ID: 1133125406

View in Genome Browser
Species Human (GRCh38)
Location 16:3642895-3642917
Sequence CACACCAGACGCAGAGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 236}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133125406_1133125411 9 Left 1133125406 16:3642895-3642917 CCGCAGGCTCTGCGTCTGGTGTG 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1133125411 16:3642927-3642949 ACGGGGAAGCACTCCTGCCCAGG 0: 1
1: 0
2: 3
3: 9
4: 116
1133125406_1133125410 -8 Left 1133125406 16:3642895-3642917 CCGCAGGCTCTGCGTCTGGTGTG 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1133125410 16:3642910-3642932 CTGGTGTGGAAGAGCTCACGGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1133125406_1133125408 -10 Left 1133125406 16:3642895-3642917 CCGCAGGCTCTGCGTCTGGTGTG 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1133125408 16:3642908-3642930 GTCTGGTGTGGAAGAGCTCACGG 0: 1
1: 0
2: 0
3: 12
4: 179
1133125406_1133125412 17 Left 1133125406 16:3642895-3642917 CCGCAGGCTCTGCGTCTGGTGTG 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1133125412 16:3642935-3642957 GCACTCCTGCCCAGGACCCGAGG 0: 1
1: 0
2: 0
3: 19
4: 194
1133125406_1133125409 -9 Left 1133125406 16:3642895-3642917 CCGCAGGCTCTGCGTCTGGTGTG 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1133125409 16:3642909-3642931 TCTGGTGTGGAAGAGCTCACGGG 0: 1
1: 0
2: 0
3: 10
4: 139
1133125406_1133125414 23 Left 1133125406 16:3642895-3642917 CCGCAGGCTCTGCGTCTGGTGTG 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1133125414 16:3642941-3642963 CTGCCCAGGACCCGAGGAGCCGG 0: 1
1: 0
2: 2
3: 19
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133125406 Original CRISPR CACACCAGACGCAGAGCCTG CGG (reversed) Intronic
900370283 1:2329182-2329204 CACAGCAGACGGAGGGGCTGGGG - Intronic
900630522 1:3632753-3632775 CACAGCAGAAGCAGGGGCTGTGG + Intronic
900849062 1:5127740-5127762 CACAGAAGACGCAAAGCCAGAGG - Intergenic
901160663 1:7174577-7174599 CAGACCAGGAGCAGAGGCTGGGG + Intronic
901261631 1:7875802-7875824 CCCACCAGTCCCTGAGCCTGGGG + Intergenic
901789351 1:11646309-11646331 CACAGCAGGCTCAGAGCCTCTGG + Intergenic
902216880 1:14939908-14939930 CACTCCTGAGGCTGAGCCTGAGG - Intronic
902250771 1:15153284-15153306 CACACCAGGCGCAGACGCCGAGG - Intronic
902503583 1:16925839-16925861 CACACCCGCTGCAGACCCTGGGG - Intronic
902629201 1:17694869-17694891 CAGACCAGGCGCTGTGCCTGTGG + Intronic
904004216 1:27355295-27355317 CACACCAGCCCCAGGACCTGGGG - Exonic
904441590 1:30535322-30535344 CCTACTAGACGCAGACCCTGAGG + Intergenic
904442737 1:30542202-30542224 CAGCCCAGCCTCAGAGCCTGGGG - Intergenic
904615502 1:31747338-31747360 CACAGGAGAGGCAGGGCCTGGGG - Intronic
907256541 1:53183368-53183390 AACAGCAAAGGCAGAGCCTGAGG + Intergenic
910524664 1:88164208-88164230 CACATCAGGGGCAGAGCATGAGG + Intergenic
