ID: 1133127881

View in Genome Browser
Species Human (GRCh38)
Location 16:3657914-3657936
Sequence CATCAGTGACCACTATCCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133127876_1133127881 -1 Left 1133127876 16:3657892-3657914 CCACTTGCCTGCAGGCCCAAGCC 0: 1
1: 1
2: 4
3: 34
4: 311
Right 1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 147
1133127874_1133127881 6 Left 1133127874 16:3657885-3657907 CCTGTGCCCACTTGCCTGCAGGC 0: 1
1: 0
2: 2
3: 36
4: 338
Right 1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 147
1133127875_1133127881 0 Left 1133127875 16:3657891-3657913 CCCACTTGCCTGCAGGCCCAAGC 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 147
1133127872_1133127881 7 Left 1133127872 16:3657884-3657906 CCCTGTGCCCACTTGCCTGCAGG 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 147
1133127877_1133127881 -8 Left 1133127877 16:3657899-3657921 CCTGCAGGCCCAAGCCATCAGTG 0: 1
1: 1
2: 2
3: 17
4: 172
Right 1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 147
1133127871_1133127881 12 Left 1133127871 16:3657879-3657901 CCAGACCCTGTGCCCACTTGCCT 0: 1
1: 0
2: 2
3: 36
4: 337
Right 1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 147
1133127870_1133127881 13 Left 1133127870 16:3657878-3657900 CCCAGACCCTGTGCCCACTTGCC 0: 1
1: 0
2: 4
3: 21
4: 294
Right 1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133127881 Original CRISPR CATCAGTGACCACTATCCAG TGG Exonic
900598632 1:3493704-3493726 CATCAGTGACCAATATTGATTGG - Intronic
909197722 1:72648641-72648663 CATCAGTGCCCAAAGTCCAGAGG - Intergenic
909488608 1:76201539-76201561 CATCAGTGACATCTAGCCATAGG - Intronic
910359643 1:86402998-86403020 CATCAGTGACCACCCCCAAGTGG - Intergenic
910598704 1:89007254-89007276 CATCAGTGAGAATTATCCATGGG + Exonic
911742300 1:101400353-101400375 CATCAGAGAAGACTTTCCAGAGG + Intergenic
916127929 1:161588121-161588143 CAACAGAGACCTCTTTCCAGAGG + Intronic
916137847 1:161669951-161669973 CAACAGAGACCTCTTTCCAGAGG + Intronic
916882998 1:169039811-169039833 AATCATTGACCACAATCAAGTGG + Intergenic
917445706 1:175104423-175104445 CATCCGTGTCCACTATGCCGAGG - Intronic
919422384 1:197386141-197386163 CATTGGTGAACACAATCCAGGGG - Intronic
921079133 1:211724941-211724963 CGTCAGTGAACATTATCCTGGGG + Intergenic
921272811 1:213487917-213487939 CATCAAAGACCAATAGCCAGAGG - Intergenic
922324510 1:224515838-224515860 CATCAGTGACCACAAGTCACAGG - Intronic
1063663356 10:8048493-8048515 CATCAGTGACTCCTAGCCAGGGG - Intergenic
1064207492 10:13336305-13336327 CCTCAGTGACCTCTATGCAATGG - Exonic
1065078514 10:22104744-22104766 CCTCAGTGTCCACTGTACAGTGG + Intergenic
1067085298 10:43234957-43234979 CATCAGTGGCCTCTGCCCAGGGG - Intronic
1069675948 10:70247847-70247869 CTTCAGTGACCACAGTGCAGGGG + Exonic
1070611032 10:77932749-77932771 CAGCAGTGGCCACTCTGCAGTGG - Intergenic
1072792276 10:98327011-98327033 CCCCAGAGACCACTGTCCAGCGG - Intergenic
1078345591 11:10544966-10544988 CATCAGTGTCCAAAGTCCAGAGG + Intergenic
1078440840 11:11366019-11366041 CAACAGTGCCCAGTACCCAGTGG + Intronic
1079187020 11:18246970-18246992 CATCACTGACCACCTCCCAGAGG - Intronic
1085298766 11:75446113-75446135 CATCAGGGACCACTTGACAGGGG + Intronic
1085695551 11:78701674-78701696 CATCTGGGACCACCAGCCAGAGG + Exonic
