ID: 1133130180

View in Genome Browser
Species Human (GRCh38)
Location 16:3671897-3671919
Sequence ACGTGTGCTAAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133130175_1133130180 -10 Left 1133130175 16:3671884-3671906 CCTTCAACCCAGCACGTGTGCTA 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1133130166_1133130180 23 Left 1133130166 16:3671851-3671873 CCCCATTAACCTGCCCTTTGTCT 0: 1
1: 0
2: 0
3: 17
4: 242
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1133130167_1133130180 22 Left 1133130167 16:3671852-3671874 CCCATTAACCTGCCCTTTGTCTT 0: 1
1: 0
2: 1
3: 27
4: 346
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1133130172_1133130180 10 Left 1133130172 16:3671864-3671886 CCCTTTGTCTTCAGGCCTGGCCT 0: 1
1: 0
2: 1
3: 25
4: 285
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1133130170_1133130180 14 Left 1133130170 16:3671860-3671882 CCTGCCCTTTGTCTTCAGGCCTG 0: 1
1: 0
2: 1
3: 33
4: 318
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1133130168_1133130180 21 Left 1133130168 16:3671853-3671875 CCATTAACCTGCCCTTTGTCTTC 0: 1
1: 0
2: 1
3: 24
4: 328
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1133130173_1133130180 9 Left 1133130173 16:3671865-3671887 CCTTTGTCTTCAGGCCTGGCCTT 0: 1
1: 0
2: 3
3: 31
4: 287
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1133130174_1133130180 -5 Left 1133130174 16:3671879-3671901 CCTGGCCTTCAACCCAGCACGTG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133130180 Original CRISPR ACGTGTGCTAAGAGGGAAGC AGG Intronic
900521145 1:3106109-3106131 ACATGTGCTAGGTGGGGAGCTGG - Intronic
904227258 1:29032439-29032461 ACGTGTTATAACAGAGAAGCAGG - Intronic
906253500 1:44329930-44329952 AGGTGTGCTAGGAAGGAAACAGG - Intronic
906539208 1:46572149-46572171 ATGTGGGCTAAGATGGAACCTGG + Exonic
909341053 1:74531461-74531483 AGGTGGGCTAAGAGGAAAGGTGG + Intronic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
915615539 1:157034979-157035001 AGGTGTGCAAAGAGGGATGTGGG + Intronic
915806497 1:158858984-158859006 ACGTGTGCCAAATGGGAAGAGGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
918055874 1:181022103-181022125 ACGTTTGCTGGGAGGGAGGCGGG - Intronic
918065646 1:181099543-181099565 ACATGTGCTATGAGGAAAGCAGG + Intergenic
921874553 1:220179861-220179883 AGGAGTGCTAAGAGGGAAGTCGG + Intronic
921901466 1:220455897-220455919 ACGTGTACTAAGAGGCAAAATGG - Intergenic
923814178 1:237357305-237357327 ACGTGTTCTGAGAAGGAAGCAGG - Intronic
924405311 1:243738635-243738657 ACGAGTACTAAGTGGGAAGTGGG - Intronic
1064248891 10:13691734-13691756 CCCTGTGCTAAGGGGGAAGGTGG + Intronic
1065739292 10:28782489-28782511 AGGTTTGGTAAGAAGGAAGCTGG - Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1070644257 10:78190532-78190554 AGGTGTGCAGAGAGGCAAGCAGG + Intergenic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1084005098 11:66318267-66318289 ACTTCTGCTAAGAGTGCAGCGGG - Intergenic
1084587083 11:70068589-70068611 ACGTGAGCCAGGAGGGAAGGAGG + Intergenic
1091768639 12:3137691-3137713 AGGTTTGCTGAGAGGGAAGGGGG + Intronic
1092209396 12:6636435-6636457 AAGTGTGCTCAGTGGGAGGCAGG - Exonic
1093185136 12:16011555-16011577 ACTTTTGCTGAGAGGGAAGGGGG - Intronic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1103791081 12:123471620-123471642 AAGGGTGCTAGGTGGGAAGCTGG - Exonic
