ID: 1133125543

View in Genome Browser
Species Human (GRCh38)
Location 16:3643550-3643572
Sequence GTGGGTGAGCTGTCCCTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133125534_1133125543 16 Left 1133125534 16:3643511-3643533 CCTGATTCACTGTCTCACTGCTG 0: 1
1: 0
2: 0
3: 22
4: 321
Right 1133125543 16:3643550-3643572 GTGGGTGAGCTGTCCCTGTCGGG 0: 1
1: 0
2: 1
3: 12
4: 159
1133125540_1133125543 -8 Left 1133125540 16:3643535-3643557 CCACCACGGAGCGGAGTGGGTGA 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1133125543 16:3643550-3643572 GTGGGTGAGCTGTCCCTGTCGGG 0: 1
1: 0
2: 1
3: 12
4: 159
1133125539_1133125543 -7 Left 1133125539 16:3643534-3643556 CCCACCACGGAGCGGAGTGGGTG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1133125543 16:3643550-3643572 GTGGGTGAGCTGTCCCTGTCGGG 0: 1
1: 0
2: 1
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133125543 Original CRISPR GTGGGTGAGCTGTCCCTGTC GGG Intronic
900188309 1:1343066-1343088 TTGGCTGAGCTGCCCCTGTGAGG - Intronic
900567170 1:3339235-3339257 GTGGGTGAGCTGTCTCCCTCGGG - Intronic
900658002 1:3769668-3769690 GAGGGTGAGCTGTTCCTTCCTGG + Intronic
904483489 1:30808427-30808449 CTTGGTGAGCTGTCACTGTGGGG + Intergenic
905392898 1:37649505-37649527 GTGGCAGAGCTGGGCCTGTCTGG - Intergenic
907282952 1:53362797-53362819 GTGTGTGATCTGGCCCTGTAAGG - Intergenic
909384305 1:75037376-75037398 TTGGGAGATCTCTCCCTGTCAGG - Intergenic
912469241 1:109895264-109895286 GTGGGTGAGGTGTCCCTCCCAGG + Intergenic
915625298 1:157110783-157110805 GGGGTGGAGCTGTCTCTGTCTGG + Intergenic
917728311 1:177848777-177848799 AGAGGTGAGCTGTCCCTGCCAGG - Intergenic
920294200 1:204945943-204945965 GTGGGTGAGGGGTCCCTGCAAGG + Intronic
920374562 1:205500923-205500945 TTGGCTGAACTCTCCCTGTCTGG + Intergenic
1065854306 10:29817112-29817134 TTGGGTTAGCTGTCCCTGGTTGG + Intergenic
1067206365 10:44217786-44217808 GTGGGAGAGCCATACCTGTCTGG + Intergenic
1069746328 10:70717257-70717279 GAGGGGGTGCTGTCCCTGTGGGG + Intronic
1070579668 10:77710212-77710234 TGGGGTGAGCTGTGCCTGGCTGG - Intergenic
1071386066 10:85122552-85122574 GTGGGTAAGTAGTCCCAGTCTGG + Intergenic
1073586710 10:104717445-104717467 GTGGGTGAGCTCTAGGTGTCCGG - Intronic
1075708231 10:124515769-124515791 GTGAGTGAGCTTTCCCAGCCTGG + Intronic
1076076742 10:127539241-127539263 GAGGCTGTGCTGTCCCTGGCAGG + Intergenic
1076881580 10:133242084-133242106 GGGGCTGAGCTGTGCCTGTTCGG + Intergenic
1076883611 10:133251580-133251602 GTGTGTGGGGTGTGCCTGTCGGG - Intergenic
1077172935 11:1176435-1176457 GTGGGTGAGCTGTCCCTGGGAGG + Intronic
1077308768 11:1879415-1879437 TTGGGTGAGCCGACCCTGTAAGG + Intronic
