ID: 1133125542

View in Genome Browser
Species Human (GRCh38)
Location 16:3643549-3643571
Sequence AGTGGGTGAGCTGTCCCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 10, 3: 36, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133125539_1133125542 -8 Left 1133125539 16:3643534-3643556 CCCACCACGGAGCGGAGTGGGTG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1133125542 16:3643549-3643571 AGTGGGTGAGCTGTCCCTGTCGG 0: 1
1: 0
2: 10
3: 36
4: 165
1133125534_1133125542 15 Left 1133125534 16:3643511-3643533 CCTGATTCACTGTCTCACTGCTG 0: 1
1: 0
2: 0
3: 22
4: 321
Right 1133125542 16:3643549-3643571 AGTGGGTGAGCTGTCCCTGTCGG 0: 1
1: 0
2: 10
3: 36
4: 165
1133125540_1133125542 -9 Left 1133125540 16:3643535-3643557 CCACCACGGAGCGGAGTGGGTGA 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1133125542 16:3643549-3643571 AGTGGGTGAGCTGTCCCTGTCGG 0: 1
1: 0
2: 10
3: 36
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133125542 Original CRISPR AGTGGGTGAGCTGTCCCTGT CGG Intronic
900567171 1:3339236-3339258 GGTGGGTGAGCTGTCTCCCTCGG - Intronic
900624082 1:3600271-3600293 TGTGGCAGAGCTGTCCCTGTGGG + Intronic
901217989 1:7565386-7565408 CCTGGGTCAGCTGTCCCAGTAGG - Intronic
902234186 1:15047291-15047313 AGTGGGGGAGCTGGGCCTGCAGG - Intronic
902667657 1:17950921-17950943 CGTGGGGGAGCTGTGCGTGTGGG + Intergenic
903476249 1:23620859-23620881 AGTGGGTGAGTTGTCCTGGGAGG - Intronic
903735844 1:25529656-25529678 AGTGGGTGAGGTGTGCCAGCAGG - Intergenic
904483488 1:30808426-30808448 GCTTGGTGAGCTGTCACTGTGGG + Intergenic
905195371 1:36272227-36272249 AGTGGGGGTGATGTCCCTCTGGG - Intronic
906584691 1:46965916-46965938 ACTGAGTGAGATCTCCCTGTGGG - Intergenic
907314957 1:53562459-53562481 GGTGGGTGAGCTGTGGGTGTGGG - Intronic
907556463 1:55348631-55348653 AGGGGGAGAGCTCTCTCTGTGGG + Intergenic
912229690 1:107777607-107777629 AGTGGGTGAGGTGACCCTGCAGG - Intronic
912278774 1:108290463-108290485 AGTGGGGGTGGTGTCCCAGTGGG + Intergenic
912289452 1:108403894-108403916 AGTGGGGGTGGTGTCCCAGTGGG - Intronic
912734186 1:112135489-112135511 AGAGGGTTAGCTGGCCCTCTGGG - Intergenic
913350266 1:117850624-117850646 TGTAGGTGAGCTTTACCTGTGGG + Intergenic
914404627 1:147358396-147358418 ACTGGGTGGGGTGTCCCTGCAGG + Intergenic
918059424 1:181048704-181048726 ACAGGGGGAGCTGTCCCTGCGGG - Intronic
919657695 1:200213821-200213843 AGTGGAAGAGCAGCCCCTGTGGG + Intergenic
919932444 1:202230118-202230140 AGAGGCTGGGCTCTCCCTGTGGG + Intronic
920208497 1:204311142-204311164 AGTGAGTGTGCTGTCTCTGCAGG - Intronic
924277485 1:242403392-242403414 AGATGGAGAGCTGCCCCTGTAGG - Intronic
