ID: 1133139090

View in Genome Browser
Species Human (GRCh38)
Location 16:3731380-3731402
Sequence CCTGCTCAGCTGTGACCTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 293}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133139090_1133139105 18 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139105 16:3731421-3731443 GGGGGCAGGGTGTTGATGACAGG 0: 1
1: 0
2: 0
3: 17
4: 256
1133139090_1133139098 -4 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139098 16:3731399-3731421 CAGGGGGTCGGGGTCGACGATGG 0: 1
1: 0
2: 0
3: 3
4: 103
1133139090_1133139100 -2 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139100 16:3731401-3731423 GGGGGTCGGGGTCGACGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 129
1133139090_1133139104 5 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139104 16:3731408-3731430 GGGGTCGACGATGGGGGGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 190
1133139090_1133139103 4 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139103 16:3731407-3731429 CGGGGTCGACGATGGGGGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 142
1133139090_1133139099 -3 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139099 16:3731400-3731422 AGGGGGTCGGGGTCGACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1133139090_1133139102 0 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139102 16:3731403-3731425 GGGTCGGGGTCGACGATGGGGGG 0: 1
1: 0
2: 0
3: 17
4: 94
1133139090_1133139101 -1 Left 1133139090 16:3731380-3731402 CCATGAGGTCACAGCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 293
Right 1133139101 16:3731402-3731424 GGGGTCGGGGTCGACGATGGGGG 0: 1
1: 0
2: 2
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133139090 Original CRISPR CCTGCTCAGCTGTGACCTCA TGG (reversed) Exonic
900705938 1:4080178-4080200 TTCTCTCAGCTGTGACCTCATGG + Intergenic
900739461 1:4321966-4321988 CCTGCCCTGCTCTGACCTCCAGG - Intergenic
901112066 1:6805628-6805650 CCTGAGCAGCTGGGACTTCAGGG + Intronic
901617557 1:10553882-10553904 CCTGCACACCTGTGACATGACGG + Intronic
901757557 1:11450622-11450644 CCTGCTCAGCTGTGCCCTGGAGG - Intergenic
902216349 1:14936674-14936696 CCTGCTCAGCTGTCAGTTCCAGG - Intronic
902296681 1:15472465-15472487 CCTGCCCTACTGAGACCTCAAGG + Intronic
902838045 1:19059283-19059305 CCTGCTCTTCTGTGGCTTCATGG - Intergenic
905434440 1:37946989-37947011 CCTCCTGAGCTGTCACCACAGGG + Exonic
905580447 1:39080260-39080282 CCTGCTGAACTGTGAGCCCATGG + Intergenic
905785892 1:40757313-40757335 CACTCTCAGCTGTGAGCTCAAGG + Intronic
906286155 1:44589073-44589095 CCTGCTCAGCTGTGTGCTGCAGG + Intronic
906681098 1:47725852-47725874 CCCGCTCAGCAGTGCCCTGAAGG - Intergenic
906693869 1:47811119-47811141 CCTGCTGAGATGTGAAGTCACGG + Intronic
906706870 1:47901391-47901413 TCTGCTCAGGTGGGACCACAGGG + Intronic
911254302 1:95616489-95616511 CCTGCTCAGTTATGGACTCATGG - Intergenic
912496971 1:110098120-110098142 CTTACTCAGCTGTGTCCTCTCGG + Intergenic
912934138 1:113988051-113988073 CCTCCTCCCCTGTGGCCTCAGGG - Intergenic
915583290 1:156829219-156829241 CCTTCTCACCTGTCACCTCATGG - Intronic
