGGG - Intergenic
961783213 3:129333820-129333842 CTGACTCCCCACCCCAGTGAGGG + Intergenic
961984175 3:131115094-131115116 TAGATTGCCCTCCACAGTGTGGG + Intronic
963087763 3:141454392-141454414 TAGACTCCAGTCCTCAGTGGGGG + Intergenic
963368982 3:144373771-144373793 CACACTCTCTTCCACAATGGTGG - Intergenic
967403280 3:189087079-189087101 CACACTGTCTTCCACAGTGGTGG + Intronic
968282211 3:197485494-197485516 CAGACGTCCCCCGACAGTGGAGG - Intergenic
968914116 4:3489695-3489717 CACACGCTCCTCCACAGTCGAGG - Exonic
969723369 4:8905614-8905636 AAGCGTCCACTCCACAGTGGGGG - Intergenic
970379863 4:15495806-15495828 CAGACTGCTTTCCACAGTGGCGG + Intronic
970403283 4:15738168-15738190 CAGCATCCCCACCAGAGTGGTGG - Intronic
970459702 4:16261083-16261105 CAGACTGCCCTCCATAATGTGGG - Intergenic
970520526 4:16879440-16879462 CACACAGCCCTCCCCAGTGGGGG + Intronic
971452240 4:26810923-26810945 CACACTGTCTTCCACAGTGGTGG - Intergenic
974007738 4:56575517-56575539 CAGACTCTCTTCCACAGCTGTGG - Exonic
974230611 4:59109175-59109197 CACACTGTCTTCCACAGTGGTGG + Intergenic
974815311 4:66996185-66996207 CACACTGTCCTCCACAATGGTGG - Intergenic
976269701 4:83218578-83218600 CTGACTCCCCTCCAGAGAGAAGG - Intergenic
976395300 4:84549357-84549379 CAGACTACCCTCCATAATGTGGG + Intergenic
982058464 4:151577808-151577830 CAGCTTCTCCTCCACAGTGGGGG - Exonic
985106288 4:186503325-186503347 CAGACTTCCCTCCATAATGTTGG + Intronic
985647776 5:1093214-1093236 CAGACTCCTCTCCACAGCAGGGG + Intronic
985679694 5:1249448-1249470 GAGTCTCCCGTCCACACTGGGGG + Intergenic
985977160 5:3429169-3429191 CAGGCTCCCCTCCACAGCAGTGG - Intergenic
986236108 5:5912248-5912270 CACACTCCCCTCCTCCCTGGGGG - Intergenic
993259328 5:85638893-85638915 CGGGCGCCCCTCCCCAGTGGCGG - Intergenic
993261516 5:85663177-85663199 CGGGCGCCCCTCCCCAGTGGCGG + Intergenic
994218443 5:97165934-97165956 CAGATTGCCCTCCCCAGTGTGGG + Intronic
994296693 5:98098129-98098151 CAGATTGCCCTCCATAGTGTGGG - Intergenic
995809225 5:116086009-116086031 GAAACTACCCTCCACAGTGTGGG + Intronic
995926660 5:117383023-117383045 CATACTCCCCTCCCAAGTGCTGG - Intergenic
996195479 5:120601147-120601169 CAAACTGCTTTCCACAGTGGCGG + Intronic
999362822 5:151000206-151000228 CAGACTGCCCTCCCCAGTGTGGG + Intergenic
1000381762 5:160635973-160635995 CAGAGTCCCCTCCACAAGGCAGG + Intronic
1002795081 6:465563-465585 CAGACTCCCCTCCAGTGCAGAGG + Intergenic
1004540104 6:16541609-16541631 CAGACTTCATTCCACAGTGGTGG + Intronic
1005687578 6:28269759-28269781 CAGACTGCCCTCCATAATGTTGG - Intronic
1007394028 6:41567074-41567096 CTGACTCCCCTGCACAGAGCTGG + Intronic
1007630863 6:43272574-43272596 CACTCTCCCCTCCACCATGGAGG - Intronic
1007956484 6:45922308-45922330 CATTCTCCCCACCACAGAGGAGG - Intronic
1011180641 6:84616126-84616148 AGAACTCCCCTCCACGGTGGTGG - Intergenic
1011807655 6:91090674-91090696 CAGATTCCCCTGCACATTGGCGG + Intergenic
1013430551 6:110051463-110051485 GGGACTCCCCTCCCCAGTGTGGG + Intergenic
1014204047 6:118636606-118636628 CAGACTGCCCTCCATAATGTGGG + Intronic
1015661023 6:135573673-135573695 CAGATTGCCCTCCCCAGTGTGGG - Intergenic
1016932923 6:149427442-149427464 CACACTGCCCTGCACAGTGTGGG + Intergenic
1017027910 6:150197673-150197695 CAGGCCCTCCTCCACCGTGGCGG - Intronic
1017027926 6:150197721-150197743 CAGGCCCTCCTCCACCGTGGCGG - Intronic
1017027942 6:150197769-150197791 CAGGCCCTCCTCCACCGTGGCGG - Intronic
1017027972 6:150197865-150197887 CAGGCCCTCCTCCACTGTGGCGG - Intronic
1017028031 6:150198057-150198079 CAGGCCCTCCTCCACCGTGGCGG - Intronic
1017028077 6:150198201-150198223 CAGGCCCTCCTCCACCGTGGCGG - Intronic
1017028124 6:150198345-150198367 CAGGCCCTCCTCCACCGTGGCGG - Intronic