1066046465 10:31599737-31599759 ACTGGCTGAGTTGACCCTGTAGG - Intergenic
1066779341 10:38927171-38927193 AGTGTGGGGGCTGTCCATGTGGG - Intergenic
1068126866 10:52851330-52851352 AGTGGGTGGGGTTTCCCTGCAGG - Intergenic
1069626513 10:69871214-69871236 AGTGCCTGGGCTGTCCTTGTGGG + Intronic
1069746327 10:70717256-70717278 AGAGGGGGTGCTGTCCCTGTGGG + Intronic
1069892297 10:71659440-71659462 AGAGGTTGAGCTGGCTCTGTGGG + Intronic
1072604037 10:96962917-96962939 AGTGTGTAAACTGTCCCTGAGGG - Intronic
1072716005 10:97753067-97753089 AGAGGATGAGCTGGCCCTGCAGG + Exonic
1076204239 10:128582273-128582295 ACTGGGGGAGCTGTGCCTGCAGG - Intergenic
1077444183 11:2582665-2582687 ACAGGGTGAGCTGTGCCTGAGGG + Intronic
1081664798 11:44910448-44910470 AGTGGGTGAGCTGGCCCAGATGG + Intronic
1083655880 11:64229430-64229452 AGTGGGTGACCAGCCCCTGCGGG - Intronic
1084642449 11:70434027-70434049 GGAGGGTGGGGTGTCCCTGTGGG - Intronic
1085524511 11:77156603-77156625 AGTTGGTGGGGAGTCCCTGTGGG + Intronic
1085740681 11:79075932-79075954 AGATGGTGAGCTGTCACTGGAGG - Intronic
1087219220 11:95527807-95527829 AGTGAGTGTGCTGTCATTGTAGG - Intergenic
1088977194 11:114826261-114826283 AGTGGGTGAGATCTCCCAGCTGG - Intergenic
1089788692 11:120926564-120926586 AGTGGCTGAGCTGGCCCTAGAGG + Intronic
1089812054 11:121140373-121140395 AGTGGGTTAGCTCTCCCTCCAGG + Intronic
1090423346 11:126590695-126590717 AGGGCTTGAGCTGTGCCTGTGGG + Intronic
1095977742 12:47951360-47951382 ACTGGGGGAGCTGTGCCTGAGGG - Intergenic
1096016515 12:48280966-48280988 AGTCACTGAGCAGTCCCTGTAGG - Intergenic
1102197806 12:111036727-111036749 AGTGGAGGGGGTGTCCCTGTGGG + Intronic
1102425902 12:112844203-112844225 AGGGGATGAGCTGTCACTCTTGG + Intronic
1103133223 12:118486451-118486473 AATGGGGAAGGTGTCCCTGTTGG + Intergenic
1104903852 12:132203322-132203344 AGTGGGTGAGCTGTCTGCCTGGG - Intronic
1106210731 13:27641999-27642021 AGAGGGTGAGATGTCACAGTGGG - Intronic
1107692997 13:42970914-42970936 AGTTGGTGTACTGTCCTTGTAGG + Intronic
1107876354 13:44794071-44794093 AGAGGGTGAGCTGTCTGTGAAGG - Intergenic
1108444470 13:50493607-50493629 AGTGGGTGAGCTGGCCACTTAGG + Intronic
1109195599 13:59374883-59374905 TGTGGTTCAACTGTCCCTGTAGG + Intergenic
1111909700 13:94297141-94297163 CCTGGGTGAGTTGCCCCTGTGGG + Intronic
1112979572 13:105365858-105365880 AGTGTGTGAGCTGTTGGTGTAGG + Intergenic
1118045313 14:61963782-61963804 AAAGGGCGAGCTGGCCCTGTTGG + Intergenic
1118603682 14:67488088-67488110 AGTGGCTGGGCTGTCCCAGAGGG - Intronic
1119544452 14:75461526-75461548 AGCGGGTGAGCTGACCGGGTGGG + Exonic
1121124210 14:91395597-91395619 AGTGGGTGAGCCAGCTCTGTGGG - Intronic
1121313816 14:92949456-92949478 AGTGGCTGAGCTGCCCCACTAGG - Intronic
