ID: 1133120972

View in Genome Browser
Species Human (GRCh38)
Location 16:3607482-3607504
Sequence CTCAGTATACCAAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133120972 Original CRISPR CTCAGTATACCAAGGGCAGC AGG Intronic
901867309 1:12115522-12115544 ATCAGTATGGCAAGGGCAGGGGG - Intronic
902368081 1:15990298-15990320 CTGTGGGTACCAAGGGCAGCTGG - Intergenic
903060862 1:20667684-20667706 GTTAGCATACCAAGGGAAGCAGG + Intronic
903088858 1:20890814-20890836 ATCAATATACCAAGGTAAGCTGG + Intronic
906529412 1:46514936-46514958 CTCAGTAGACCATGGGAAGGGGG + Intergenic
906539849 1:46576912-46576934 CTCAGTCTCCCCTGGGCAGCTGG - Intronic
907527460 1:55062370-55062392 CTCAGTGTACCCAGGGCAAGTGG - Intronic
907933712 1:59023055-59023077 GTCAGTATCCCATGGACAGCAGG - Intergenic
908748393 1:67397205-67397227 TTCAGCAAATCAAGGGCAGCTGG + Intergenic
912491438 1:110064847-110064869 CTCGGCAGTCCAAGGGCAGCTGG + Exonic
912882359 1:113428464-113428486 CTCACTATACCAGTGGCAACTGG + Intronic
916125903 1:161571041-161571063 TTCAGTAGACCAAGAGCCGCCGG + Intergenic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
924720506 1:246618609-246618631 CTAAGGATTCCAAGAGCAGCAGG - Intronic
1066435438 10:35393081-35393103 CTCAGAAAACACAGGGCAGCTGG - Intronic
1067343606 10:45422608-45422630 CTCAGCATGCATAGGGCAGCAGG + Intronic
1069767320 10:70872496-70872518 CTCAGTCCACCAAGGGTGGCAGG - Intronic
1071981420 10:91007906-91007928 CTCAATATACCCAGAGCAGGAGG - Intergenic
1074579714 10:114707570-114707592 CTCAGGAAGCCAGGGGCAGCAGG - Intergenic
1074842107 10:117364874-117364896 CTCATTTTACTAAGGGCAGAAGG + Intronic
1076130804 10:128012440-128012462 CTCAGCAAAGCAAGGGTAGCAGG - Intronic
1077990745 11:7409073-7409095 CTCAATAAACCAAGTGCAGAAGG - Intronic
1078845456 11:15115285-15115307 CACAGTGCACCCAGGGCAGCAGG - Intronic
1078881399 11:15452539-15452561 CTCATGAGACCAAGGGTAGCTGG + Intergenic
1084314813 11:68339290-68339312 CTCAGTATCCCAAGTAGAGCTGG + Intronic
1085267158 11:75243730-75243752 ATCAGTACTCCAAGGTCAGCAGG - Intergenic
1092847906 12:12601123-12601145 CTCATTATTGCGAGGGCAGCAGG + Intergenic
1096306849 12:50485228-50485250 CTCAGTGTATCAAGAGTAGCTGG - Intergenic
1096743961 12:53713547-53713569 CTCAGTCTCCCAAGAGTAGCTGG - Intronic
1097678338 12:62626210-62626232 TTCAGTTTATCATGGGCAGCTGG + Intergenic
1098152700 12:67564080-67564102 CTAAGTATGGCAATGGCAGCTGG - Intergenic
1098761986 12:74435768-74435790 CTCAGTATCACAAGAACAGCAGG - Intergenic
1101555849 12:105808471-105808493 CTCAGGATAACCAGGGCAGTCGG + Intergenic
1104071051 12:125345606-125345628 CTCAAAATACCAATGGCAGATGG - Intronic
1112448839 13:99491198-99491220 TCCAGTATACCAATGCCAGCGGG + Intergenic
1112552486 13:100434608-100434630 CTCAGGAGACCAAAGGCAACTGG - Intronic
1115988136 14:39123842-39123864 TTCAACATACCAGGGGCAGCAGG + Intronic
1124214442 15:27794992-27795014 CTCACTATAGCATGGGAAGCAGG + Intronic
1126357530 15:47812110-47812132 CCAAGTATACCAAGGTGAGCAGG - Intergenic
1128807538 15:70542253-70542275 CTCCGTATACACAGGGCATCAGG + Intergenic