916018988 1:160776563-160776585 CTTGCTCTGCTGGGACCTCCAGG + Intergenic
918661349 1:187092508-187092530 CCTGTTCAGCTTTGATTTCATGG - Intergenic
919616313 1:199813123-199813145 CCTACTCAGCTGTGGTTTCATGG + Intergenic
919787896 1:201271498-201271520 CCTGCTGGGCTGTGACATAATGG - Intergenic
920178382 1:204117394-204117416 CCTCCCCAGCTGAGACCTGAGGG + Intronic
922441271 1:225656873-225656895 CCTGAGCAGCTGAGACCACAGGG - Intergenic
923991659 1:239444509-239444531 CCTGGTGAGCTGGGACCTGAGGG + Intronic
924182171 1:241449887-241449909 ACTGCACAGCTGTGACCACTGGG - Intergenic
924660560 1:246012700-246012722 CCTGCTTTGCTGTTTCCTCAAGG - Intronic
1063045639 10:2389871-2389893 CATTCTCGGCTGTGACCTCTGGG + Intergenic
1063460430 10:6212030-6212052 CCTGCTCAGCTCGGACATCAGGG + Intronic
1063693737 10:8312645-8312667 CCTGAACAGCTGTGACCAAATGG + Intergenic
1064343509 10:14508654-14508676 CCTTCCCTGCTGTGACTTCATGG - Intergenic
1064615538 10:17151544-17151566 GCTGCTCAGTGGTGACATCAGGG + Intronic
1065047147 10:21754668-21754690 ACTGCACAGCAGTCACCTCATGG + Intergenic
1065247681 10:23775142-23775164 CCTGGTCATCTGTGAGCTAAGGG - Intronic
1067250724 10:44584543-44584565 CATGCTCAGCTCTCACCACATGG - Intergenic
1067273983 10:44818583-44818605 TTTGCTCAGCTGGGACCTCTGGG + Intergenic
1067524220 10:47028564-47028586 CCTGCCCACCTCTGACCTCCAGG + Intergenic
1068509369 10:57944791-57944813 CCTGCTGAGCTGGGACTACAGGG - Intergenic
1072713764 10:97735893-97735915 CCTGCTCACCTGTGACATCCTGG - Intergenic
1073325165 10:102639991-102640013 CCTCCTCACCAGTGACCTCCAGG - Intergenic
1074955803 10:118388181-118388203 TCCACTCAGCTGTGACCTCCCGG + Intergenic
1075409774 10:122218895-122218917 CCTGAGCAGCTGGGACCACAGGG - Intronic
1075805730 10:125187556-125187578 CTGGCTGAGCAGTGACCTCAAGG - Intergenic
1075934112 10:126325006-126325028 CCCTCTCAACTGTGACCTCATGG - Intronic
1076451102 10:130557563-130557585 CCTGCACAGACGTGACCTCCTGG + Intergenic
1076749615 10:132536247-132536269 CCTGCTCAGCGGTGGCCGTAAGG + Intergenic
1077268189 11:1662389-1662411 CCTCCTCAGCAGTGACCCCAGGG + Intergenic
1077272693 11:1689229-1689251 CCTCCTCAGCAGTGACCCCAGGG - Intergenic
1080543432 11:33292519-33292541 CCTTCTCTGCTGTGCTCTCAAGG - Intronic
1081206235 11:40278931-40278953 TCTAATCAGCTGTGATCTCAGGG + Intronic
1083172305 11:60930273-60930295 CCGGCTAAGCTTTGACCTTATGG + Intronic
1083651222 11:64206021-64206043 CCTGCTTAGGTGACACCTCAGGG - Intergenic
1083663836 11:64264277-64264299 CCAGCCCAGGTGTGACCTGAAGG - Intronic
1083765194 11:64838255-64838277 CCTGCACAGGTGGGAACTCAGGG + Intronic
1084185850 11:67470692-67470714 CCTGCTCAAATGTCACCTCTTGG - Intergenic
1084701428 11:70788705-70788727 CCTGCCCAGCCCTGACCCCAGGG + Intronic
1085382071 11:76128772-76128794 CCCGCCCAGCTGTGACCTTTGGG + Intronic
1088795815 11:113266001-113266023 CCTGGGCAGCTCTGACCTCGAGG + Intronic
1090234153 11:125134110-125134132 CCAGCTCAGCTGCAACCACAGGG - Intergenic
1090404153 11:126467213-126467235 CCTGCTCAGGTGCCGCCTCAGGG + Intronic
1091765557 12:3117904-3117926 CCTGCGGAGCTGTCACCTCAGGG + Intronic
