ID: 1133139179

View in Genome Browser
Species Human (GRCh38)
Location 16:3731771-3731793
Sequence ATGGAGAAGCACAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 414}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133139179_1133139187 2 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139187 16:3731796-3731818 TGGCATACAGCTTCTGGGACAGG 0: 1
1: 0
2: 0
3: 13
4: 166
1133139179_1133139190 19 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139190 16:3731813-3731835 GACAGGTCATTGGACACGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 39
1133139179_1133139189 18 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139189 16:3731812-3731834 GGACAGGTCATTGGACACGTTGG 0: 1
1: 0
2: 0
3: 2
4: 58
1133139179_1133139188 9 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139188 16:3731803-3731825 CAGCTTCTGGGACAGGTCATTGG 0: 1
1: 0
2: 3
3: 16
4: 186
1133139179_1133139186 -3 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139186 16:3731791-3731813 CATGGTGGCATACAGCTTCTGGG 0: 1
1: 0
2: 3
3: 23
4: 168
1133139179_1133139185 -4 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139185 16:3731790-3731812 CCATGGTGGCATACAGCTTCTGG 0: 1
1: 0
2: 2
3: 8
4: 143
1133139179_1133139191 27 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139191 16:3731821-3731843 ATTGGACACGTTGGGCATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 238
1133139179_1133139192 28 Left 1133139179 16:3731771-3731793 CCTACCTCCTTGTGCTTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1133139192 16:3731822-3731844 TTGGACACGTTGGGCATGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133139179 Original CRISPR ATGGAGAAGCACAAGGAGGT AGG (reversed) Exonic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903790035 1:25886535-25886557 AGGGAGCAGCACATGGAGGGTGG - Intronic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
905251383 1:36650932-36650954 AGGCAGAGGCAGAAGGAGGTTGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905809084 1:40898939-40898961 ATGGAGAAGGATCAGGAGCTAGG - Intergenic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906665639 1:47619872-47619894 GTAGACGAGCACAAGGAGGTTGG + Intergenic
907274329 1:53308912-53308934 ATGGTGAGGCACAGAGAGGTGGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
909603211 1:77482323-77482345 ATGGAGTAGCCCATGGTGGTTGG - Intronic
913228010 1:116717536-116717558 AGTGAGAAGTACAAGGAGGTGGG - Intergenic
914310542 1:146462120-146462142 TTGGAGGGGCACAAGGAAGTTGG - Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915360516 1:155283913-155283935 ATGGAGGAGGACAAGCAGGGAGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915797640 1:158753441-158753463 AAGTAGAAGTAAAAGGAGGTTGG - Intergenic
915937321 1:160097233-160097255 AGGGAGGAGCCCAGGGAGGTGGG - Intronic
916678007 1:167080465-167080487 AGAGAGAAGCACTAGGAGGCAGG - Intronic
918662777 1:187109504-187109526 ATGGGAAAGCATAAGGAGATAGG - Intergenic
918948278 1:191099263-191099285 TTACAGAAGCACAAGTAGGTAGG + Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919920439 1:202163815-202163837 CTGGAGAAGCACTAGGATCTCGG + Intergenic
920193795 1:204212876-204212898 TTGAAGAACAACAAGGAGGTGGG - Intronic
920517438 1:206596608-206596630 ATGCAGAAGCAAAAGAAGGCTGG - Intronic
921021006 1:211235621-211235643 TTGGAGGATCACAATGAGGTTGG + Intergenic
921217649 1:212951096-212951118 ATGGAGGGGCACAAGGAGCTTGG - Intronic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922051126 1:221991566-221991588 TTTGAGAAGCACTTGGAGGTGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922979797 1:229816135-229816157 TTTGAGAATCACAAGGGGGTGGG - Intergenic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