1129118864 15:73382782-73382804 CTCTGTATACCCAGGGCTGATGG + Intergenic
1129781552 15:78275303-78275325 CACATTATGCCAAGGGAAGCGGG + Intronic
1130051026 15:80483822-80483844 CTCAGCCTACCCAAGGCAGCTGG + Intronic
1133120972 16:3607482-3607504 CTCAGTATACCAAGGGCAGCAGG + Intronic
1133340136 16:5030644-5030666 CCCAGTCTCCCCAGGGCAGCCGG + Intronic
1134109181 16:11503987-11504009 CCCAGGGTGCCAAGGGCAGCTGG - Intronic
1135781609 16:25307836-25307858 CTCAGTATAGCAGTGGCAGAAGG - Intergenic
1138680164 16:58678419-58678441 GTCTGTGTACCAAGGGCCGCTGG + Exonic
1140306270 16:73806129-73806151 CTCACTATCACAAGGACAGCAGG + Intergenic
1141364890 16:83433514-83433536 CTAATTTTACCAAAGGCAGCTGG + Intronic
1142582671 17:951864-951886 CTCAGTAGACGGAGGGCACCCGG + Intronic
1143008539 17:3852859-3852881 CTCACTAGACCAAGGGAAGGAGG - Intergenic
1146096651 17:29936551-29936573 CACAGTATAACAAAGCCAGCTGG + Intronic
1146735834 17:35238089-35238111 CTGAGTATGGCAAGGACAGCAGG - Intergenic
1147534631 17:41311616-41311638 CTCAGCCTCCCAAGTGCAGCTGG - Intergenic
1148247052 17:46039308-46039330 CGCCGTATACCCAGGGCAGCAGG + Intronic
1150336251 17:64332758-64332780 CCCAGTATACCAAGACTAGCTGG - Intronic
1152009018 17:77699421-77699443 CTCAGTATCCCCCGGGGAGCAGG - Intergenic
1155708566 18:28847281-28847303 TTCCCTAGACCAAGGGCAGCAGG - Intergenic
1156317672 18:35985851-35985873 CTCAATATAGCAAAGACAGCTGG - Intronic
1156439758 18:37172686-37172708 CACAGTAAACCAAGATCAGCAGG + Intronic
1157471416 18:47991816-47991838 CTCAGAACTCCAAGGGCAGTTGG - Intergenic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
1160799419 19:960903-960925 CTCAGACGACCAAGGGTAGCCGG + Intronic
1165138608 19:33686131-33686153 CTCTCTATACCCAGGGAAGCTGG - Intronic
927648617 2:24897386-24897408 CTCTTTATGCCAAGGGCAGGGGG - Intronic
928466303 2:31526048-31526070 CTCAGAATCCCCAGGCCAGCTGG + Exonic
932294909 2:70616224-70616246 CTCAGCTCACTAAGGGCAGCAGG + Intronic
933755694 2:85636618-85636640 CTCAGTCTCCCAAGGGTAGCTGG + Intronic
935803527 2:106723844-106723866 CTCAGTAAACCAATGTCAGTAGG + Intergenic
938114842 2:128595998-128596020 CTCAGCATGCCAAGGGCTGAGGG - Intergenic
943371231 2:187018707-187018729 CTCAGTATATCAAGGGGATAAGG - Intergenic
944866558 2:203868187-203868209 CTCTGTATTCCAGGGCCAGCAGG + Intronic
1175408819 20:58752701-58752723 CTCAGCATACCATGGGCACCAGG + Intergenic
1176887914 21:14278036-14278058 CTCAGTGTCCTAAGCGCAGCAGG + Intergenic
1178005067 21:28209580-28209602 CTCAGTATAGCCAGTGCAGAGGG + Intergenic
1179807786 21:43851037-43851059 CTCACTATCACAAGGACAGCAGG + Intergenic
1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG + Exonic
1180068194 21:45423322-45423344 CCCAGCACAGCAAGGGCAGCTGG - Intronic
1180102230 21:45593922-45593944 CTCAGCAGACCAGGGTCAGCTGG - Intergenic
1181979596 22:26756807-26756829 GTCAGGATACCACGGGCAGAGGG - Intergenic
949431425 3:3980150-3980172 TTCAGTATACCAGGAGCAGAGGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
951168184 3:19507234-19507256 TTCCCTATAGCAAGGGCAGCAGG + Intronic