914950976 1:152113358-152113380 CACCTTAGAGGCAGAGCCTGAGG + Intronic
917284081 1:173406689-173406711 CACAACAGACACAGAGCCCAGGG - Intergenic
918151356 1:181800133-181800155 CACACCAGCTGCAGAATCTGCGG - Intronic
920245406 1:204584100-204584122 CACAACAGAGGCAGGGCCTGGGG + Intergenic
920661450 1:207918979-207919001 CACCTCAGAGGCAGAGCATGGGG + Intergenic
920692598 1:208158487-208158509 GACACCAGCCCCAGAGCATGGGG + Intronic
922764268 1:228149378-228149400 CACACCACACACAGCCCCTGGGG - Intergenic
923145303 1:231193690-231193712 CTCACCAGAAGCAGATGCTGGGG - Intronic
923274606 1:232385463-232385485 CACTCCCCACGCAGAGACTGTGG + Intergenic
923730809 1:236547758-236547780 CACACCATCCCCAGGGCCTGCGG - Intronic
1063367728 10:5501139-5501161 CACAGCAGAGGGAGAGGCTGAGG + Intergenic
1063848641 10:10160776-10160798 CAGAGCAGACGCCGAGGCTGAGG - Intergenic
1066062215 10:31734278-31734300 CACACCAGTCACATAGCCTCAGG - Intergenic
1066582018 10:36891462-36891484 CACTCCAGACCAACAGCCTGGGG + Intergenic
1067093971 10:43286258-43286280 CAAACCAGCCCCAGAGCATGGGG - Intergenic
1070720048 10:78750176-78750198 CACACCACAAGCAGTGCATGAGG - Intergenic
1072232280 10:93423965-93423987 GACAGCAGAGGCAGAGACTGGGG + Intronic
1074242379 10:111651976-111651998 CCCACCAGAAGGACAGCCTGTGG - Intergenic
1075214124 10:120517081-120517103 CCCACCAGGCTCAGAGGCTGGGG + Intronic
1075550536 10:123389504-123389526 GACCACAGAGGCAGAGCCTGGGG - Intergenic
1076758112 10:132585746-132585768 CACCCCAGAAGCAGAGGATGTGG - Intronic
1077069768 11:663507-663529 CACACCAGAGGCAGTTGCTGAGG - Intronic
1077180346 11:1209456-1209478 AACACAAGCCCCAGAGCCTGAGG - Intergenic
1077435351 11:2536299-2536321 CACACCATCCGCACTGCCTGCGG + Intronic
1078326694 11:10387167-10387189 CACACCAGAGGCAGTGGGTGGGG - Intronic
1080427464 11:32169147-32169169 CACAGCAGAGGCACAGGCTGTGG + Intergenic
1082817863 11:57522223-57522245 CACATAGGATGCAGAGCCTGTGG + Intergenic
1084413002 11:69014791-69014813 CTCACCAGACGCTGAATCTGTGG - Intergenic
1084424032 11:69074822-69074844 CACACCAGGAGCAAAGCCTGAGG - Intronic
1085258386 11:75190289-75190311 CTCACCAGCCACAGGGCCTGAGG - Intronic
1086980521 11:93192313-93192335 CACACCAGACTCCCATCCTGAGG - Intronic
1087774479 11:102244931-102244953 GACACCTGACCCAGACCCTGAGG + Intergenic
1090204007 11:124875068-124875090 CACACCAGAAGGGGAGGCTGGGG - Intronic
1092214076 12:6668183-6668205 TACAGCAGAATCAGAGCCTGGGG - Intronic
1092226395 12:6750962-6750984 CACAGCAGTCACAGAGACTGAGG - Intronic
1096559265 12:52424190-52424212 CCCTCCAGATGCAGAGGCTGGGG - Exonic
1097707655 12:62884421-62884443 AACCCCAGAGGCAGAGGCTGTGG + Intronic
1097985576 12:65779975-65779997 CACACAGGACGCAGACACTGAGG - Intergenic
1103014671 12:117484663-117484685 CTCAACAGAGGCAGGGCCTGGGG + Intronic
1103429900 12:120874678-120874700 CACACTGGAAGCAGAGCATGTGG + Intronic
1104275559 12:127323783-127323805 TATTCCAGATGCAGAGCCTGAGG - Intergenic