1122281207 14:100623487-100623509 AGTAGGTCTGCTGTCCTTGTTGG - Intergenic
1122772165 14:104102384-104102406 TGTGGGTGACATCTCCCTGTGGG + Intronic
1122788807 14:104175896-104175918 GGTGGAGGAGCTGTCCCTGGGGG + Exonic
1124141300 15:27079506-27079528 AGTGGGTGAGATTTCACTGCAGG + Intronic
1124923457 15:34048216-34048238 ACTGGGTGGGATCTCCCTGTGGG + Intronic
1125604629 15:40932887-40932909 TGTGGGTGAGCTGGGCCTCTGGG + Intronic
1128356811 15:66933882-66933904 AGAGGGTGATGTGTCCCTGAGGG - Intergenic
1129675386 15:77630445-77630467 GGTGGGGGAGGTGTCCCTCTGGG + Intronic
1131248807 15:90817838-90817860 AGTGGGTTCTCTGTCCCTGGAGG - Intergenic
1131861886 15:96662424-96662446 ATTGGTTGAGATGTTCCTGTGGG + Intergenic
1132291914 15:100709915-100709937 AGTAGGTGACCTGACCCAGTAGG + Intergenic
1132649558 16:1014346-1014368 AGTGGGTGAGCTGTGTCTGTGGG + Intergenic
1133125542 16:3643549-3643571 AGTGGGTGAGCTGTCCCTGTCGG + Intronic
1136227985 16:28871917-28871939 AGGGGATGAACTGTCCCTGTTGG - Exonic
1136612835 16:31377697-31377719 AGTAGGTGAGCCCTGCCTGTGGG - Intronic
1136672425 16:31870544-31870566 AGTGAGTGAGCAGTCCCTGGTGG + Intergenic
1138270676 16:55693767-55693789 CGTGAGTGAGCTCACCCTGTAGG - Intronic
1138414310 16:56862594-56862616 AATGGGAGAGGTGTCCCTGGAGG - Intergenic
1138425814 16:56931632-56931654 AGTGGGTAGGCTTCCCCTGTAGG + Intergenic
1141524517 16:84603235-84603257 AGTGAGTCAGCTGTCCCCGTGGG - Intronic
1142501235 17:334561-334583 AGTGGATGGGCTGGCCCTGGGGG - Intronic
1142501295 17:334752-334774 AGTGGATGGGCTGGCCCTGGGGG - Intronic
1142501325 17:334848-334870 AGTGGATGGGCTGGCCCTGGGGG - Intronic
1145755142 17:27384814-27384836 ATTGGGTGAGCTGGCCCTCCAGG + Intergenic
1147375357 17:40019686-40019708 GGTGGGTGTGCTGTCCCAGGGGG + Intronic
1148680164 17:49469173-49469195 AGTGAGTTAGAGGTCCCTGTGGG + Intronic
1149755034 17:59179529-59179551 AGTGGGTGAGCTCTCCATGCGGG - Intronic
1149755325 17:59181390-59181412 AGTGGGTGAGCTCTCCATGCGGG - Intronic
1151493108 17:74444196-74444218 GCTGGGTGAGCTCTCCCTGGTGG + Intronic
1152173981 17:78774557-78774579 AGTTGCTGAGCTGCCTCTGTAGG + Intronic
1152179984 17:78813437-78813459 TGTGGGGAAGCTGCCCCTGTAGG - Intronic
1152724993 17:81940795-81940817 GGTGGGTGGGCTGCCACTGTGGG + Exonic
1154226608 18:12510724-12510746 AGTGGGATAGCTGGCCATGTTGG + Intronic
1157623730 18:49031400-49031422 AGTGGGTCCACTGTCCCTGAAGG - Intergenic
1160001725 18:75030867-75030889 AGTGGGTGAGTTGTCACGTTTGG - Intronic
1160751493 19:736483-736505 AGTGGGTGCCCCGTCCCTGGAGG + Intronic
1160891295 19:1380024-1380046 AGTGGCACAGCTGTGCCTGTCGG + Intergenic
1161277770 19:3428493-3428515 AGTGGGTGAGGCGTCCTTCTTGG + Intronic