1091951108 12:4593724-4593746 ACTGCTCAGCTTTCACCTTAAGG - Intronic
1092879581 12:12877640-12877662 CCAGCTCACCTGTAATCTCAGGG - Intergenic
1094386463 12:29899590-29899612 GCTGCTGAGCTGTGGTCTCAGGG - Intergenic
1096575961 12:52553000-52553022 GCTGCTCAGCTGTGCTCTCAGGG - Exonic
1096582077 12:52592167-52592189 CCTGCCAAGCTGTGAACTCCTGG + Intronic
1096585743 12:52618447-52618469 GCTGCTCCGCTGTGCTCTCAGGG - Exonic
1098090677 12:66897497-66897519 CTTCCTCAGCTGTAACCTCTGGG - Intergenic
1099687732 12:85910803-85910825 ACTGCTGAGCTGTCACCTGATGG - Intergenic
1100121982 12:91379160-91379182 CCTGCTCTCCTCTCACCTCATGG - Intergenic
1101998886 12:109544399-109544421 CCTGCTCACCTTTGGCCTCATGG - Intergenic
1102502116 12:113359744-113359766 GCTGCTCAGCTGTGTCCCTAAGG - Intronic
1104726318 12:131077643-131077665 GCTGCTCAGCTGTGGCCCCTGGG + Intronic
1104942753 12:132402589-132402611 GCTGGGCAGCTGTGGCCTCAGGG + Intergenic
1106548015 13:30747095-30747117 CTGGCTCAGCTCTGCCCTCATGG - Intronic
1109649696 13:65309964-65309986 ACTGCTCAGCATCGACCTCAAGG - Intergenic
1111380728 13:87447225-87447247 CCTGATCAGCTGTCATGTCAAGG + Intergenic
1113029515 13:105977750-105977772 CCTGTTCACCTTTGACCTCAAGG + Intergenic
1113770115 13:112902852-112902874 CCTGCCCAGCTCTCACCTCGGGG - Intronic
1113772266 13:112917706-112917728 CCTGTTCAGCTCTGACCTGGAGG + Intronic
1113790097 13:113023754-113023776 TCTGCTCAGCTGTGTCCTCATGG + Intronic
1114528163 14:23379077-23379099 CCTTTGCAGCTGTGACCTCCCGG + Exonic
1114645289 14:24252662-24252684 CCTTCTCAGCTTTGGCCTAATGG + Intronic
1115117053 14:29893946-29893968 CCTGCATATCTTTGACCTCATGG + Intronic
1115532334 14:34339096-34339118 CCTGAGCAGCTGGGACCACAGGG + Intronic
1117078460 14:52127454-52127476 CTTTCACAGCTGTGAACTCAAGG + Intergenic
1117356117 14:54925373-54925395 CTTGCTCTGCAGTGTCCTCAGGG - Intergenic
1119331939 14:73801345-73801367 TCTGCTCACATGTGATCTCAAGG + Intergenic
1121020779 14:90578849-90578871 CCTGGTCAGAGGTGAGCTCAGGG - Intronic
1121307353 14:92915418-92915440 GCTGCTGAGCTTTGACCACAGGG + Intergenic
1121426657 14:93857016-93857038 CCTGCTTAGCTGCGTCCCCAAGG + Intergenic
1121953506 14:98193325-98193347 CCTGGTCATCCCTGACCTCAAGG - Intergenic
1122165289 14:99818667-99818689 ACTCCTCAGCTGACACCTCAAGG - Intronic
1122182891 14:99968770-99968792 GCTCCTCAGCAGTGACCCCAGGG + Intergenic
1122454039 14:101835744-101835766 CCTGCACAGCCGTCCCCTCACGG + Intronic
1123030172 14:105447852-105447874 CCTGCTTCTCTGTGAGCTCATGG + Intronic
1123191854 14:106579202-106579224 ACTGCCCAGCTGGGATCTCAGGG - Intergenic
1124072614 15:26409973-26409995 CCTCCTCAGCTGTGGCATCCTGG + Intergenic
1124365178 15:29065965-29065987 GCTGCTCGGGTGTGACGTCAGGG + Intronic
1125421953 15:39512794-39512816 CCTGCTCTGCTGTTCCCTGAAGG - Intergenic
1125503857 15:40255557-40255579 TCTGCTCAGCTGTCACCTGCGGG - Intronic
1125733801 15:41909698-41909720 CCTGCATAGCCTTGACCTCAGGG + Exonic
1126817380 15:52466906-52466928 CCTGTGCAGCTGTGATGTCATGG - Intronic
1127027106 15:54819022-54819044 CCTCCTCATCTGTGACATGAGGG + Intergenic
1127260247 15:57322235-57322257 CCTTCTCAGCTTTGAGCTGAAGG + Intergenic