1104307377 12:127621729-127621751 CACACCAGTCCCAGAGCCACGGG - Intergenic
1104633720 12:130425072-130425094 CAGAGCACACGCAGAGCCAGCGG + Intronic
1105278314 13:18948865-18948887 GTCACCAGACACAGAGACTGAGG + Intergenic
1105540843 13:21315131-21315153 GACAACAGAGGCAGAGACTGAGG + Intergenic
1106130712 13:26937128-26937150 CTCACCAGAAGCAGATACTGGGG + Intergenic
1107821207 13:44287230-44287252 GACTCCTGATGCAGAGCCTGAGG - Intergenic
1112179347 13:97062295-97062317 CTCACCAGAAGCAGATGCTGGGG - Intergenic
1113890058 13:113731013-113731035 CACCCCACAGGCAGAGTCTGGGG + Intronic
1114494006 14:23120148-23120170 GAAACCAGAGGCAGAGCCTCAGG - Intergenic
1114665287 14:24374026-24374048 CACCCCAGAGACAGAGTCTGTGG - Intronic
1115174663 14:30548005-30548027 CAGAGCAGACGCAGAGGCTGAGG + Intergenic
1117262766 14:54053571-54053593 TTCACTAGATGCAGAGCCTGAGG - Intergenic
1117375477 14:55114988-55115010 CACACCAAACCAAGAGCCTCAGG + Intergenic
1118796743 14:69151890-69151912 CAAACCAGAGGGAGAGCCCGGGG + Intronic
1119441599 14:74632037-74632059 CCTACCAGAAGCAGAGCCTGTGG + Intergenic
1120040306 14:79745518-79745540 CAAACCAGCAGCAGAGCCTGGGG + Intronic
1121828046 14:97026912-97026934 CCCACCAGACACAGTGCCTCAGG - Intergenic
1122635165 14:103126430-103126452 CACATCAGAGGCAGAGTCAGAGG + Exonic
1126855257 15:52832681-52832703 CACAGCAGCAGCAGAACCTGGGG - Intergenic
1127289765 15:57559830-57559852 CCCAACAGACCCAGAGCCTTTGG - Intergenic
1128085421 15:64883131-64883153 CACTGCAGGGGCAGAGCCTGTGG - Intronic
1128709104 15:69858500-69858522 TGCACCAGAGGGAGAGCCTGGGG + Intergenic
1129059448 15:72849159-72849181 TCCACCAGACTCAGAGCCAGAGG - Intergenic
1129230740 15:74195973-74195995 CACACCAACCCCAGGGCCTGGGG + Intronic
1130953937 15:88613519-88613541 CAAACCAGCCCCAGAGGCTGAGG - Intergenic
1131569736 15:93522561-93522583 CACCCCAGCAGCAGAGCCTATGG - Intergenic
1132578148 16:673350-673372 CAGACCAGAGGCACAGCCGGTGG - Intronic
1133125406 16:3642895-3642917 CACACCAGACGCAGAGCCTGCGG - Intronic
1136364224 16:29801613-29801635 CCCAGCAGACCCAGAGCTTGGGG + Intronic
1141143477 16:81513243-81513265 CTCACCAGACCCAGAGTGTGGGG + Intronic
1141944298 16:87298893-87298915 CACCCCAAAAGCAGAGCCTGAGG + Intronic
1141945446 16:87305976-87305998 AACACCAGCCCCAGAGCCTCCGG + Intronic
1142100239 16:88267146-88267168 CAGACCACACGCAGAGAGTGAGG - Intergenic
1142246593 16:88973052-88973074 CCCAGCAGACACAGGGCCTGCGG + Intronic
1142849120 17:2695838-2695860 GGAACCAGACACAGAGCCTGCGG + Intronic
1143251838 17:5528510-5528532 CACACCAGGAGGAGAGCATGGGG - Intronic
1143877169 17:10000789-10000811 CAGAGCAGACGCAAAGCCTTGGG - Intronic
1144218530 17:13079352-13079374 CAAACCAGACCCAGAAGCTGGGG + Intergenic
1144425861 17:15141691-15141713 CTCCCCAGACTCAGAGCCTGGGG + Intergenic
1146011171 17:29196055-29196077 CACACCAGGAGCTGTGCCTGGGG - Intergenic