924175950 1:241391259-241391281 AAGGAAAAGCACAAGGCTGTGGG + Intergenic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064366790 10:14715789-14715811 CTTGAGAACCACCAGGAGGTTGG - Intronic
1065965452 10:30766899-30766921 ATGGAGGAGAACGAGGAGGCGGG - Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1067766066 10:49088413-49088435 ATTGAGCAGGTCAAGGAGGTTGG - Intronic
1068046754 10:51895809-51895831 ATGGAGAAAGACAAGGACCTTGG + Intronic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1069234962 10:66059586-66059608 ATTGAGGAGAACAAGGAGATGGG - Intronic
1069572574 10:69503350-69503372 ATGGAGGAGCACAAGAATGCTGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070814047 10:79312263-79312285 ACGTGTAAGCACAAGGAGGTGGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1072428225 10:95348310-95348332 ATAGAAAAACACAAGGAAGTAGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1075780218 10:125012542-125012564 ATGCAGAGGCACAGGCAGGTGGG - Intronic
1075923081 10:126229183-126229205 AGGGAGAGGAACCAGGAGGTGGG + Intronic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077767156 11:5171326-5171348 ATTGAGAAGCACATGGAGACTGG + Intronic
1078003364 11:7514418-7514440 CTGGAGATGCGCAGGGAGGTGGG + Intronic
1079397955 11:20082294-20082316 AATGAGAAGCACAGGAAGGTGGG + Intronic
1079693907 11:23454823-23454845 TTGGAGAAACACCTGGAGGTGGG + Intergenic
1079714822 11:23731756-23731778 GTGGGGAAGCACAAGGGGTTGGG + Intergenic
1079730768 11:23936237-23936259 ATGCAAAAACACAAAGAGGTGGG - Intergenic
1080757536 11:35216495-35216517 ATGGAGGAGCACTAGGAGGTAGG + Intronic
1080874547 11:36264164-36264186 ATGGAGAAGCCCGGGAAGGTGGG + Intergenic
1080990814 11:37532497-37532519 ATAGAGAAGCACAAAGACATGGG - Intergenic
1081101714 11:39010335-39010357 ATGGAGAAGCCAAAGGAAATAGG - Intergenic
1081145360 11:39556850-39556872 ATAGAGAAGCTCAAGAAGTTTGG + Intergenic
1081584901 11:44377446-44377468 AGGAAGGAGCACAACGAGGTTGG - Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083541011 11:63511513-63511535 AGGGAGAAGGACATGGTGGTCGG + Intronic
1084211444 11:67625341-67625363 ATGCAAAAACACAAAGAGGTGGG + Intergenic
1084287299 11:68140589-68140611 AAGGAGGAGCTCAAGGAGGCAGG + Intergenic
1088133774 11:106528707-106528729 ATTGAAAAGAACAAGGAGGTGGG + Intergenic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1088353768 11:108920205-108920227 ATGGTGATGAACAAGAAGGTAGG + Intronic
1088771166 11:113037297-113037319 ATGGAGAAAAACAAGAGGGTTGG + Intronic
1088883703 11:113991128-113991150 AAGAAGAAACACTAGGAGGTGGG + Intergenic
1089118861 11:116117855-116117877 GTGGAGAAGCACAGGGAAGGAGG + Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091127447 11:133113407-133113429 AGGGAGAAGAACAAGGAAGCAGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092472757 12:8793611-8793633 ATGCAAAAACACAAAGAGGTGGG + Intergenic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1092764110 12:11837083-11837105 ATCTAGAATCACAGGGAGGTGGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095168419 12:39003226-39003248 ATGGAAAAGCAGAAGGGGATGGG - Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097596326 12:61636855-61636877 ATGGATAATCACAAAGAGGCAGG + Intergenic
1099495746 12:83343677-83343699 ATAGAGATGCACAAGGACTTGGG + Intergenic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1101887254 12:108676225-108676247 ATGGAGAAGTCTGAGGAGGTTGG + Intronic