1017208913 6:151833663-151833685 CACAGTCCCTGCCACAGTGGAGG + Intronic
1018259422 6:161954811-161954833 CAGCCTCTCCTTCACAGTGCAGG + Intronic
1018635041 6:165853957-165853979 GAGCCTCCCCGCCACCGTGGTGG - Intronic
1018736025 6:166687935-166687957 TAGAACCCCCTCCCCAGTGGTGG - Intronic
1019437055 7:1027901-1027923 CAGGCTCCCCTGCGCTGTGGGGG - Intronic
1021463188 7:20912021-20912043 CAGATTGCCCTCCCCAGTGTGGG - Intergenic
1022541521 7:31140226-31140248 CAAACTGCTCTCCATAGTGGTGG + Intergenic
1022904541 7:34843097-34843119 CAGCCTCCCCAGCACAGTGGTGG + Intronic
1024712942 7:52038196-52038218 AAGCCTCCCCTCCCCATTGGTGG - Intergenic
1024871694 7:53970694-53970716 CAGATTGCCCTCCCCAGTGTGGG - Intergenic
1026219287 7:68378549-68378571 CAGACTCCCCTCCAAAGAATTGG - Intergenic
1026659225 7:72284497-72284519 CAGATTCTCCTCCCCAGTGTGGG + Intronic
1029460231 7:100690009-100690031 CAGGATCCCCTCCTCAGTTGAGG - Intergenic
1029558757 7:101288602-101288624 CAGATTACCCTCTACAGTGTGGG + Intergenic
1031236504 7:119185395-119185417 CAGCTTCCCTACCACAGTGGTGG + Intergenic
1032016981 7:128386540-128386562 CAGACACCCCTCCCCAATGTGGG + Intergenic
1032467897 7:132158057-132158079 CAGAGACACCTCCACAGTGGAGG + Intronic
1032566100 7:132946684-132946706 CAGACTGAGCTCCACAGTGATGG + Intronic
1032951609 7:136921071-136921093 CAGACTCTTCTACACAGTGGTGG + Intronic
1035034749 7:155887372-155887394 CCGACACCCCTCCACACCGGGGG - Intergenic
1035281687 7:157782444-157782466 CAGCCCGCCCTCCACAGAGGGGG + Intronic
1035670645 8:1414559-1414581 CAGAGTCCACACCAGAGTGGAGG + Intergenic
1036603429 8:10284710-10284732 CTGACTCCGCCCCTCAGTGGTGG + Intronic
1037080097 8:14774115-14774137 CAGACTGCCCTCCATAATGTGGG + Intronic
1037229408 8:16637173-16637195 CATTCTACCCTCCTCAGTGGAGG + Intergenic
1038526843 8:28281882-28281904 CAGATTGCCCTCCCCAGTGTGGG + Intergenic
1039156497 8:34564491-34564513 AAGACCCCCCTCCACATGGGTGG + Intergenic
1039626244 8:39057750-39057772 CAGACTGCCCTCCCTATTGGAGG - Intronic
1040096367 8:43447512-43447534 CACAGTCCCAGCCACAGTGGAGG - Intergenic
1040752963 8:50733504-50733526 GAGACTGCTTTCCACAGTGGTGG + Intronic
1040763517 8:50878359-50878381 CAGATTACCCTCCACAATGTGGG - Intergenic
1040900325 8:52411178-52411200 CAGCCTCCCCTCCCCACTGCAGG + Intronic
1041898044 8:62948925-62948947 TAGACTCCAGTCCACAGAGGAGG + Intronic
1042267928 8:66927335-66927357 CAGCTTCCCCTTCACACTGGAGG - Intergenic
1049793788 8:144486460-144486482 CACACTGCTCTCCAGAGTGGTGG + Intronic
1053751283 9:41258687-41258709 CACACTGTCTTCCACAGTGGTGG + Intergenic
1054155639 9:61637988-61638010 CAGACTCATCTCTACAGTGAGGG - Intergenic
1054256804 9:62823016-62823038 CACACTGTCTTCCACAGTGGTGG + Intergenic
1054856776 9:69909012-69909034 CACACTTCACTCCACTGTGGAGG + Intergenic
1057927016 9:99161689-99161711 CAAACTGCTTTCCACAGTGGTGG + Intergenic
1060548727 9:124475474-124475496 CAGACTCACCTCCTCATTGCAGG - Exonic
1061391346 9:130318978-130319000 CATGCTCCCCTCCACAGAAGTGG + Intronic
1061631514 9:131875060-131875082 CAGCCACCCCTGCTCAGTGGGGG + Intronic
1062353733 9:136152224-136152246 CAGGCTCCCATCCTCAGCGGAGG - Intergenic
1188581644 X:31721361-31721383 CAGATTACCCTCCACAATGTGGG + Intronic
1193574020 X:83177585-83177607 CAGTTTCCCATCCCCAGTGGTGG - Intergenic
1195303027 X:103550704-103550726 CAGATTGCCCTCCCCAGTGTGGG + Intergenic
1199054782 X:143280819-143280841 CAGATTTCCCTCTACAATGGGGG + Intergenic
1199590705 X:149465813-149465835 CAGATTCCCCTCCATAATGTGGG + Intergenic
1200052469 X:153442292-153442314 CAGAGACCCCTCCACAGAGGCGG + Intergenic
1201614055 Y:15876185-15876207 CAGGCTTCCCTTAACAGTGGTGG - Intergenic
1201616313 Y:15903595-15903617 CAGGCTTCCCTTAACAGTGGTGG + Intergenic