1129117783 15:73374879-73374901 TCTGCTCAGCTGGCACCTCAGGG - Intergenic
1129674620 15:77625785-77625807 CCTGCTGAGCTGTGTCATCTTGG + Intronic
1130520551 15:84658056-84658078 CCCGCTCAGCTGGGATCTCCCGG - Exonic
1131101340 15:89692207-89692229 CCTTCTCAGCTTTCACCTGAGGG - Intronic
1131120975 15:89823368-89823390 CCTGCCCTGCTGCCACCTCAGGG - Intergenic
1131226166 15:90626004-90626026 CCTGCTTAGCAGTGACCTGGTGG + Intronic
1131716892 15:95121421-95121443 CCTGGGCAGCAGTCACCTCAAGG + Intergenic
1132156569 15:99499929-99499951 CTTGCTCAGCTCTGAGCTGATGG - Intergenic
1132423460 15:101693867-101693889 CCTCCCCAGCCCTGACCTCAGGG - Intronic
1132463152 16:65481-65503 TTTGCTCAGCTGTTACTTCATGG - Intronic
1132567365 16:629692-629714 CCAGCTCAGCTGTGACCTCCGGG - Intronic
1132594037 16:740242-740264 CCTGCTCAGCTCTGGCCCCGCGG + Intronic
1132645982 16:999495-999517 CAGGGTCAGTTGTGACCTCACGG - Intergenic
1133139090 16:3731380-3731402 CCTGCTCAGCTGTGACCTCATGG - Exonic
1133342431 16:5045331-5045353 CCTGGTCCCGTGTGACCTCATGG + Intronic
1133622236 16:7537451-7537473 CTTGTTCAGCTATGACCTCAGGG - Intronic
1135492534 16:22922326-22922348 CAGGCTCTGCTGTCACCTCATGG - Intergenic
1136045090 16:27609105-27609127 CCTGCTCAAATGTGTCCTCATGG + Intronic
1137667429 16:50259888-50259910 TCTTCTCAGCTGTGGGCTCAGGG - Intronic
1138569072 16:57856354-57856376 CCTGAATAGCTGGGACCTCAGGG - Intronic
1141422644 16:83926589-83926611 GCTGCCCAGCTGTGAACACAAGG + Exonic
1141984553 16:87571334-87571356 TTTGCTCAGCTTTGAGCTCACGG + Intergenic
1142126190 16:88411823-88411845 CCTGTTCAGCTGTGACAGAAAGG - Intergenic
1142133034 16:88439458-88439480 CCACCTCAGCTCTGACATCAAGG - Exonic
1142624737 17:1184546-1184568 CCAGCACAGCTATGACCACATGG + Intronic
1142814244 17:2412772-2412794 CCTGCTCAGCAGTGCCCTCTGGG + Intronic
1142953321 17:3502684-3502706 ACTGCTCTGCACTGACCTCATGG + Exonic
1143024619 17:3934296-3934318 TCAGTTCAGCTGTGACCTCCTGG + Intronic
1143314144 17:6018823-6018845 CCTGGTCAGTGATGACCTCAGGG + Intronic
1143455497 17:7065098-7065120 TCTGCTCAGCTTTGCCTTCACGG - Intergenic
1143601827 17:7951905-7951927 CCTGCTCAGCTGTGTCAGAACGG + Intergenic
1143675082 17:8426660-8426682 CCTGCTGATCTGGAACCTCACGG - Intronic
1144135406 17:12290424-12290446 CCTGCTCTCCTGCTACCTCATGG + Intergenic
1144608740 17:16690180-16690202 CCTGCCCACCTGTGACATCACGG - Intergenic
1144904076 17:18625647-18625669 CCTGCCCACCTGTGACGTCACGG + Intergenic
1145018525 17:19413608-19413630 CCTGCTCAGCTCAGGGCTCATGG - Exonic
1145128512 17:20321095-20321117 CCTGCCCACCTGTGACGTCACGG - Intergenic
1145753415 17:27372096-27372118 CCTCCTGAGCTGTGACACCAAGG + Intergenic
1146257754 17:31401377-31401399 GGTCCTCAGCAGTGACCTCAGGG - Intronic
1147387971 17:40092788-40092810 CCAGCTCAGCTGTGAACTATTGG + Exonic
1148606139 17:48930495-48930517 CCTCCTCAGCTGTAATCTCCTGG + Exonic
1149644311 17:58228686-58228708 CCTGCTCAGCTGGGAGCTTGGGG - Intronic
1150142867 17:62744658-62744680 CCAGCTCTTCTGTGACCTCCTGG - Intronic
1150453194 17:65286690-65286712 CCTGGCCAGCTGAGACCACAAGG + Intergenic
1150593849 17:66586207-66586229 GCTCCTCAGCTGTGATCTCCAGG - Intronic