1161515422 19:4693619-4693641 AGTGGCTGAGCTGTCCTGGTGGG - Intronic
1162761564 19:12891660-12891682 AGTGAGTGCGCTGTGCCTGCGGG + Intronic
1166364267 19:42270545-42270567 AGTGGGTGAGGTTGGCCTGTTGG + Intronic
925330425 2:3054299-3054321 AGTGGGGAAACTGTCGCTGTGGG + Intergenic
926216529 2:10909044-10909066 AGTGCGTGAGCTGAGCCTGGAGG - Intergenic
926400747 2:12493449-12493471 CATGGGTGAGCTGTCCCTACAGG - Intergenic
926748549 2:16180234-16180256 AGTGTGTTTGCTGTTCCTGTAGG + Intergenic
928719190 2:34099624-34099646 AGTGGGTGAGAGGTCTCTGTTGG - Intergenic
929031902 2:37657196-37657218 GGTGGGAGAGCTTTCCATGTAGG - Intronic
929457242 2:42074693-42074715 AATGGGTCAGCTGTCTCTGGTGG + Intergenic
930707081 2:54515397-54515419 AGTGGGTGAGGTGAAACTGTTGG + Intronic
936791705 2:116160033-116160055 AGTGGGTGAGCTCCCCTGGTGGG + Intergenic
937862562 2:126722490-126722512 AGAAGGTGAGCTGATCCTGTGGG - Intergenic
937895929 2:126976793-126976815 AGAGGGGGAGCTGCCCCTGCTGG + Intergenic
938086340 2:128404599-128404621 AGTGGGTGAGCTGACCCATTGGG + Intergenic
940298952 2:152159615-152159637 AGTGGGTGAGCTCTCCATGCGGG - Intronic
942756847 2:179351386-179351408 TGTGAGTGAGCTTTTCCTGTGGG + Intergenic
945255156 2:207797130-207797152 AGGGTGTGAGCTCACCCTGTAGG - Intergenic
946370935 2:219280823-219280845 AGACACTGAGCTGTCCCTGTGGG - Intronic
947061448 2:226171154-226171176 AGTGGCTGAGCTGAGTCTGTAGG + Intergenic
948865742 2:240773910-240773932 ACTGGGAGAGCTGTGCCTGCTGG - Intronic
948951155 2:241252725-241252747 AGTGGGTGAATTGTCACTTTTGG - Intronic
949043611 2:241860319-241860341 AGTGGCTAAGCTGCCCCTGCTGG + Intergenic
1169115735 20:3064464-3064486 AGTGGGTAAGGTGAACCTGTTGG - Intergenic
1172779010 20:37424771-37424793 AGGGGGTGATCTGTCACAGTTGG + Intergenic
1174447182 20:50598006-50598028 AGTGAGTGAGCTGCCCCAGCGGG + Intronic
1176306071 21:5123765-5123787 GGTGGCAGAGCTGTCCCTGGAGG + Intronic
1179850986 21:44138266-44138288 GGTGGCAGAGCTGTCCCTGGAGG - Intronic
1181042174 22:20197346-20197368 CCTGGGTGGGCTGTCCCTGGCGG + Intergenic
1181526719 22:23493730-23493752 CCTGGGTGAGCTGGCCCTGCTGG - Intergenic
1182351443 22:29702332-29702354 TGAGGCTGGGCTGTCCCTGTCGG - Intergenic
952931724 3:38365794-38365816 AGTGGGTGACCTGCCTCTGGGGG + Intronic
953912599 3:46900461-46900483 TTTGGGTGAGCTGTGCCTCTGGG - Intronic
954457225 3:50606353-50606375 TGTGGCTGAGCAGTCCCTGCTGG - Intergenic
957361720 3:79168202-79168224 ATTGGGTAAACTGTCACTGTTGG - Intronic
960967278 3:123114090-123114112 AGTCGGCCAGTTGTCCCTGTGGG - Intronic
962362135 3:134751563-134751585 AATGGCTGTGCTGTCACTGTTGG + Intronic
966239560 3:177741199-177741221 GCTGGGTGAGTTGGCCCTGTGGG - Intergenic