1087453469 11:98353614-98353636 CATCAGTGCCCAAAGTCCAGAGG + Intergenic
1087970919 11:104482266-104482288 CATCATTGATCACTACCAAGTGG + Intergenic
1089680698 11:120117418-120117440 CCTCAGAGACCACTGTTCAGGGG + Intronic
1090613806 11:128496592-128496614 GACCAGTGACCACCCTCCAGGGG - Intronic
1091362950 11:134992658-134992680 CATCAGGGACCACTATTTTGGGG - Intergenic
1094169700 12:27479237-27479259 CACCAGGGCACACTATCCAGGGG - Intronic
1095092243 12:38118133-38118155 CTTCAGTGACCAGAATCCATAGG + Intergenic
1102023236 12:109698392-109698414 CATCAGTGAGAACTTCCCAGTGG + Intergenic
1102493343 12:113302450-113302472 CATAACTGACCACAAACCAGGGG - Intronic
1102706743 12:114887633-114887655 CATCTGTGACCTATATCCACTGG - Intergenic
1104441687 12:128798372-128798394 CATCAGTGACAAGTGTCCATGGG + Intronic
1104647260 12:130505848-130505870 CATCCCTGGCAACTATCCAGAGG + Intronic
1104874794 12:132026402-132026424 CATCACTGCCCACTATGCAAAGG - Intronic
1105041816 12:132966954-132966976 CATCAGTGCCCAATGTCCAGAGG - Intergenic
1107853402 13:44591945-44591967 CCTCAGTGCCCAAAATCCAGAGG - Intergenic
1114403902 14:22435980-22436002 CATCAGGGACCACTTTCTTGGGG - Intergenic
1115152737 14:30304093-30304115 CATCAGGCAGCACTTTCCAGAGG - Intergenic
1116706402 14:48307791-48307813 CTGCAGTTACCACTATCCAAGGG - Intergenic
1129178941 15:73859423-73859445 CATTAGCCACCACTATCCAAAGG - Intergenic
1130183106 15:81651556-81651578 CATCAGTGCCCAAAGTCCAGAGG - Intergenic
1130794311 15:87192836-87192858 CTTCAGTGCCCACAATCAAGTGG + Intergenic
1131075329 15:89491902-89491924 CTGCAGTGAGCACTGTCCAGGGG - Intronic
1131605744 15:93900938-93900960 CATCAGTGCCCAAAGTCCAGAGG + Intergenic
1132317702 15:100901856-100901878 CATCAGTGCCCACCCTCCACTGG + Intronic
1132898109 16:2238370-2238392 CATCAGCGACCACTTTCCAGTGG + Exonic
1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG + Exonic
1133984538 16:10658385-10658407 CACAATAGACCACTATCCAGCGG + Intronic
1135753232 16:25073795-25073817 CATCTGTGGCCACCAGCCAGAGG - Intergenic
1137005790 16:35273501-35273523 CATCACAGAGCACTAGCCAGGGG - Intergenic
1139191597 16:64869897-64869919 CATCAGTGACTCCTACCCAGTGG + Intergenic
1139310419 16:66023787-66023809 CATCAGTGACTTGTATGCAGAGG - Intergenic
1141034630 16:80616605-80616627 AAACAGTGACCACCATCCTGGGG + Intronic
1141653317 16:85404860-85404882 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141653448 16:85405385-85405407 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141653508 16:85405650-85405672 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141653616 16:85406078-85406100 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141653687 16:85406376-85406398 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141653892 16:85407203-85407225 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141653962 16:85407468-85407490 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141654243 16:85408619-85408641 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141654274 16:85408750-85408772 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141654454 16:85409476-85409498 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141654478 16:85409574-85409596 CAACAGTGAGGATTATCCAGGGG - Intergenic