1151872491 17:76845778-76845800 CCAGCTCAGAGCTGACCTCACGG + Intergenic
1152193608 17:78903230-78903252 GCTGTTGAGCTGTGACATCATGG + Intronic
1152278480 17:79371795-79371817 CCTGGTCAGCCGTGCCCTGAGGG + Intronic
1152423813 17:80208270-80208292 CCTGCTCAGCTGTGTCCGCCAGG + Exonic
1152987496 18:334058-334080 CCTGCGTAGCTGGGACCACAGGG - Intronic
1154207085 18:12346504-12346526 CCTGATAAGCTGTGGGCTCATGG + Intronic
1155154727 18:23148717-23148739 TCAGGTCAGCTGTGACCTCACGG + Intronic
1156335870 18:36170881-36170903 ACTGCTCTCCTGTGTCCTCAAGG - Intronic
1157600817 18:48892222-48892244 CCTGCTCTGCTGGGCCCTGATGG - Intergenic
1157828708 18:50836479-50836501 GCTGCTCAGGGGTGACATCAAGG + Intergenic
1158036570 18:53038982-53039004 CCTAATCAGCTGTCACATCAGGG + Intronic
1158591550 18:58782854-58782876 CCTGCACTGCTGTGATCTCAGGG - Intergenic
1159738174 18:72130346-72130368 CCTGCTGAGCTGGGACATGAGGG + Intergenic
1159914711 18:74178365-74178387 CCTGGTCAGCTTAGCCCTCATGG - Intergenic
1160411429 18:78677830-78677852 CCAGCTCTGCAGTGACCTCTCGG + Intergenic
1161193112 19:2970547-2970569 CTCACTCAGCTGTGACCTCCTGG - Intergenic
1161408040 19:4101342-4101364 ACTGCTCAGCTCTGACCCCCGGG - Intronic
1161606842 19:5219816-5219838 TCTGCCCAGCTCTGACCACAGGG + Intronic
1162058985 19:8083330-8083352 CTTGCTCACCTGTGTGCTCATGG - Exonic
1162155794 19:8677344-8677366 CCTCTTCAGCTGTCACCTCTTGG + Intergenic
1163607305 19:18282084-18282106 CCTGCTCTGCTGTGCCGCCAGGG + Intergenic
1164945156 19:32287267-32287289 CCTGGTCTGCTGTTACCCCAGGG - Intergenic
1167326335 19:48828491-48828513 CCTGAGCAGCTGGGACCACAGGG - Intronic
1167590704 19:50402903-50402925 CCTGCTCTGCTCTCACCTCCAGG - Intronic
1167706889 19:51086479-51086501 GCTGCTCCTCTGTGAACTCACGG + Intergenic
1168181842 19:54666908-54666930 CCTGCTGTCCTGGGACCTCATGG + Intronic
1168331263 19:55570596-55570618 CCTGAGCAGCTGGGACCACAGGG - Intergenic
1168666721 19:58210001-58210023 CCTGCTGGGCAGTGACCTCGAGG - Exonic
925302956 2:2829925-2829947 CCTGCTGAGCTGTGCTCTCCCGG - Intergenic
927554420 2:24022216-24022238 CCTGCTCAGCTGTGATCAGGTGG - Intronic
931724225 2:65093467-65093489 CCTGTTCAGGTGTGACATCTGGG - Intronic
932596252 2:73095472-73095494 TCTGCTCAGGTGTGGCCTCTGGG - Intronic
933816027 2:86069477-86069499 TCTGGACAGCTGTGACCACAAGG + Intronic
934949676 2:98567698-98567720 CCAGCTCACCAGTGACCTCAGGG - Intronic
936465879 2:112749827-112749849 CCTGCTCAGCTCTGCCAGCAGGG + Intronic
937449849 2:121993009-121993031 CTTGCTCACCTTTGACCTCTTGG + Intergenic
939241226 2:139562350-139562372 CCTTCACAGCTATGGCCTCAGGG + Intergenic
939678067 2:145096876-145096898 CCTGCTCACCTCTGAGCTCTAGG + Intergenic
940729766 2:157375479-157375501 CCTGCTAGGCGGTGCCCTCATGG + Intergenic
942454027 2:176125386-176125408 CCTGACCAGCTGGGACCTCCCGG - Intergenic
943444182 2:187962887-187962909 CCTTCTCAGCTGTGACATGGGGG + Intergenic
944081551 2:195794112-195794134 CCTGCTCAGCTGAGATCTTATGG - Intronic
946099339 2:217305824-217305846 CCTGCCATGCTGTGACATCAGGG - Intronic
946529541 2:220557129-220557151 CCTGGTCAGCTCTGGCCCCAAGG - Intergenic
