ID: 1133125539

View in Genome Browser
Species Human (GRCh38)
Location 16:3643534-3643556
Sequence CACCCACTCCGCTCCGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133125539_1133125545 -5 Left 1133125539 16:3643534-3643556 CCCACCACGGAGCGGAGTGGGTG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1133125545 16:3643552-3643574 GGGTGAGCTGTCCCTGTCGGGGG 0: 1
1: 0
2: 0
3: 18
4: 152
1133125539_1133125544 -6 Left 1133125539 16:3643534-3643556 CCCACCACGGAGCGGAGTGGGTG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1133125544 16:3643551-3643573 TGGGTGAGCTGTCCCTGTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 135
1133125539_1133125543 -7 Left 1133125539 16:3643534-3643556 CCCACCACGGAGCGGAGTGGGTG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1133125543 16:3643550-3643572 GTGGGTGAGCTGTCCCTGTCGGG 0: 1
1: 0
2: 1
3: 12
4: 159
1133125539_1133125542 -8 Left 1133125539 16:3643534-3643556 CCCACCACGGAGCGGAGTGGGTG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1133125542 16:3643549-3643571 AGTGGGTGAGCTGTCCCTGTCGG 0: 1
1: 0
2: 10
3: 36
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133125539 Original CRISPR CACCCACTCCGCTCCGTGGT GGG (reversed) Intronic
900137473 1:1124463-1124485 CACCCAGTCCGCTCACTGCTTGG + Intergenic
902261278 1:15226597-15226619 CATCCACTCCTCTTCATGGTGGG - Intergenic
902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG + Intronic
904738228 1:32651338-32651360 CACCCACTGCCCTCCTGGGTCGG - Intronic
905967869 1:42114429-42114451 CACCCACCCTGCTCCAGGGTGGG - Intergenic
913070620 1:115295178-115295200 CTCCAACTCCTCTTCGTGGTTGG - Intronic
915168693 1:153963100-153963122 CACCCACTCCGTTCGGGAGTTGG - Exonic
919784127 1:201248037-201248059 AACCCAATACCCTCCGTGGTAGG + Intergenic
1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG + Intergenic
1078840452 11:15072612-15072634 CACCTGCTCCCCTCCGTGGGTGG + Intronic
1091696815 12:2633329-2633351 CACCCACTCCTGCCCCTGGTGGG + Intronic
1113643707 13:111976683-111976705 CACCCAGGCCGCGCCCTGGTTGG - Intergenic
1113807350 13:113117618-113117640 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807360 13:113117655-113117677 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807371 13:113117692-113117714 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807382 13:113117729-113117751 CACCCACCCAGCACCGCGGTCGG - Intronic
1115401747 14:32969315-32969337 CACCCACACCGCACCAGGGTTGG - Intronic
1127359106 15:58229394-58229416 CCCCCACCCCCCTCCCTGGTAGG - Intronic
1129001755 15:72341404-72341426 CAACCTCTCCTCTCCTTGGTAGG - Exonic
1129115105 15:73361256-73361278 CACCCACTCGGATCTGAGGTGGG - Intronic
1132798806 16:1741411-1741433 CACCCACACAGCTCCATGCTGGG - Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1144053005 17:11514124-11514146 CACCCTCTCCTCTTCGTGGACGG + Intronic
1147149316 17:38504914-38504936 CAGTCTCTCAGCTCCGTGGTGGG + Intronic
1149634721 17:58157325-58157347 CATCCACGCCGCTCCGTCTTAGG - Intergenic
1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG + Exonic
1151676528 17:75601631-75601653 CACCCACTCCTCTCCGCTGTCGG - Intergenic
1154122569 18:11663765-11663787 CACCCACTCTGCTCTGTGCCTGG - Intergenic
1163668087 19:18612448-18612470 CTCCCTCTCCGTTCCCTGGTTGG + Intronic
1167524865 19:49977361-49977383 CACTCACTCAGCCCCTTGGTTGG - Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
930124215 2:47783486-47783508 CCCCCACCCCGCTACCTGGTGGG - Exonic
936433976 2:112487261-112487283 TACCCACTCCTCTCTGTGATGGG + Intronic
942218797 2:173748977-173748999 CACCCTCTCTGCTCCGAGCTTGG + Intergenic
949055758 2:241927599-241927621 CTCCCACTCCTCACAGTGGTGGG + Intergenic
949057651 2:241937156-241937178 CTCCCACTCCGGCCCGTGGAAGG - Intergenic
1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG + Exonic
1171254577 20:23679755-23679777 CACCCTCTCCACTCCATGCTGGG - Intergenic
1171261063 20:23735027-23735049 CACCCTCTCCACTCCATGCTGGG - Intergenic
1171270182 20:23810869-23810891 CACCCTCTCCACTCCATGCTAGG - Intergenic
1178117428 21:29431804-29431826 TAACCACTCAGCTCCGTGGTAGG - Intronic
1181438923 22:22925653-22925675 CACCTACTGCGCTCGGTGCTGGG - Intergenic
1182362042 22:29752374-29752396 CACCCCCTCCACTCCATGGGGGG + Intronic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
957309127 3:78496867-78496889 CACCCACTCCTTTCCGTCGATGG - Intergenic
959468539 3:106720672-106720694 CTCCCACTCGGCCCAGTGGTGGG + Intergenic
961603732 3:128078521-128078543 CACCCAATCAGCTCCCTGGGTGG + Intronic
966850257 3:184160571-184160593 CAGCCATTCAGCTCCATGGTGGG + Intronic
975828129 4:78341002-78341024 CACCCACTCCCTTCTGTTGTGGG - Intronic
981576511 4:146211675-146211697 CACCGCCTCCTCTCCGTGGTGGG + Intergenic
984852057 4:184162934-184162956 CACCCACTCCGCTCCCCGAGTGG + Intronic
993019664 5:82576644-82576666 CTCCCACTCCCCTCCATGGGAGG - Intergenic
1001761897 5:174214372-174214394 CACCCACACAGCTCCCTGGGAGG - Intronic
1003968999 6:11280477-11280499 CACCCAGTCCTCCCCATGGTGGG - Intronic
1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG + Intronic
1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG + Intergenic
1009526343 6:64751254-64751276 CACCAACTCCTCTGCGTGGGAGG - Intronic
1013393149 6:109706917-109706939 CCCCCTCTCCTCTCAGTGGTGGG + Intronic
1017525741 6:155240127-155240149 CACCCAGTCCCCTCAATGGTTGG - Intronic
1032419166 7:131764241-131764263 CACCCACTGTGCTCCCTGGCTGG - Intergenic
1032462570 7:132122726-132122748 CACCCACGCCGCTCAGAGGTGGG - Intergenic
1041621006 8:59969424-59969446 CAGTCACTCCTCTCCATGGTAGG + Intergenic
1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG + Intronic
1061488560 9:130933044-130933066 CACCCAAGCCCCTCCCTGGTGGG + Intronic
1185934198 X:4237210-4237232 CACCCACTCTGCTCCTTGGAGGG - Intergenic
1189064816 X:37796126-37796148 CACTCACTCAGCTCCATGGATGG - Exonic
1194793508 X:98181000-98181022 GACTCACTCAGCTCCGTGATGGG + Intergenic