1141654706 16:85410464-85410486 TAACAGTGAGCATTATCCAGGGG - Intergenic
1144083599 17:11786747-11786769 CATCAGTGACCACTACCACAAGG - Intronic
1147163268 17:38579802-38579824 CTTCAGTGACCAGTGGCCAGGGG + Intronic
1147519579 17:41157755-41157777 CATCAGTTACCACTAGCTATGGG - Intergenic
1154488883 18:14903684-14903706 CATCAGGGACCACTATTTTGGGG + Intergenic
1156274842 18:35574676-35574698 CATCAGTGAAAACAAGCCAGAGG - Intergenic
1157085485 18:44576467-44576489 TATCAGTCACGACTCTCCAGAGG + Intergenic
1157777068 18:50404003-50404025 CATCACAGAACACTAGCCAGGGG + Intergenic
1161674023 19:5632911-5632933 CATCAGAGTATACTATCCAGAGG + Intronic
1161832277 19:6615421-6615443 CATCAGGGACTACAATCCAGTGG + Intergenic
925011887 2:492242-492264 TATGAGTGACCAGTTTCCAGCGG + Intergenic
927262796 2:21110880-21110902 CATCAGTGACCAGAATCCAATGG - Intergenic
927860269 2:26556316-26556338 CAACACTGACCACAATTCAGAGG - Intronic
930811302 2:55544707-55544729 CATCAGCCACCACTTCCCAGAGG + Intronic
931140862 2:59456093-59456115 CACCAGAGACCATTTTCCAGAGG + Intergenic
931377102 2:61717579-61717601 CAGCCATTACCACTATCCAGGGG - Intergenic
933423225 2:82078557-82078579 TAACAGTGATCAATATCCAGGGG - Intergenic
934920101 2:98336086-98336108 AATCAGTGACCACTAAAAAGGGG - Intronic
936493884 2:113000330-113000352 CAGCTATAACCACTATCCAGGGG - Intergenic
937734049 2:125268113-125268135 CATCTGTGCTCACTATGCAGTGG + Intergenic
938211821 2:129472460-129472482 CATCAGAGAACACTATCAAGAGG - Intergenic
941361505 2:164557318-164557340 CATCAGTGCAAACTAGCCAGGGG + Intronic
941998824 2:171626671-171626693 CATCAGTGACCAAAGTCCAAAGG - Intergenic
946012738 2:216579418-216579440 CATCACTGACCTCTACCCACTGG - Intergenic
948477171 2:238227621-238227643 CATCAGTTCCCCCTTTCCAGCGG + Intronic
1170774977 20:19367262-19367284 CTCCTGTGACCACTATCCAGAGG - Intronic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1174619841 20:51865538-51865560 CATCTGTGACCACTTTTCTGAGG + Intergenic
1180604296 22:17044994-17045016 CATCAGTCACACCTACCCAGAGG - Intergenic
953026131 3:39146313-39146335 ACTCAGTGTCCACTGTCCAGGGG - Intronic
962149085 3:132873563-132873585 TATCAGTCACCACTGGCCAGGGG - Intergenic
967154653 3:186681395-186681417 CATAAGGGAGCACTGTCCAGGGG - Intergenic
967156257 3:186695234-186695256 CATGAGGGAGCACTGTCCAGGGG - Intergenic
967158077 3:186711651-186711673 CATGAGGGAGCACTGTCCAGGGG - Intergenic
967975569 3:195032649-195032671 CATCAGTCACCACCCTTCAGTGG - Intergenic
968124126 3:196145929-196145951 CCTCTGTGGCCACTACCCAGAGG - Intergenic
972764953 4:42144015-42144037 CATCAGTGACCAACAGCCAACGG + Intronic
974135164 4:57807002-57807024 CATCAGTTACTGCTATACAGAGG + Intergenic
974138172 4:57847299-57847321 CATCTGTGACCTGTTTCCAGTGG - Intergenic
974684986 4:65215937-65215959 CATCAGCCACAACTTTCCAGTGG + Intergenic
981808627 4:148747119-148747141 CTTCTGTGAGCACTATCCAAGGG + Intergenic
982953660 4:161734749-161734771 CATTTGTGACCAATATCTAGGGG + Intronic
984178847 4:176455368-176455390 GATAACTGATCACTATCCAGTGG + Intergenic
984440998 4:179770456-179770478 CATCAGTGAAAACTGTCAAGTGG - Intergenic
984512694 4:180698458-180698480 GATCATTGATCACTATCCTGTGG + Intergenic
985170060 4:187139182-187139204 CATCAGATCCCACTATGCAGAGG + Intergenic