1150477713 17:65487601-65487623 CTCACCAGAGGCAGATGCTGGGG - Intergenic
1151415771 17:73961806-73961828 CTCACCAGAAGCAGATGCTGGGG + Intergenic
1152747806 17:82049285-82049307 GACACCTCAGGCAGAGCCTGGGG + Intronic
1153978174 18:10287594-10287616 CACAACAGTCCCATAGCCTGAGG - Intergenic
1154123947 18:11673204-11673226 CACACCAGAGACAGAGTCTTAGG - Intergenic
1155248728 18:23935887-23935909 CACTCCAGACCCAGTTCCTGGGG - Intronic
1157470550 18:47984777-47984799 CTCACTAGAAGCAGAGCCTGAGG - Intergenic
1160057038 18:75492706-75492728 CACACCAAACACAGACCTTGAGG - Intergenic
1160177914 18:76611183-76611205 CACATCAGCAGCAGAGCCCGGGG + Intergenic
1160406493 18:78649921-78649943 CACAGATGATGCAGAGCCTGTGG - Intergenic
1160451097 18:78966406-78966428 CACACCAGAGCCACAGCCTGGGG + Intergenic
1160872817 19:1284905-1284927 CTCACCAGACTCTGAGCTTGTGG - Intergenic
1160971532 19:1769884-1769906 GACCCCAGAGGCAGAGGCTGGGG - Intronic
1161264569 19:3358496-3358518 TGCGCCAGACGCAGAGCCGGTGG + Intergenic
1161630619 19:5353424-5353446 CACACCAGTCCCCCAGCCTGTGG + Intergenic
1162134602 19:8547701-8547723 TCCCCCAGAAGCAGAGCCTGAGG - Intronic
1163134057 19:15296515-15296537 CACACAAGGCCCAAAGCCTGAGG + Intronic
1163775267 19:19213630-19213652 CACCCCAGACACAGACCCTGGGG - Intronic
1165333444 19:35154116-35154138 CACCCCAGACCCAGGGCCTCAGG + Exonic
1165652053 19:37500094-37500116 CACTCCAGAGGCAGAGCCGCAGG - Intergenic
1165728317 19:38127951-38127973 CTCACCAGATACAGAACCTGCGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166749073 19:45156154-45156176 CACACCAGAGGCTGAGGCTGCGG + Intronic
1168087104 19:54056297-54056319 AACCCCAGAGGCAGAGGCTGCGG - Intronic
1168687524 19:58357693-58357715 AACACCAGACAGAGGGCCTGAGG + Intronic
926213863 2:10891482-10891504 CACACCACACCAAGTGCCTGTGG - Intergenic
932586287 2:73031659-73031681 CACACCAGACTCAGAGGTTTTGG + Intronic
934047857 2:88186828-88186850 CTCACCAGATGGAGACCCTGTGG + Intergenic
934209586 2:89963934-89963956 CACACCAAGCCCAGAGCCCGAGG - Intergenic
936973300 2:118195243-118195265 CTCACCAGACTCAGAACCTAAGG - Intergenic
938071371 2:128310211-128310233 CAGACCAGGCGCTGAGGCTGCGG - Intronic
938250694 2:129813370-129813392 CACAGCAGACACAGAGCATGGGG + Intergenic
939745462 2:145960988-145961010 CAGAGCAGACGCCGAGGCTGAGG + Intergenic
939886501 2:147686730-147686752 CAGAGCAGACGCCGAGGCTGAGG + Intergenic
947390934 2:229638985-229639007 CTCACCTGACGCAGAGCCCCTGG + Intronic
947525628 2:230875161-230875183 GACACCAGAGAAAGAGCCTGGGG - Intronic
948143335 2:235690555-235690577 CACATCAGACCCAGAGTCCGAGG + Intronic
948588898 2:239037221-239037243 CACCCCAGATGCAGAGCCCCTGG + Intergenic
948652876 2:239459395-239459417 CACAGCAGATGCACAGCCAGAGG - Intergenic
948686065 2:239670409-239670431 GAAATCAGAGGCAGAGCCTGGGG - Intergenic
948785960 2:240353115-240353137 CACCCCAGACCCAGAGCTGGAGG - Intergenic