947122867 2:226835856-226835878 CCTGCCCCGCTGTGCCCTCGCGG + Intronic
947379322 2:229529882-229529904 CCTGAGCAGCTGGGACCACACGG - Intronic
948104148 2:235399624-235399646 CCTCCTCAGCTTGGACTTCATGG - Intergenic
948692546 2:239715748-239715770 CCTGCTCTGCTGTGGCCTCCTGG - Intergenic
1169288122 20:4326427-4326449 CCTGTTCTTATGTGACCTCAGGG - Intergenic
1169847111 20:10005952-10005974 TCTGAACAGCGGTGACCTCAAGG - Intronic
1170795985 20:19546977-19546999 ACCTCTCAGCTGAGACCTCAGGG - Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172275586 20:33677210-33677232 CCTCCTCAGAAGTGACCTCCTGG + Exonic
1173384094 20:42572421-42572443 CCTTCTCTGCTGTGGCCACATGG + Intronic
1173660503 20:44729975-44729997 GCGGCTCAGCTGTGAGGTCATGG - Intergenic
1173726139 20:45299281-45299303 CTTGCTCTGCTCTGTCCTCATGG - Intronic
1175540164 20:59743338-59743360 CCTGCTGATCTGTGACTTCCTGG + Intronic
1176009998 20:62888105-62888127 GGTGCCCAGCTGTGCCCTCAGGG - Intronic
1176076918 20:63252855-63252877 GCTGGTCGGATGTGACCTCAGGG - Intronic
1176189966 20:63803830-63803852 CCTGAGCAGCTGGGACCACAGGG + Intronic
1176268354 20:64222394-64222416 CGTGCCCAGCTGCGGCCTCAGGG - Intronic
1181430507 22:22878730-22878752 CCTGCTGATGTGTGACCTCAGGG + Intronic
1183684045 22:39351245-39351267 CAAGGCCAGCTGTGACCTCAGGG + Intronic
1184041003 22:41943609-41943631 CCTGCTCTACTGTGACCTGGAGG - Exonic
1184074595 22:42168346-42168368 CCTGGCCAGCTGTGCCCTGAAGG + Intronic
1184486619 22:44783626-44783648 CTTGCACAGCTCTGGCCTCAGGG - Intronic
1184696062 22:46139752-46139774 CCTCCCCAGCTGTGCCCTCGTGG - Intergenic
949855337 3:8456370-8456392 CCTTCTCAACTGTGATCTCCTGG - Intergenic
949876506 3:8629377-8629399 CCTGCTTGGCTCTGACCTCTAGG - Intronic
949950588 3:9225680-9225702 CCTGCGCTGTTGTGACCTTAAGG - Intronic
950179920 3:10904250-10904272 CCTTCCCAGCTATGACCACAGGG - Intronic
953775994 3:45817899-45817921 CCTGCACTGCAGTGCCCTCAGGG - Intergenic
956011292 3:64834373-64834395 CTTGCTCAGCTCTCAGCTCATGG + Intergenic
959845716 3:111030939-111030961 CCTGCTGAAATGTGACCTCTTGG + Intergenic
963963006 3:151331295-151331317 GCTTCTCAGCTGTGTCTTCAAGG - Intronic
965554708 3:170007020-170007042 CCTGCTTAGCTTTTACCTCTCGG - Intergenic
967409239 3:189150831-189150853 TCTGCTCATCTCTGCCCTCAGGG - Intronic
970014969 4:11503409-11503431 CCTGCTGAGCTGTGCCTTCCAGG + Intergenic
970195511 4:13547334-13547356 CGGGCTCAGCTGTGAGCTCCAGG + Intergenic
970515172 4:16821978-16822000 CCTGCTCAGCTGAAAGCTCTTGG - Intronic
971288503 4:25312915-25312937 CCCGCCCCGCTGTGCCCTCACGG + Exonic
971660457 4:29407690-29407712 CTTGCTCACCTGTGACTTCCAGG - Intergenic
972233010 4:37097256-37097278 CCTGCTAAGATGTGACGGCAGGG + Intergenic
972333002 4:38080797-38080819 CCTGCTCAGCTGTCTCCTTAGGG + Intronic
973627783 4:52790278-52790300 CCTGAGCAGCTGGGACCACAAGG + Intergenic
974673656 4:65063122-65063144 CCTGCTAATCTGAGACCTAAAGG - Intergenic
974747964 4:66101163-66101185 CTTTGTCAGCTGTCACCTCATGG + Intergenic
974815950 4:67003738-67003760 ACTGGGCAGCTGTGACCCCATGG + Intergenic
981600706 4:146485413-146485435 CCTGTTTTGCTGTGACCACAAGG - Intronic