1103172802 12:118836088-118836110 ATGGAGATGGACAAGAAGGCAGG - Intergenic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1104713587 12:131002820-131002842 CTCGTGAAGCACAGGGAGGTAGG + Intronic
1104998501 12:132673995-132674017 GGGGAGAGGCCCAAGGAGGTGGG - Intronic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106743569 13:32674728-32674750 ATGCAGAAGCATATAGAGGTAGG + Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1110795929 13:79638335-79638357 TTGGAGATGCACATGGAAGTTGG - Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1111899904 13:94188083-94188105 ATGGAGAAGGGCAAGAAAGTGGG - Intronic
1112118482 13:96383762-96383784 AGAGGGAAGCACAAGGTGGTGGG + Intronic
1112467760 13:99658624-99658646 GTGGACAGGAACAAGGAGGTGGG + Intronic
1112672435 13:101655669-101655691 ATGGAGAAGCAAATGAATGTTGG - Intronic
1113518595 13:110921832-110921854 ATGCAGAAGCACCAGGGCGTGGG + Intergenic
1114836381 14:26207615-26207637 AGAGAGACGGACAAGGAGGTAGG - Intergenic
1115135831 14:30107138-30107160 CTGGGGAAGCACAAGGGGTTGGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116965941 14:51015412-51015434 ATGGAGAGGTAAATGGAGGTGGG - Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121216616 14:92253460-92253482 GTGGAGATGCACAAGGAGTCAGG + Intergenic
1122024782 14:98867839-98867861 ATGGAGGAGCACAGGCAGGCTGG - Intergenic
1122191081 14:100044194-100044216 ATTGTGAAGCAAAAGGGGGTTGG + Intronic
1122885477 14:104708570-104708592 AGGAAGGAGCCCAAGGAGGTGGG + Exonic
1123966816 15:25467664-25467686 ACAGAGAAGCTCAAGGAGCTGGG + Intergenic
1123986762 15:25653153-25653175 ATGGAGAAGAACGAGGAGAACGG - Intergenic
1124220871 15:27848505-27848527 ACGGAGAAGCACAGGGGGGTCGG + Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125458464 15:39885415-39885437 ATGGGGTAGAGCAAGGAGGTGGG - Intronic
1125664623 15:41420475-41420497 ATGGAGCAGCACAAGGTATTTGG - Intronic
1126179619 15:45772348-45772370 ATGGAGACACACACAGAGGTGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127141592 15:55983441-55983463 ATGGAGACGAACAGGAAGGTTGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128522896 15:68387119-68387141 ATGGAAAAGTAGAAGAAGGTAGG + Intronic
1128541148 15:68534213-68534235 ATGTGTATGCACAAGGAGGTGGG - Intergenic
1128638640 15:69319351-69319373 AAGCAGAAGTACAAGGAGCTGGG - Intronic
1129302723 15:74635231-74635253 AGGGAGAAGCATAAGGGGATGGG + Intronic
1129699644 15:77760246-77760268 ATGGAGAGGCTCAAGGAGGTGGG + Intronic
1129785903 15:78309895-78309917 ATGACGAAGGAAAAGGAGGTGGG + Intergenic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130846764 15:87754951-87754973 ACAGGGAAGCACAGGGAGGTGGG - Intergenic
1130849396 15:87778922-87778944 AAGGAGAAGAACAGGAAGGTAGG - Intergenic
1131509397 15:93041294-93041316 ATGCATTAGCACACGGAGGTGGG - Intronic
1132001655 15:98186615-98186637 ATAGATAAGCACATTGAGGTTGG + Intergenic
1132220947 15:100105104-100105126 CTGGAGAAGTACATGCAGGTAGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1137673561 16:50292808-50292830 ATCGAGAAGCGCCAGCAGGTGGG + Exonic
1137758345 16:50920179-50920201 ATGGAGCAGCACACGGGGCTCGG + Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1142034554 16:87855269-87855291 ATGGGGAGGCACAAGGGGGTGGG - Intronic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1143021614 17:3919625-3919647 ATGGAGGAGGACCAGGAGGGTGG - Intergenic
1143095815 17:4477767-4477789 TTGGAGCAGCACAGGGAGGTGGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143172951 17:4940593-4940615 GTGGCGGAGCTCAAGGAGGTGGG - Exonic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1146516798 17:33495765-33495787 ATGGAGAAGCATAGGGAGCCAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147377767 17:40033051-40033073 ATGGTGAAGCGCATGCAGGTGGG - Exonic