1169374703 20:5057156-5057178 CTCCCTAGAAGCAGAGCCTGAGG - Intergenic
1171125168 20:22596436-22596458 TTCCCCAGAAGCAGAGCCTGAGG + Intergenic
1172225532 20:33302844-33302866 CAGGCCACACACAGAGCCTGTGG + Intronic
1173071820 20:39775451-39775473 CACATCAGAAGCAGAGACTCAGG + Intergenic
1173959343 20:47059032-47059054 CACACCAGAATTAGTGCCTGTGG + Intronic
1174060371 20:47828230-47828252 CACACCAGGCACAGGGACTGGGG + Intergenic
1174071527 20:47903139-47903161 CACACCAGGCACAGGGACTGGGG - Intergenic
1175730879 20:61353120-61353142 AACACCAGAAGCGAAGCCTGTGG - Intronic
1176147293 20:63571229-63571251 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147307 20:63571280-63571302 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147321 20:63571331-63571353 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147362 20:63571484-63571506 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147388 20:63571586-63571608 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147428 20:63571739-63571761 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147469 20:63571892-63571914 CCCACCACAGGCAGAGCCAGAGG - Intronic
1176147493 20:63571994-63572016 CCCACCACAGGCAGAGCCAGAGG - Intronic
1178478945 21:32962460-32962482 CACACCAGAGCCAAAGGCTGGGG - Intergenic
1179518931 21:41929462-41929484 CACAACAGACACAGACCCTGTGG + Intronic
1179608987 21:42536935-42536957 CACACCACAGCCAGAGACTGAGG + Intronic
1182045075 22:27267854-27267876 CCCACCAGACCCAGGGCCTGAGG + Intergenic
1183230797 22:36580630-36580652 CACTCCATACTCAGAGCCTGGGG - Intronic
1183504070 22:38199385-38199407 CATACCAAACCCACAGCCTGTGG + Intronic
1184557864 22:45242746-45242768 CTCTCCAGACGCAGAACCAGAGG - Intergenic
1185021717 22:48380373-48380395 CAGGCCAGACCCAGAGCCGGGGG - Intergenic
1185318073 22:50187275-50187297 CACACCTGAGCCAGAGCCCGAGG - Intronic
949651219 3:6162159-6162181 CAGACCAGAGGCACACCCTGTGG - Intergenic
950156920 3:10728363-10728385 CACACTATAAGCAGAGCATGTGG - Intergenic
950389319 3:12684032-12684054 CACAACAGCCTCAGAGGCTGTGG - Intergenic
950471230 3:13187792-13187814 CTCAGCAGACACCGAGCCTGCGG - Intergenic
950715278 3:14843479-14843501 AACGCCTGCCGCAGAGCCTGGGG - Intronic
950940924 3:16890701-16890723 CATAACAGTCGCAGATCCTGTGG - Intronic
952846927 3:37695641-37695663 CACATCACAGGCAGAGCATGGGG - Intronic
954076693 3:48187384-48187406 CACAGCAAACGAAGATCCTGAGG + Intronic
958718694 3:97819668-97819690 CACCCAAGATGCAGAGCCAGAGG - Intergenic
959585522 3:108021910-108021932 TACATCAGACACAGAACCTGAGG - Intergenic
961433211 3:126897937-126897959 CACTCCACAGGCAGAGACTGAGG - Intronic
961532393 3:127547566-127547588 CAGAGCAGACGCACAGCCCGGGG + Intergenic
964811761 3:160672323-160672345 CACACCAGAGGGGCAGCCTGAGG - Intergenic
965648001 3:170904608-170904630 CCCAGCAGACCCAGAGGCTGAGG - Intronic
966879071 3:184339536-184339558 AACCCCAGAGGCAGAGGCTGCGG - Intronic