967574813 3:191077290-191077312 ACTGGGTGAGCCCTCCCAGTTGG + Intergenic
968576512 4:1368788-1368810 AGATGATGAGCTGTCCCTGCTGG + Intronic
971571805 4:28222098-28222120 AGTGTCTGAGCTGTCTCTTTAGG - Intergenic
975097291 4:70471888-70471910 AGTGGATGATCTGTTCCTGTTGG + Intronic
975763601 4:77642420-77642442 ATTGGCTGAGCAGTCCCTCTGGG + Intergenic
977732945 4:100377416-100377438 TGTGGATGGTCTGTCCCTGTGGG - Intergenic
980512515 4:133812520-133812542 AGTGGGTGGAGTCTCCCTGTGGG + Intergenic
981751578 4:148097426-148097448 AGCTGCTGAGCTGCCCCTGTAGG + Intronic
984804548 4:183739121-183739143 ATTTGCTGAGCTGTCGCTGTGGG - Intergenic
986149024 5:5109961-5109983 GGTGGGGGCTCTGTCCCTGTCGG + Intergenic
991450323 5:66744160-66744182 AGAGGGTGAGATGTCTCTGGGGG - Intronic
992796178 5:80256473-80256495 CGTGGGTGGGCTGTCCCAGTCGG - Intergenic
1002094393 5:176822634-176822656 AGCAGGTGGGCTGTCCTTGTTGG - Intronic
1003116560 6:3287453-3287475 AGTGGGTGTGCAGTGGCTGTTGG - Intronic
1004001670 6:11602061-11602083 AGTGGGCAGGCTGTCCCTGCAGG + Intergenic
1006337018 6:33426093-33426115 TGTGGGTGAGAGGCCCCTGTGGG + Intronic
1009600717 6:65794269-65794291 AATGGGAAAGCTGTCTCTGTGGG + Intergenic
1020045332 7:5036364-5036386 AGTGGGTGAGCTCTCCATGCGGG - Intronic
1020290731 7:6720603-6720625 ATTGGGTGAGCTCTCCATGTGGG - Intergenic
1021956458 7:25830059-25830081 AGTGGGTCATGTGTCCCCGTGGG - Intergenic
1023824984 7:44002914-44002936 AGTGGGTGAGCTCTCCATGTGGG + Intronic
1024568574 7:50705231-50705253 TGTGGGTGAGCTGACCCTGCTGG - Intronic
1024627997 7:51224912-51224934 TGTGGGTGACCTGTGCGTGTGGG + Intronic
1026088288 7:67280134-67280156 AGTGGGTGAGCTCTCCACGCAGG + Intergenic
1026088534 7:67281701-67281723 AGTGGGTGAGCTCTCCATGTGGG + Intergenic
1026725719 7:72868651-72868673 AGTGGGTGAGCTCTCCATGTGGG - Intergenic
1026725967 7:72870193-72870215 AGTGGGTGAGCTCTCCATGCAGG - Intergenic
1026747798 7:73026518-73026540 AGTGGGTGAGCTCTCCATGCGGG - Intergenic
1026751448 7:73054657-73054679 AGTGGGTGAGCTCTCCATGCGGG - Intergenic
1026755097 7:73082771-73082793 AGTGGGTGAGCTCTCCATGCGGG - Intergenic
1026758747 7:73110805-73110827 AGTGGGTGAGCTCTCCATGCGGG - Intergenic
1027034004 7:74911812-74911834 AGTGGGTGAGCTCTCCATGCGGG - Intergenic
1027088659 7:75282681-75282703 AGTGGGTGAGCTCTCCATGCGGG + Intergenic
1027092302 7:75310609-75310631 AGTGGGTGAGCTCTCCATGCGGG + Intergenic
1027095945 7:75338576-75338598 AGTGGGTGAGCTCTCCATGCGGG + Intergenic
1027118134 7:75497001-75497023 AGTGGGTGAGCTCTCCATGTGGG + Intergenic
1027273670 7:76538467-76538489 AGTGGGTGAGCTCTCCATGTGGG - Intergenic