984791342 4:183617517-183617539 CCTGAGCAGCTGGGACCACAGGG + Intergenic
984961395 4:185101471-185101493 CCTGCGCCTCAGTGACCTCATGG - Intergenic
985823549 5:2177367-2177389 ACTGTCCAGCAGTGACCTCAGGG + Intergenic
985829201 5:2215482-2215504 CGTGTTCAGCTGTGGCCTCATGG + Intergenic
986022931 5:3821727-3821749 CCTGCTCACCTGTGCCCTGGGGG + Intergenic
991304227 5:65159611-65159633 CCTGCTCCTCTGTGCACTCATGG + Intronic
992590791 5:78294332-78294354 CCTGCCCTGCTCAGACCTCAGGG + Intronic
993875884 5:93306241-93306263 ACTGCTCACCAGTGTCCTCAGGG + Intergenic
999273756 5:150314560-150314582 CCTGCTCCACAGTGTCCTCAGGG + Intronic
999430937 5:151524854-151524876 TCTGCTCAGATGTCACCTCCTGG + Intronic
999435746 5:151562094-151562116 CCTGTTAACCTTTGACCTCAGGG - Intronic
1000516752 5:162245774-162245796 TCTGCTCAATTGTGACCACAGGG - Intergenic
1001600818 5:172926962-172926984 CCCAGTCAGCTGTGACCACATGG + Intronic
1002118849 5:176985727-176985749 CCTGTGCAGCTGGGACCACAGGG + Intronic
1002816758 6:688276-688298 CCAGCTCAGCTGGGCCATCAAGG - Intronic
1004505979 6:16246948-16246970 CCGCCTCACCTGTGACATCACGG - Exonic
1005510133 6:26505273-26505295 CCTGCCCAGATGTGACCTCATGG + Intronic
1006239093 6:32661864-32661886 CCAGCTCAGTAGTGACATCAGGG + Intronic
1006626527 6:35401878-35401900 CCTTCTCAGCTAAGACCACAGGG - Intronic
1007424360 6:41737058-41737080 CCTGCTCAGCTCTGAGCCCTGGG + Intronic
1007506491 6:42339130-42339152 GCAGTTCAGCAGTGACCTCAAGG - Intronic
1007789173 6:44299155-44299177 CCTGCTCACATGTCACCTCTTGG + Intronic
1007791447 6:44311238-44311260 CTTGCTGAGCTGTGACTTGAGGG - Intronic
1008481977 6:51995225-51995247 CTTGCTGAGCTGTGGCCTGATGG - Intronic
1008556940 6:52681582-52681604 ACTGCACTGCTGTGCCCTCAGGG + Intronic
1011701142 6:89956061-89956083 ACTGGTCAGCAGTGGCCTCAAGG + Intronic
1011772991 6:90695562-90695584 CCTCCTCCACTGTGACCTGAAGG - Intergenic
1012279355 6:97310517-97310539 CCTGCTATGCTCTGACCTGATGG + Intergenic
1013306070 6:108848307-108848329 CCTGCTCTGATCTGACCTCCCGG + Intergenic
1014836956 6:126170697-126170719 CCCGCTGATCTGTGCCCTCATGG + Intergenic
1015446774 6:133315200-133315222 CCTGCACAGCTGTGTAGTCAGGG + Intronic
1016345197 6:143105790-143105812 CCTGCACAGCTAAAACCTCAAGG - Intronic
1017007985 6:150041772-150041794 CCCACTCACCTGTCACCTCAGGG + Intergenic
1018177422 6:161189324-161189346 TCACCTGAGCTGTGACCTCAGGG - Intronic
1018391540 6:163345181-163345203 CCTGCTCAGCTCTAAGCTCTAGG - Intergenic
1018434432 6:163748226-163748248 CCTGCTCAGCTTTGTCCCCTGGG + Intergenic
1019435596 7:1020703-1020725 CCTGTTCACCTCTGATCTCAGGG + Intronic
1019707792 7:2504804-2504826 GCTGCTCAGGTGTGTCCACAGGG - Intergenic
1019825614 7:3281891-3281913 CCTTCTCAGCTGTGAGATCCAGG - Intergenic
1021559219 7:21952731-21952753 CCTGAGCAGCTGGGACCACAAGG - Intergenic
1026534398 7:71228195-71228217 CCTGCTTGGCTGGGACATCAGGG - Intronic
1026534629 7:71229642-71229664 CTTGCTCAACTGGGACATCAGGG - Intronic
1026686190 7:72512156-72512178 CCTGAGCAGCTGGGACCACAGGG - Intergenic
1027262453 7:76474727-76474749 CCTGCCCAGCTGTGAGCCCCGGG - Intronic