968323500 3:197791702-197791724 TGCGCCAGACCCAGAGCCTGGGG + Intronic
968673894 4:1866690-1866712 CACAGCAGAGGCACAGCCTTTGG - Intergenic
968892460 4:3376882-3376904 CACGCCAGAGGCTGAGACTGAGG - Intronic
969107179 4:4816383-4816405 CTCACCAGAAGCAGATGCTGAGG - Intergenic
969455405 4:7297248-7297270 CACACCGTGCTCAGAGCCTGAGG + Intronic
970333151 4:15004226-15004248 CGCAGCAGCCGCAGAGCCGGAGG + Exonic
973581975 4:52352827-52352849 CACACCTGACCCTGAGCCTATGG - Intergenic
974743916 4:66045031-66045053 CTCACCAGAAGCAGATGCTGGGG - Intergenic
977009267 4:91615060-91615082 TTCACCAGAAGCAGATCCTGAGG + Intergenic
977634601 4:99282580-99282602 CACAGCACAGGTAGAGCCTGGGG + Exonic
977637291 4:99314055-99314077 CACAGCACAGGTAGAGCCTGGGG + Exonic
981550855 4:145938950-145938972 CACACAAGAGGCACAGACTGAGG + Intergenic
983869147 4:172804563-172804585 CATACCAGCTGCTGAGCCTGGGG + Intronic
984942210 4:184942988-184943010 CTCACCAGAAGCAGACCCTGGGG - Intergenic
985537544 5:473502-473524 CCCAGCGGACGCCGAGCCTGGGG - Intronic
986013810 5:3740461-3740483 CACACCGGACTCAGACCCTCCGG - Intergenic
986373896 5:7110543-7110565 CACACCAGACACCAAGTCTGCGG + Intergenic
991254508 5:64599488-64599510 AACACCAGATGAAGAGGCTGAGG + Intronic
992786122 5:80172241-80172263 GACACCAGAGGCAGAGGCTGCGG + Intronic
992796144 5:80256280-80256302 CGCACCAGACCCGGAGCGTGGGG - Intergenic
994024948 5:95071210-95071232 GACACCAGATCCGGAGCCTGAGG + Intronic
997032062 5:130141861-130141883 CACACCAGAAGGAATGCCTGGGG + Intronic
997304877 5:132829918-132829940 CACCCCAGATGCAGAGTCTCTGG + Intronic
997399702 5:133592825-133592847 CTCACCAGAAGCAGATTCTGGGG + Intronic
997426909 5:133809460-133809482 CACACCAGACTGAGAGCTTTGGG - Intergenic
997638907 5:135435690-135435712 CACTGCAGACACAGAGGCTGGGG - Intergenic
997997427 5:138597789-138597811 TTCCCCAGAAGCAGAGCCTGAGG - Intergenic
1001638791 5:173231097-173231119 ATCACCAGCCCCAGAGCCTGAGG - Intergenic
1002480039 5:179494523-179494545 AACCCCAGAGGCAGAGGCTGCGG + Intergenic
1002639732 5:180625071-180625093 CACACCAGAGCCACAGCCAGTGG + Intronic
1002925226 6:1601947-1601969 AACCCCGGACGCAGAGCCAGAGG - Intergenic
1003412049 6:5874205-5874227 GACAACAGAGGCAGAGACTGAGG - Intergenic
1005266132 6:24114004-24114026 GACAACAGAGGCAGAGACTGGGG + Intergenic
1005352592 6:24950914-24950936 CACACAAGACCTAGATCCTGTGG - Intronic
1006001019 6:30965196-30965218 CACAGCAGTCTCAGAACCTGTGG - Intergenic
1006459333 6:34149308-34149330 CCCATCAGACACAGAGGCTGAGG - Intronic
1007152328 6:39705933-39705955 GCCACCAGAAGCAGATCCTGAGG - Intronic
1013353127 6:109323864-109323886 CACAACAGAGCCAGAGCCTCTGG - Intergenic
1017236215 6:152119819-152119841 CACGCCAGACGCAGATGATGGGG - Intronic
1019142956 6:169959852-169959874 CAATCCAGATGCAGGGCCTGTGG - Intergenic
1020071584 7:5230401-5230423 CACTCCAGTGGGAGAGCCTGTGG + Intronic