1106331912 13:28747287-28747309 ACTTGTGCTAAGAAGCAAACAGG + Intergenic
1110234380 13:73201177-73201199 AAGAGTTCAAAGAGGGAAGCTGG - Intergenic
1111104742 13:83630165-83630187 AATTGTGATAAGAGGTAAGCGGG + Intergenic
1114791535 14:25664917-25664939 ACGTGTTCCAAGAGGTAAGATGG + Intergenic
1115426766 14:33269789-33269811 AAATGTCCTAATAGGGAAGCAGG + Intronic
1117438415 14:55739557-55739579 AAGTGTTCAAAGAGGGAAGGGGG + Intergenic
1120537454 14:85714372-85714394 AGGTGTGTTAAGACAGAAGCAGG - Intergenic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1124220022 15:27843310-27843332 AAGTGTGCTGAGTGGGCAGCAGG - Intronic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1131050885 15:89347104-89347126 ACCTGTGATAAGGAGGAAGCTGG - Intergenic
1131071707 15:89470300-89470322 ACGTCGGCAAAGATGGAAGCCGG - Intergenic
1131712968 15:95075662-95075684 ACTAGTGAAAAGAGGGAAGCGGG - Intergenic
1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG + Intronic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1135964203 16:27022465-27022487 TCATTTGCTAAGAGGGAAGGAGG + Intergenic
1136187746 16:28597956-28597978 GCGTGAGCTCAGAGGCAAGCGGG + Intergenic
1139962260 16:70724784-70724806 GCTTCTGCTGAGAGGGAAGCAGG + Intronic
1141221662 16:82075194-82075216 AGTAGTACTAAGAGGGAAGCTGG + Intronic
1144969053 17:19095681-19095703 AGGTGTGCCAACAGGTAAGCTGG + Intronic
1144978863 17:19156385-19156407 AGGTGTGCCAACAGGTAAGCTGG - Intronic
1144989359 17:19221847-19221869 AGGTGTGCCAACAGGTAAGCTGG + Intronic
1145269331 17:21396354-21396376 TCGTCTGCAAAGTGGGAAGCAGG - Intronic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1147422671 17:40330474-40330496 ACGTGTGCTGGGGGGGAAGAGGG - Intronic
1149030613 17:52078699-52078721 TTGTGTTCTAAGTGGGAAGCAGG + Intronic
1149682678 17:58517137-58517159 ACCTGTGATCAGAGGGCAGCAGG + Intronic
1150252473 17:63714749-63714771 ACGTGTGCTGTGAGTGAAGCTGG + Intronic
1165013422 19:32864521-32864543 ACATGTGCCAAGAGGGATACTGG + Intronic
925298464 2:2793376-2793398 ACGGGTGCCAGGAGGGCAGCAGG - Intergenic
925827783 2:7867023-7867045 ATGTGTGCAAAGAGGAAAGGAGG - Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926695650 2:15768671-15768693 AGGTGTGCAAAGCAGGAAGCAGG + Intergenic
928876045 2:36041474-36041496 AAGTGTGGCAAGAGGGCAGCTGG - Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932595243 2:73089314-73089336 ACCTGTGAGAAGAGGGGAGCAGG + Exonic
936350100 2:111706152-111706174 ACTTGGGCTTAGAGGGAAGGTGG - Intergenic
937108339 2:119340265-119340287 ACGTGTGGAAACAGAGAAGCAGG + Exonic
937228625 2:120384099-120384121 ACGGCTGCTTGGAGGGAAGCAGG - Intergenic
943811182 2:192191764-192191786 ATGCAAGCTAAGAGGGAAGCTGG - Intronic
947219511 2:227779111-227779133 ACGTGTGTCAAGAGAGAAGTAGG + Intergenic
947509425 2:230737376-230737398 AGGTGTCCTGAGAGGGTAGCGGG - Intronic
948747513 2:240107178-240107200 ACGTGGGCTAAGAGGGACTTGGG + Intergenic
948827617 2:240580413-240580435 ACGTGGCCTAATAGAGAAGCTGG - Exonic
1170873433 20:20229468-20229490 ACAGGTGCTGAGAGGTAAGCAGG + Intronic
1171324227 20:24276653-24276675 AGGTGTGCTTAGAGGCAAGAGGG + Intergenic
1178879721 21:36439680-36439702 ACTTGGGCTAAGAGGGAAAATGG + Intergenic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1179960512 21:44764869-44764891 ATGTGTGCCAGGAGGGAAGGGGG - Intergenic