985802364 5:2013118-2013140 CAACACTGACCACTCTCCTGAGG - Intergenic
988801501 5:34700211-34700233 CATCAGAAACCACCACCCAGGGG - Intronic
990286019 5:54301413-54301435 CAGTGGTGACCACTATCCCGAGG - Intronic
992115435 5:73534605-73534627 GATAAGTGACCACTGACCAGTGG - Intergenic
992838969 5:80668489-80668511 CATCAGTGTCCAAAGTCCAGAGG + Intronic
993559151 5:89382356-89382378 CAAAAGTGACCACTATTCATGGG + Intergenic
994193195 5:96892108-96892130 AATCAGTGCCCATTATCAAGTGG - Intronic
997263243 5:132479515-132479537 CATCAAGGACCACTTTCCACTGG - Intergenic
1001883903 5:175271081-175271103 CATCAGTGACAAATCTCCAGAGG + Intergenic
1002211474 5:177601997-177602019 AAGCAGTGACTATTATCCAGGGG - Intronic
1004173764 6:13320891-13320913 CAAAAGTGACCACTAACCAGTGG + Exonic
1010024543 6:71200583-71200605 TATCAGTGATGACTATTCAGAGG - Intergenic
1011703724 6:89980575-89980597 CCTCAGTGGCCACCATCTAGAGG + Intronic
1020553186 7:9634054-9634076 CATAATGGACCACAATCCAGTGG + Intergenic
1020644132 7:10793474-10793496 CATAAGTGACCTTTATTCAGAGG + Intergenic
1024118246 7:46212891-46212913 CATCAGTGAGCACTTTCAAAAGG + Intergenic
1024661538 7:51500069-51500091 CACCAGTGACCACAAGCCAGAGG - Intergenic
1025145265 7:56496186-56496208 CACCAGTGCCCACTAATCAGGGG - Intergenic
1028248906 7:88516245-88516267 CATCAGTGGCCTCCATCCATTGG + Intergenic
1028527460 7:91801555-91801577 CATCAGTGCCCAAAGTCCAGAGG + Intronic
1028788142 7:94820241-94820263 CATCAGTGTCCTGTATTCAGGGG - Intergenic
1029178367 7:98681688-98681710 CCTCACTCACCACTCTCCAGTGG - Intergenic
1035185773 7:157125067-157125089 GAACAGTGTCCACTATCCATCGG - Intergenic
1035391546 7:158507897-158507919 GATCAGTGAGGACCATCCAGGGG + Intronic
1035751832 8:2001966-2001988 CATGAGCGACCACTATCTGGAGG + Exonic
1038072423 8:24031764-24031786 CCTTAGAGACCACTATCTAGTGG - Intergenic
1043807730 8:84693756-84693778 AATCAGTGATCATTATCAAGTGG + Intronic
1044095142 8:88054432-88054454 CATTAGTGGCCACTATGCAGTGG + Intronic
1047318406 8:123755253-123755275 CATCAGTGTCCAAAGTCCAGAGG + Intergenic
1047715474 8:127591111-127591133 CATCCCTGGCCACTATCCACTGG - Intergenic
1049048070 8:140168714-140168736 CCTGAGTGACCAGTGTCCAGGGG + Intronic
1055458220 9:76492658-76492680 CATCTGTGTCCACTATGCCGCGG - Intronic
1055739171 9:79367102-79367124 CATTAGGGACCATTATCAAGAGG + Intergenic
1056433149 9:86548436-86548458 CATCACTCACCACTCTCCATTGG + Intergenic
1059184683 9:112257206-112257228 TATCAGTGAATACAATCCAGGGG - Intronic
1203779406 EBV:92538-92560 TGTCAGTGACCACTATCAGGTGG + Intergenic
1190621056 X:52287580-52287602 CATCAGTGCCCAAAGTCCAGAGG - Intergenic
1190801398 X:53792733-53792755 GATCATTCACCACAATCCAGTGG - Intergenic
1191095383 X:56668326-56668348 TATTAGTGAGCACTATCTAGAGG + Intergenic
1192727726 X:73769568-73769590 CCTCAGTGACCTCTATGCAATGG + Intergenic
1198641249 X:138758536-138758558 TCTCAGTGACCACTAGCTAGTGG + Intronic
1199092277 X:143705784-143705806 CATCAGTGCCCAAAATTCAGAGG - Intergenic
1199832353 X:151559133-151559155 CATCCATGTCCACTATGCAGAGG - Intergenic
1200223303 X:154402811-154402833 CATCAGTGACCACTACCCCGTGG - Exonic
1201283140 Y:12358159-12358181 CATCACAGAACACTAGCCAGGGG - Intergenic
1201599122 Y:15708600-15708622 CATCACTGGCCTCTATCCACTGG - Intergenic