1020119100 7:5492745-5492767 CACAACAGAGGCAGAGACTGGGG + Intronic
1021539552 7:21742330-21742352 CTCACCAGAAGCAGATGCTGGGG - Intronic
1023703941 7:42919433-42919455 CAAACCCGAAGCAGAACCTGAGG + Intronic
1024310668 7:47966170-47966192 CACAGGAGAGGCAGAGACTGAGG + Intronic
1027263442 7:76480828-76480850 AACACCTGGCGCAGAGCCTGTGG - Intronic
1027314815 7:76978927-76978949 AACACCTGGCGCAGAGCCTGTGG - Intergenic
1027466391 7:78519853-78519875 CACAAAAGAAGCAGAGGCTGGGG - Intronic
1028257689 7:88620828-88620850 CACCCCAGACTCAGAAACTGTGG + Intergenic
1032012976 7:128359162-128359184 AACTCCAGAGGCAGAGCTTGTGG + Exonic
1032366511 7:131305070-131305092 CTCACCAGACACTGAACCTGCGG + Intronic
1033549363 7:142432644-142432666 CACACCACATGCAGGTCCTGTGG + Intergenic
1034368489 7:150572410-150572432 ACCACCAGAAGCAGAGCATGAGG - Exonic
1034694503 7:153041910-153041932 CACACCTGAACCAGTGCCTGTGG - Intergenic
1034987251 7:155523916-155523938 CACTACAGAGGCAGAGGCTGGGG + Intronic
1035179230 7:157077256-157077278 CTCATCAGAGGCAGAGCCTGTGG + Intergenic
1035406618 7:158602810-158602832 CACCCAACACACAGAGCCTGGGG + Intergenic
1037674551 8:21042530-21042552 CCCCCCAGACTCAGACCCTGGGG + Intergenic
1038442734 8:27583330-27583352 CACACCAGCAGCAGAGCCTGGGG + Intergenic
1044712312 8:95069937-95069959 CATACCAGATGCATAGGCTGGGG + Intronic
1045431957 8:102123331-102123353 CACACCAGCCGCCTCGCCTGCGG + Intronic
1049558034 8:143293289-143293311 CTTCCCAGAGGCAGAGCCTGGGG - Intronic
1049814026 8:144589760-144589782 CACACCAGAGGCAGAGTCGTGGG - Intronic
1050756464 9:9010389-9010411 CTCACCAGACACAGAGCAGGGGG - Intronic
1053433553 9:38059799-38059821 CACAGCAGAGGCAGAGCTGGTGG - Intronic
1053886980 9:42650920-42650942 GACACCAGAAGCAGAGCCCTAGG + Intergenic
1054226000 9:62458370-62458392 GACACCAGAAGCAGAGCCCTAGG + Intergenic
1054813230 9:69451316-69451338 TTCCCCAGAAGCAGAGCCTGAGG - Intronic
1056581327 9:87889534-87889556 GACACCAGACGCAAACCCAGGGG - Intergenic
1056973942 9:91233382-91233404 CACAGCAGGGGCAGATCCTGTGG + Intronic
1057087304 9:92223184-92223206 CACACCAAAAGAAAAGCCTGTGG + Intronic
1057394490 9:94667651-94667673 AACAGCAGAAGCACAGCCTGTGG + Intergenic
1057842188 9:98495183-98495205 CAGAGCAGATACAGAGCCTGCGG - Intronic
1061769361 9:132906086-132906108 CACAGCAGAGGCAGAGCCTGTGG - Exonic
1062637019 9:137496958-137496980 CCCCACAGAGGCAGAGCCTGGGG + Intronic
1185460580 X:331240-331262 CACACGCCACTCAGAGCCTGGGG - Intergenic
1196663725 X:118294792-118294814 CAGAGCAGACGCCGAGGCTGAGG + Intergenic
1199495033 X:148443372-148443394 CTCACCAGACGCTGAATCTGCGG - Intergenic
1201350918 Y:13040331-13040353 TCCACCAGAAGCAGATCCTGGGG - Intergenic
1201584392 Y:15544942-15544964 CACACCAGACTTAGTGCATGTGG - Intergenic
1201626262 Y:16018070-16018092 CTCACCAGACGCTGAATCTGAGG - Intergenic
1201677991 Y:16609257-16609279 CAAACCAGACACAGAGAATGAGG - Intergenic