1182978258 22:34643674-34643696 ACGTGTTCTAAGTGTGCAGCAGG + Intergenic
1183978985 22:41528731-41528753 CCGTGGGCTAAGCGGGGAGCAGG - Exonic
1184751044 22:46486958-46486980 ACGTGTGATGAGTGGGGAGCAGG - Intronic
1185105189 22:48864956-48864978 ACCTGTCCCAAGAGGGAAGAAGG - Intergenic
951160944 3:19420981-19421003 ACGTGTGTTAAGAGAGAAGGAGG + Intronic
954438900 3:50510911-50510933 ACCTGTGCTAATAGGAAAGCTGG - Intergenic
954979643 3:54733309-54733331 CCTTGTGCCAAGAGGGCAGCTGG + Intronic
955341417 3:58128220-58128242 CCATGTGGTAAGGGGGAAGCAGG - Intronic
956715252 3:72073862-72073884 AAGTGGGCTAAGCAGGAAGCAGG - Intergenic
959213800 3:103423870-103423892 TCCTGGGCTAAGAGGGGAGCTGG + Intergenic
967729047 3:192890169-192890191 ACCTGTTCTGTGAGGGAAGCAGG - Intronic
969963725 4:10973236-10973258 GGGTGTCCTAAGAGTGAAGCAGG - Intergenic
974353747 4:60784775-60784797 AGGTGTGCAAAGAAGGTAGCTGG - Intergenic
982529640 4:156523020-156523042 ATGTGTGCTAACAGTGAAACTGG + Intergenic
985920942 5:2973071-2973093 ACAACTGCTAAGAGAGAAGCCGG + Intergenic
985931282 5:3059565-3059587 AAGTGTGCTAAGACGGCAGAAGG - Intergenic
987252757 5:16117430-16117452 AGGAGTGCAAAGAAGGAAGCTGG - Intronic
992003700 5:72458571-72458593 AGGGGTGCGAACAGGGAAGCAGG + Intronic
994244823 5:97467412-97467434 AGTTGTGCTAAGAGAGAAGGGGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998353169 5:141514089-141514111 ACGGTTGCTGAGATGGAAGCAGG + Intergenic
998367599 5:141640977-141640999 TCTTGTGCTAAGAGGGCAGGGGG - Exonic
1000185471 5:158853632-158853654 AGGTGTGCTGAGAGGGTGGCAGG + Intronic
1001352405 5:170981456-170981478 ACGTGTTGTGGGAGGGAAGCAGG + Intronic
1002601497 5:180356399-180356421 ACCTGTGCTTACAGGGGAGCAGG + Intergenic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1005600975 6:27425649-27425671 ACTTGTTCTAAGAGGAATGCTGG - Intergenic
1015847696 6:137538144-137538166 ACTTGTGATAAGTGGGAAGGAGG - Intergenic
1017764049 6:157592793-157592815 ACGTGTGCAACGAAGGAGGCCGG + Intronic
1018455905 6:163951975-163951997 ATGTGTGCTAAGAGGCAAAATGG - Intergenic
1019018766 6:168900484-168900506 AGGGGTGAGAAGAGGGAAGCAGG + Intergenic
1019018815 6:168900664-168900686 AGGAGTGAGAAGAGGGAAGCAGG + Intergenic
1021264199 7:18498772-18498794 AAGAATGCTAAGAGGCAAGCAGG - Intronic
1022752901 7:33250934-33250956 ACGTGTTCTAAGATGGAGGTGGG + Intronic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1026929415 7:74215562-74215584 ACGTCTGCTAAGTGGAAAGATGG - Intronic
1031681566 7:124681129-124681151 ACGGGTGCTAAGTAGGAAACAGG + Intergenic
1038437104 8:27543880-27543902 ACGGGTGCTCAGAGGGAAGACGG + Intronic
1038862460 8:31402202-31402224 ACACGTGCTCACAGGGAAGCTGG + Intergenic
1042865767 8:73355734-73355756 ACCAGTGCTCAGAGGGCAGCAGG + Intergenic
1050075296 9:1856563-1856585 ACAGGTGCTTAGAGGGAAGTAGG - Intergenic
1055768339 9:79689746-79689768 ACTTGTGCTGATAGGTAAGCAGG + Intronic
1062253737 9:135611216-135611238 ACGTGTGCCAAGAGGCAGCCAGG + Intergenic
1188291510 X:28394721-28394743 ACATATGCTATGAGGGAACCAGG - Intergenic
1192442417 X:71184423-71184445 ACGTGTGTTGAGAGGGGAGGAGG - Intergenic
1197775770 X:130117867-130117889 ATGTGTCCTCAGAGTGAAGCTGG + Intergenic
1198677612 X:139147428-139147450 ACCTGTGCTGCAAGGGAAGCAGG + Intronic