1077417695 11:2432535-2432557 GAGCGTGAGCCGTCCCTGACCGG + Intergenic
1083400947 11:62423235-62423257 GTGGGGGGTCTGCCCCTGTCAGG + Intergenic
1085252511 11:75152928-75152950 GAGGGGAAGCTGTCCCAGTCAGG + Intronic
1088169582 11:106980272-106980294 GTGGGAGCCCTGTCCCTGGCTGG - Intronic
1089090845 11:115873512-115873534 GAGGGAGAGCAGTCCCTTTCAGG + Intergenic
1095681516 12:44981800-44981822 GTTGGGGAGCTATCCCTCTCCGG - Intergenic
1096576495 12:52556203-52556225 GTGGGTGAGATGTCCTTGGCTGG - Intergenic
1098575984 12:72042974-72042996 GTGGGTCAGCTGTCCATTCCTGG + Intronic
1101631344 12:106498111-106498133 GTGGGTGAGAAGGCCCTGTGAGG + Intronic
1101758924 12:107643449-107643471 CTGGGTGAGCTGTCCCCCTGAGG + Intronic
1102064384 12:109961430-109961452 GTGCGTGAGCTGTGCCTCCCAGG - Intronic
1103943168 12:124511805-124511827 GTGGGGGAACTGGCCCTGGCGGG - Intronic
1108167658 13:47709940-47709962 GTGGGTGGGCTGTACCTGGGCGG - Intergenic
1109195600 13:59374884-59374906 GTGGTTCAACTGTCCCTGTAGGG + Intergenic
1112024155 13:95397217-95397239 CTGAGTGAGCAGTCCCTCTCTGG + Intergenic
1112458466 13:99582928-99582950 GTGGAGGAGCAGTCCTTGTCTGG - Intergenic
1113081515 13:106525439-106525461 GTGGCTTAGCTGTTCCTGTGAGG + Intronic
1114551459 14:23534931-23534953 GTGGCCAAGCTGTCCCTGCCAGG - Exonic
1115564478 14:34613216-34613238 GAGGGAGAGCTGGCCCTGCCAGG + Intronic
1121119434 14:91366882-91366904 GTGGTTGAGATGGCCCTGGCAGG - Intronic
1122791758 14:104186871-104186893 GTGGCTGACATGTCCCTGCCAGG + Intergenic
1124218379 15:27828243-27828265 CTTGGCCAGCTGTCCCTGTCGGG + Intronic
1128355932 15:66926595-66926617 GTGGGTGAAGTGACTCTGTCTGG - Intergenic
1128697871 15:69781894-69781916 ATGGGGGAACTGGCCCTGTCAGG - Intergenic
1132069960 15:98767764-98767786 GTGGGTATGGTGTCCCTGGCAGG + Intronic
1132149843 15:99451675-99451697 GAGGGTGAGATGTCCCTCTCTGG - Intergenic
1132649559 16:1014347-1014369 GTGGGTGAGCTGTGTCTGTGGGG + Intergenic
1132843610 16:1990198-1990220 CTGGGTGAGTGGTCCCTGCCCGG + Exonic
1132981173 16:2739343-2739365 GTGGCTGAGCTGTGCCTGTGAGG - Intergenic
1133125543 16:3643550-3643572 GTGGGTGAGCTGTCCCTGTCGGG + Intronic
1133233380 16:4376760-4376782 GTGGGTGAGCTGTCCCTTGGCGG - Intronic
1133382099 16:5339831-5339853 GTGGGAGAGCTTTCCCAGCCCGG + Intergenic
1135099811 16:19595632-19595654 GTGAGTGAGCTGTCTGGGTCTGG - Intronic
1135811034 16:25586981-25587003 GAGGGGGAGGTGTGCCTGTCTGG - Intergenic
1136227984 16:28871916-28871938 GGGGATGAACTGTCCCTGTTGGG - Exonic
1136624308 16:31452591-31452613 GTGGGTGACCTCTCCCAGGCTGG - Intergenic
1138105417 16:54285066-54285088 GAGCCTGAGCTGTCCCTGGCTGG - Exonic
