ID: 1133122462

View in Genome Browser
Species Human (GRCh38)
Location 16:3618494-3618516
Sequence CAGAGGTAATCCGCCCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45322
Summary {0: 1, 1: 3, 2: 294, 3: 6523, 4: 38501}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133122462_1133122467 10 Left 1133122462 16:3618494-3618516 CCAAGGCGGGCGGATTACCTCTG 0: 1
1: 3
2: 294
3: 6523
4: 38501
Right 1133122467 16:3618527-3618549 TGAGACCAGCTTGGCCAATATGG 0: 127
1: 4962
2: 49889
3: 123799
4: 182060
1133122462_1133122466 1 Left 1133122462 16:3618494-3618516 CCAAGGCGGGCGGATTACCTCTG 0: 1
1: 3
2: 294
3: 6523
4: 38501
Right 1133122466 16:3618518-3618540 TCAGGAGTTTGAGACCAGCTTGG 0: 1836
1: 49211
2: 124310
3: 181848
4: 201665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133122462 Original CRISPR CAGAGGTAATCCGCCCGCCT TGG (reversed) Intronic
Too many off-targets to display for this crispr