1027273918 7:76540008-76540030 AGTGGGTGAGCTCTCCACGCAGG - Intergenic
1027323396 7:77029116-77029138 AGTGGGTGAGCTCTCCATGCGGG - Intergenic
1027327119 7:77057518-77057540 AGTGGGTGAGCTCTCCATGTGGG - Intergenic
1027327364 7:77059060-77059082 AGTGGGTGAGCTCTCCACGCAGG - Intergenic
1028535405 7:91886145-91886167 AATGAGTGAGTTGTCCCTCTTGG - Intergenic
1029396044 7:100309289-100309311 AGTGGGTGAGCTCTCCATGCGGG + Intronic
1029396267 7:100310675-100310697 AGTGGGTGAGCTCTCCATGCGGG + Intronic
1029396492 7:100312065-100312087 AGTGGGTGAGCTCTCCATGCGGG + Intronic
1029396717 7:100313455-100313477 AGTGGGTGAGCTCTCCATGCGGG + Intronic
1029396942 7:100314847-100314869 AGTGGGTGAGCTCTCCATGCGGG + Intronic
1029479275 7:100803081-100803103 AGTGGGGGGGCTGTCCCAGGGGG - Exonic
1029719367 7:102353039-102353061 AGTGGGTGAGCTCTCCATGTGGG - Intergenic
1029753247 7:102556227-102556249 AGTGGGTGAGCTCTCCATGTGGG + Intronic
1029771199 7:102655311-102655333 AGTGGGTGAGCTCTCCATGTGGG + Intronic
1030528111 7:110677872-110677894 AATGGGTGAGCTTTCTTTGTGGG + Intronic
1033481269 7:141743384-141743406 TGAGGGTGAGGTGTCCCTATAGG - Intronic
1033598995 7:142875787-142875809 AGGGGATGAGCAGTCCCTGCTGG - Exonic
1034902066 7:154914052-154914074 AGTGGGTCCGCAGTCCCTCTCGG - Intergenic
1036006609 8:4671921-4671943 AGTGGGTCAGCTTTCTCAGTAGG + Intronic
1043668141 8:82844485-82844507 AGTGGGGGAGGTGAACCTGTTGG - Intergenic
1048755031 8:137728887-137728909 TGTAGGGGAGCTTTCCCTGTGGG - Intergenic
1050606220 9:7304042-7304064 AATGGCTGAGCAGTCCCTGGGGG + Intergenic
1053308263 9:36999370-36999392 AGTGGGTGAGGTGACACTGGGGG - Intronic
1054704852 9:68452130-68452152 GGTTGGTGAGCAGTCCCTTTAGG - Intronic
1056826975 9:89883241-89883263 AGTGTGTGTGCTGTCAGTGTGGG - Intergenic
1056927361 9:90846282-90846304 AGTGGGGCAGTTGTCCCTGGGGG + Intronic
1059746193 9:117204068-117204090 AGTGGGTGGGGCTTCCCTGTAGG - Intronic
1061259890 9:129474436-129474458 CCTGGGTGAGCTGGCCCTGCTGG + Intergenic
1061595270 9:131624822-131624844 AGAGGGAGAGCTGGCTCTGTGGG - Intronic
1061906962 9:133703857-133703879 AGTGGGTGGGATGTCCCTGCTGG - Intronic
1189107146 X:38248822-38248844 AGTGAGTGGGCTCTCCCTGATGG + Intronic
1190566231 X:51732682-51732704 ACTGGGTGAGTTGGCCCTCTGGG + Intergenic
1194140454 X:90202766-90202788 AGTGGTTGTGCTGTCCCAGTTGG - Intergenic
1194744043 X:97609062-97609084 AGTGTGTGAGCTATCCTTTTCGG - Intergenic
1195587957 X:106587585-106587607 GGTGAGTGAGTTTTCCCTGTGGG - Intergenic
1197023142 X:121715902-121715924 ACTGGGTGAGCCCTCCCTGCAGG - Intergenic
1200486199 Y:3771734-3771756 AGTGGTTGTGCTGTCCCAGTTGG - Intergenic
1200510183 Y:4067946-4067968 AATGAGTGAGCTGTCACTCTAGG - Intergenic