1139947325 16:70650226-70650248 GGGGCTGTGCTGTCCCTGCCTGG + Intronic
1140661464 16:77194041-77194063 GTGGTTGAGCTGTGTCTTTCTGG + Intronic
1140897607 16:79338846-79338868 GTGGGTGAGCTGTCCACCTGTGG + Intergenic
1141524516 16:84603234-84603256 GTGAGTCAGCTGTCCCCGTGGGG - Intronic
1142419387 16:89961122-89961144 GTGAGGGAGCTGTTCCTGGCGGG + Intronic
1146160088 17:30555020-30555042 GTGGGTGACCGGGCCCTGACAGG - Intergenic
1146239397 17:31203136-31203158 GTGGCTGAGCTGCTCCTTTCTGG + Intronic
1147807347 17:43141168-43141190 GTGGATGAGCTGTCTCTCCCAGG - Intergenic
1148989571 17:51653722-51653744 GTGGATGAGCTGCACCTGGCAGG + Exonic
1149847472 17:60016242-60016264 GTGGGTGACCGGGCCCTGACAGG + Intergenic
1150085830 17:62272859-62272881 GTGGGTGACCGGGCCCTGACAGG + Intronic
1150354490 17:64471389-64471411 GTGGGGGAGGTGTCGCTTTCTGG - Intergenic
1151493109 17:74444197-74444219 CTGGGTGAGCTCTCCCTGGTGGG + Intronic
1152179983 17:78813436-78813458 GTGGGGAAGCTGCCCCTGTAGGG - Intronic
1152274373 17:79347238-79347260 GTGTGTGATCTCTTCCTGTCTGG + Intronic
1154126931 18:11699920-11699942 GTGGGGAGGCTGTGCCTGTCGGG + Intronic
1157749828 18:50168457-50168479 GTGGAACAGCTGCCCCTGTCAGG + Intronic
1157757443 18:50231348-50231370 GTGGGTGAGCAGTGACTATCTGG - Intronic
1161607275 19:5222133-5222155 GTGGGTGAGTTGTAGTTGTCAGG + Exonic
1162187556 19:8917697-8917719 GTGGCTGAGCTATCCTTCTCTGG + Exonic
1162350577 19:10146499-10146521 CTGTGTGAGCTGTGCCCGTCTGG - Exonic
1164145608 19:22510746-22510768 GTGGGTGAGTGGTTCCTGTGAGG - Intronic
1165054306 19:33164357-33164379 TTCGGTGAGCTGTACCTGACCGG + Intronic
1167491045 19:49792766-49792788 GTGTGTGGGGTGTCCCTGGCAGG - Intronic
925026207 2:609138-609160 GGGGGTGAGCTGACTCTGACTGG + Intergenic
925026218 2:609212-609234 GGGGGTGAGCTGACTCTGACTGG + Intergenic
925026224 2:609249-609271 GGGGGTGAGCTGACTCTGACTGG + Intergenic
925171253 2:1751509-1751531 GTGGTTGAGCTGACACTGACCGG - Intergenic
926045475 2:9706553-9706575 GTGGGTGAGCTTTGCATTTCAGG + Intergenic
926400746 2:12493448-12493470 ATGGGTGAGCTGTCCCTACAGGG - Intergenic
927136431 2:20099978-20100000 GAGGGTGAGCTGTTCCAGGCAGG + Intergenic
927844005 2:26462060-26462082 GTGGGTGAGCAGTCCCTGCATGG - Intronic
929031901 2:37657195-37657217 GTGGGAGAGCTTTCCATGTAGGG - Intronic
942706006 2:178773285-178773307 GAGGTTGAGCTGTCCCACTCTGG - Exonic
944601512 2:201308326-201308348 GAGGGGGAGCTGCTCCTGTCTGG - Intronic
1173192622 20:40887668-40887690 GAGTGTGAGCTTCCCCTGTCCGG - Intergenic
1174447081 20:50597598-50597620 CTGGATGAGCTGTCCCTGTTTGG - Exonic