953711399 3:45274029-45274051 CTATGTATCCCAAGGGCAGAGGG + Intergenic
954371363 3:50171071-50171093 CTCACAATACCAAGGGCACAGGG - Intronic
954879823 3:53826574-53826596 CTCAGTAAACCAAGAGTAGAAGG + Intronic
958897458 3:99844775-99844797 CTCAGTATCACAAGAACAGCAGG - Intronic
963722952 3:148885141-148885163 TTCAGCATACCAAGGGAAGAAGG - Intronic
964539380 3:157762200-157762222 TTCACTATCCCAAGGGCAGGAGG + Intergenic
973301598 4:48591245-48591267 CTCACTATACCAAGAGCAAAAGG - Intronic
977602917 4:98953443-98953465 TTCAGAAGTCCAAGGGCAGCTGG - Intergenic
982200211 4:152953015-152953037 CTCAGCCTCCCGAGGGCAGCTGG - Intronic
985876268 5:2599456-2599478 CACAGTAAACCAAGAGCAGGGGG + Intergenic
986831099 5:11579446-11579468 TTCAGTGTACCAAGAGCATCTGG - Intronic
993968319 5:94385991-94386013 GTCAGTTTACCATGGGCAGAGGG - Intronic
994898359 5:105736024-105736046 CTTAGTCTACCAAGACCAGCAGG + Intergenic
995428492 5:112049569-112049591 CTGAGTAGACCAGGGGCAGAAGG + Intergenic
1000646618 5:163767569-163767591 CTCAGTATGCCAAGATCAGCAGG - Intergenic
1001182169 5:169530657-169530679 CTCAGTCAACCAAGAGCAGCTGG + Intergenic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1003385614 6:5664800-5664822 TTCAGTAGCTCAAGGGCAGCTGG + Intronic
1004419318 6:15453964-15453986 CTCAGTCTACTAAGAGCACCTGG - Intronic
1004626427 6:17381355-17381377 GTCAGCAAACCAAGAGCAGCAGG - Intergenic
1005514173 6:26538562-26538584 CTAAGTATACGGAGGGCGGCGGG - Intronic
1006051677 6:31350189-31350211 CTCAGGCCACCAAGGGAAGCAGG - Intronic
1010412668 6:75578581-75578603 ATCACTATACCAAGGGGAGTGGG + Intergenic
1013662022 6:112307755-112307777 CTCAGTTTTCTAAGGTCAGCAGG - Intergenic
1017592550 6:155993036-155993058 CTAAATATGCCAAAGGCAGCTGG - Intergenic
1041766217 8:61420852-61420874 CTCAGCCTCCCAAGGGTAGCTGG - Intronic
1045215523 8:100145480-100145502 CCCAGAAAGCCAAGGGCAGCAGG + Intronic
1045651457 8:104345259-104345281 CTCATTAAACCAAAGGGAGCAGG + Intronic
1048869454 8:138785174-138785196 TTCAGTATCCCCAGGGGAGCAGG - Intronic
1050175808 9:2868376-2868398 CTGAAAATTCCAAGGGCAGCTGG + Intergenic
1053379317 9:37636080-37636102 CTGAGTATATCGAGGGCGGCTGG - Intronic
1056760083 9:89408354-89408376 CTGAGAAGAGCAAGGGCAGCAGG - Intronic
1059539563 9:115117232-115117254 CAAAGTACACCAGGGGCAGCAGG + Intronic
1059597753 9:115741333-115741355 CTCAGTATACCAAAGAAAGAGGG - Intergenic
1060110880 9:120905427-120905449 CTCAGAATACCAGGTGCCGCTGG - Intronic
1060300043 9:122369784-122369806 CTCTGTCTCCCTAGGGCAGCTGG + Intergenic
1203768366 EBV:38255-38277 CTGAGCATTCCATGGGCAGCAGG + Intergenic
1185665886 X:1765284-1765306 ATCAGTATACACTGGGCAGCTGG - Intergenic
1188323535 X:28771124-28771146 CTTAGGACACAAAGGGCAGCAGG + Intronic
1188708404 X:33363603-33363625 GTCAGAATACCAGAGGCAGCCGG - Intergenic
1193738281 X:85186155-85186177 CTCAGTAGATTAAGGGCACCAGG - Intergenic
1194130423 X:90074392-90074414 CTGAGTATACCATGGTCTGCTGG - Intergenic
1194234974 X:91372172-91372194 CTCACCTGACCAAGGGCAGCAGG - Intergenic