1027313829 7:76972819-76972841 CCTGCCCAGCTGTGAGCCCCGGG - Intergenic
1029023137 7:97386255-97386277 CTTCCTCAGCTGTGACAACATGG - Intergenic
1032022448 7:128416432-128416454 CCTGAGTAGCTGTGACCACAGGG - Intergenic
1033326432 7:140382542-140382564 CCTTCTCACCTTTGACCTTAAGG + Exonic
1035227154 7:157439927-157439949 CCTCCTTAGCTGTCACCTCCAGG + Intergenic
1035420178 7:158723437-158723459 CCTGGTCTGCGGTGCCCTCATGG + Intergenic
1035421633 7:158734239-158734261 CTTTCTCAGGTATGACCTCACGG - Exonic
1036213745 8:6863107-6863129 CCTGCTCAGCTCTGCCCACAGGG + Intergenic
1039546509 8:38414672-38414694 CCTTCCCACCTGTGCCCTCATGG - Intronic
1043306861 8:78805643-78805665 CCTGCTCAGGTGAGACCTCAAGG + Intergenic
1047269654 8:123343856-123343878 TCTGCTCAGATATCACCTCAGGG - Intronic
1048941493 8:139404271-139404293 GCTGGTCAGCTGGGACCTCAGGG + Intergenic
1048974530 8:139663527-139663549 CCTGCACAGGTGTGTCCTCAGGG - Intronic
1049102577 8:140590165-140590187 CCTGCACAGCTGTGACGCCTGGG - Intronic
1049155458 8:141063584-141063606 CCTCCTCAGCCTTGACCTCCTGG - Intergenic
1049178589 8:141208747-141208769 CCGGCCCAGCTGAGAGCTCACGG + Intronic
1049389894 8:142362251-142362273 CCAGCGGAGCTGTGGCCTCAGGG + Intronic
1049425818 8:142537463-142537485 CCTGCTCAGCTGCCACCTAGGGG + Intronic
1049675877 8:143888812-143888834 CCGGCTGAGCTGTGGCCTGAGGG + Intergenic
1051633380 9:19160217-19160239 CTTCTTCAGCTGTGTCCTCAAGG - Intergenic
1055913061 9:81373454-81373476 GCTGCTCAGTTGAGAGCTCAGGG - Intergenic
1056512820 9:87321804-87321826 CCTGCTCACCTGAGCTCTCATGG - Intergenic
1057008281 9:91580334-91580356 CCTGTTCAGCAGTCACCACAGGG + Intronic
1057461136 9:95263205-95263227 CCTGCCCTGCTGTCTCCTCAGGG + Intronic
1058947828 9:109875421-109875443 CTTCCTGAGCTGTGACTTCAGGG + Intronic
1059320629 9:113465677-113465699 CCTGCCCAGCCATGGCCTCAGGG + Intronic
1059412237 9:114139625-114139647 CCAGGTCAGCTTTGACCACAGGG + Intergenic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1062103932 9:134742461-134742483 CCTGCTCACCAGTCACCTGAGGG - Intronic
1062337295 9:136077656-136077678 CCTGCTCAGGTGTCACCGCCTGG - Intronic
1062351519 9:136141984-136142006 CCTGCCCAGCTCTGGCCTCCTGG + Intergenic
1062382257 9:136292110-136292132 CCTGCTCTGCTGTGGCATCTGGG - Intronic
1189316552 X:40061054-40061076 CATGCTCAGCTGTGGGCTCCCGG - Intronic
1191782665 X:64885498-64885520 CCTGAGCAGCTGGGACCACAGGG - Intergenic
1192194279 X:69018297-69018319 TCTGCTAAGCCATGACCTCAAGG + Intergenic
1192315233 X:70046017-70046039 CATGCACAGCTGTCACCTCCAGG - Intronic
1193679868 X:84505049-84505071 CCTTCTCAGATGGGACTTCATGG + Intergenic
1196001739 X:110794627-110794649 CTTGCCCAGCTGTGACTGCAAGG + Intronic
1196393795 X:115237867-115237889 ACTGCTCTGCTGTTAACTCATGG - Intergenic
1197279956 X:124523612-124523634 CCTTCTTAGCTTTGACCTCGTGG - Exonic
1198891918 X:141406116-141406138 CCTGCAGAGGAGTGACCTCAGGG + Intergenic
1200043500 X:153387514-153387536 CCTGCTCTGCTCTGTCCTCCTGG - Intergenic
1200062670 X:153490520-153490542 CATGCTCAGCGGGGACCTCTGGG - Intronic
1200366464 X:155670971-155670993 CATCCACAGCTGTGAGCTCATGG + Intergenic