1175856994 20:62126440-62126462 GTGAGTGACCTGTTTCTGTCTGG + Intronic
1176306072 21:5123766-5123788 GTGGCAGAGCTGTCCCTGGAGGG + Intronic
1176307191 21:5129928-5129950 GTGCGGGAGCTGCCCCTGGCCGG + Intergenic
1178244034 21:30935315-30935337 GAGGGTGGCCTGGCCCTGTCTGG - Intergenic
1179472836 21:41622957-41622979 GTGGGTGAGCTCACGCTGGCAGG - Intergenic
1179849868 21:44132102-44132124 GTGCGGGAGCTGCCCCTGGCCGG - Intergenic
1179850985 21:44138265-44138287 GTGGCAGAGCTGTCCCTGGAGGG - Intronic
1181042175 22:20197347-20197369 CTGGGTGGGCTGTCCCTGGCGGG + Intergenic
1181526718 22:23493729-23493751 CTGGGTGAGCTGGCCCTGCTGGG - Intergenic
1182975299 22:34618482-34618504 GTGGGTGGGCAGTCCATGGCTGG + Intergenic
1183323351 22:37178262-37178284 GGGGGTGAGGTCGCCCTGTCTGG + Intergenic
1184647169 22:45902708-45902730 GTGTGTGAGCCGTTCCTGTGCGG + Intergenic
953205118 3:40820139-40820161 GAAAGTGAGCTTTCCCTGTCAGG + Intergenic
953559154 3:43971471-43971493 GTGGGTGAGGAGGCCCTGCCTGG - Intergenic
954286806 3:49625186-49625208 GTGGGGGTGCTGCCTCTGTCCGG - Exonic
954436699 3:50500093-50500115 GTGGGTGACGTGTGTCTGTCTGG - Intronic
954457224 3:50606352-50606374 GTGGCTGAGCAGTCCCTGCTGGG - Intergenic
960671524 3:120159247-120159269 GAGGGTGAGCTGTGCCTCACTGG + Intergenic
961485913 3:127216381-127216403 GTGTGTCAGCTGTCCCTCCCCGG - Intergenic
969512882 4:7629648-7629670 CTGGATGAGCTGTTCCTTTCCGG + Intronic
969898891 4:10330171-10330193 GTGGGTGTGCTGGGCCTGCCAGG + Intergenic
971927756 4:33035621-33035643 GTTGTTGTTCTGTCCCTGTCTGG - Intergenic
975097292 4:70471889-70471911 GTGGATGATCTGTTCCTGTTGGG + Intronic
976777611 4:88723157-88723179 CTTGGTGAGCTGACCCAGTCAGG + Intergenic
977227121 4:94405863-94405885 GTGGTTAAGCTGTCACTGACAGG - Intergenic
985576665 5:676429-676451 GTGGGTCAGATGCCCCTGTGTGG - Intronic
992798828 5:80277633-80277655 GTGTGTGTGCTGACCTTGTCTGG - Intergenic
993032550 5:82721919-82721941 CTGGGTGTGCTGTGCCTGTTAGG - Intergenic
994236442 5:97368914-97368936 GTGAGTGACCTCTACCTGTCCGG + Intergenic
997337055 5:133115847-133115869 GTGGCTGAGCTGCCCCTGGAAGG + Intergenic
997751934 5:136355026-136355048 TTGGGGGAGCTGCCCCTGTATGG - Intronic
1001381516 5:171309444-171309466 GCGGGTGCGCTGTCCTGGTCCGG - Exonic
1001787991 5:174430456-174430478 GTGCATTAGCTCTCCCTGTCTGG - Intergenic
1002082961 5:176748406-176748428 GGGAGTGAGCTGGCCCTGGCTGG - Intergenic
1002663827 5:180808781-180808803 ATGGCTGAGCTGACCCTGACGGG + Exonic
1004734031 6:18387094-18387116 AGAGGTGAGCTGTCCCTGTCTGG + Intergenic
1005223326 6:23613451-23613473 GTGAGTGAGTTGTCAATGTCTGG + Intergenic
1007138853 6:39550803-39550825 GAGGGTGAGTTGTCTCTGACAGG + Intronic
1012373209 6:98531189-98531211 GTGTCTGTGCTGTCCCAGTCCGG - Intergenic
1013350933 6:109304888-109304910 GTGGGTGAGCTGGCCTCTTCTGG + Intergenic
1013643884 6:112116390-112116412 GTGGCTGGACTGTCCCTGCCAGG + Intronic
1014355555 6:120405072-120405094 GTGGTTTATCTCTCCCTGTCAGG + Intergenic
1018054891 6:160043285-160043307 GTGGGTGAGTTGTGCCTGGATGG + Exonic
1020234999 7:6348550-6348572 GTGGGTGAGCCGTGCCTGCCCGG - Intronic
1021415204 7:20376135-20376157 CTGAGGGTGCTGTCCCTGTCAGG + Intronic
1022968016 7:35492542-35492564 GTGGGTGAGCTGCACTTTTCGGG + Intergenic
1023089947 7:36608261-36608283 GGGGCTCAGCTTTCCCTGTCGGG - Intronic
1024195649 7:47056450-47056472 GTGTGTGTGCTGTCTTTGTCAGG + Intergenic
1024209398 7:47190749-47190771 CTGTGTGAGCTGTCACTGTTAGG + Intergenic
1025813790 7:64891404-64891426 CTGGCTGTGCTGTGCCTGTCTGG - Intronic
1025818930 7:64945528-64945550 CTGGCTGTGCTGTGCCTGTCTGG + Intergenic
1026853210 7:73737543-73737565 GAGGGTGAGCCGCCCATGTCTGG - Exonic
1026867752 7:73833768-73833790 GTGGGGGAGCTGTCCAGGACAGG + Intergenic
1036288134 8:7462594-7462616 GTGGGTGAGCAGTCATTGTTTGG - Intronic
1036333341 8:7848934-7848956 GTGGGTGAGCAGTCATTGTTTGG + Intronic
1036581337 8:10078505-10078527 GTGGGTCATCTGACCCTTTCTGG + Intronic
1047398483 8:124525483-124525505 GCGGGTGAGCTGTGACTATCTGG - Intronic
1048755030 8:137728886-137728908 GTAGGGGAGCTTTCCCTGTGGGG - Intergenic
1048950138 8:139489817-139489839 GATGGTGAGCTGTCCTTGCCTGG - Intergenic
1049096730 8:140552661-140552683 GTGTGTGTGCACTCCCTGTCTGG - Intronic
1051819306 9:21146043-21146065 GGAGGTGAGTTGTCCCTTTCAGG - Intergenic
1053284140 9:36839560-36839582 GTGGGTGAAGTGTCCATGGCAGG + Exonic
1056667863 9:88596293-88596315 GTGGGTGAGCAGTGACTGCCTGG + Intergenic
1061259891 9:129474437-129474459 CTGGGTGAGCTGGCCCTGCTGGG + Intergenic
1061802693 9:133120949-133120971 GTGGGTGAGCTGGGGCGGTCGGG - Intronic
1061906961 9:133703856-133703878 GTGGGTGGGATGTCCCTGCTGGG - Intronic
1062349553 9:136132384-136132406 CCGGGTGGGCTGTCCCAGTCAGG + Intergenic
1185501459 X:599843-599865 GTGAGTAAGCAGTGCCTGTCAGG - Intergenic
1186433417 X:9523431-9523453 GTGGGTGACCTGGCCCAGTGTGG - Intronic
1190083255 X:47373255-47373277 GAGGGTGAGCGGCCACTGTCTGG + Intronic
1192535511 X:71923743-71923765 GTGGCTGTGCTGCTCCTGTCTGG + Intergenic
1194140453 X:90202765-90202787 GTGGTTGTGCTGTCCCAGTTGGG - Intergenic
1195343532 X:103926800-103926822 GTGGGTCTGCTGTTCCTGCCAGG + Intronic
1200090177 X:153632356-153632378 GTGAGGAAGCTGGCCCTGTCCGG - Intergenic
1200486198 Y:3771733-3771755 GTGGTTGTGCTGTCCCAGTTGGG - Intergenic