1147474869 17:40701135-40701157 AGGAAGAACCACGAGGAGGTAGG - Exonic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148966529 17:51440563-51440585 CTGGAGAAGTCCAAGCAGGTTGG + Intergenic
1148977140 17:51539383-51539405 ATGTAAAAGTACTAGGAGGTGGG - Intergenic
1149275520 17:55030468-55030490 ATGGAGATGTACAAGGGGCTGGG + Intronic
1149278318 17:55071091-55071113 AGGGAGAAGAAAAAGGAGATGGG - Intronic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1152140483 17:78533616-78533638 CTGGAGAATCCCAAGGTGGTCGG + Intronic
1152164904 17:78697070-78697092 ATGTATAAGCACAAGGACTTGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155163160 18:23211707-23211729 AAGGAGATGCACCAGCAGGTGGG - Intronic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156706200 18:39885531-39885553 ATGGAGAGGCCTAAGGAAGTGGG - Intergenic
1156964114 18:43069546-43069568 AAGGACAAAAACAAGGAGGTTGG - Intronic
1158234225 18:55295035-55295057 ATGGAGAATCAAAAACAGGTTGG + Intronic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158682905 18:59584671-59584693 ATGGTGAAGCACAAGCAAGAGGG - Intronic
1159345130 18:67192271-67192293 ATGGAGAAACAAAAAGAGATGGG - Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160824512 19:1073474-1073496 AGAGATAAGGACAAGGAGGTGGG - Intronic
1161234317 19:3190357-3190379 CGGGTGCAGCACAAGGAGGTGGG - Intronic
1161428956 19:4219741-4219763 AAGGAGAAGGACAAGAAGGTGGG + Exonic
1162724100 19:12679618-12679640 ATGGAGCAGAACACAGAGGTGGG - Exonic
1163060477 19:14757427-14757449 TTGAAGAAGAACAAGAAGGTTGG + Intronic
1164844739 19:31422338-31422360 CTGGAGAATCCCAAGCAGGTGGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165355049 19:35299461-35299483 ATGGAGGTGGACAAGGAGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166783292 19:45353237-45353259 CTGGAGAAGTACCAGGAGGTGGG - Exonic
925210986 2:2045876-2045898 ATGGAGGACCACAGGGAGGGAGG - Intronic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930381595 2:50636639-50636661 CTCTAGAAGCACAAAGAGGTAGG - Intronic
931113543 2:59139733-59139755 ATGTAGAGGCACAAAGAGATGGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
936055980 2:109262318-109262340 GTGGAAAAGCACCAGGAGGGTGG + Intronic
937936401 2:127249159-127249181 ATGGAGGAGCTCCTGGAGGTGGG - Intergenic
939133564 2:138267244-138267266 ACAGAGAAGCACAAGGACCTGGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939941922 2:148361868-148361890 CTGGGGAAGCACAAGGGGTTGGG + Intronic
940814791 2:158286554-158286576 ATGAAGAAGAACAACAAGGTAGG + Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
944729433 2:202502247-202502269 ATGCAAAAACACAAAGAGGTGGG + Intronic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
945927332 2:215819202-215819224 CTCAAGAAGCACAAGGAGTTGGG + Intergenic
946355863 2:219184185-219184207 AGGAAGATGCACAAGGATGTGGG + Exonic
946749995 2:222884619-222884641 ATAGAGAGGCAGAAGGAGATTGG - Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947574699 2:231263552-231263574 ATGTAGTAGTACAGGGAGGTGGG - Intronic
948224335 2:236297357-236297379 ATGGAGGAGGACAGGGGGGTGGG + Intergenic
1168971226 20:1932282-1932304 ATAGAGCAGATCAAGGAGGTGGG + Intronic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170224475 20:13976467-13976489 ATTGAGAAAGACATGGAGGTGGG + Intronic
1170294164 20:14806334-14806356 CTGAAGAAGCACAAGGGGTTGGG + Intronic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173761777 20:45567718-45567740 ACGTAAAAGCACAGGGAGGTTGG + Intronic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1173939948 20:46902113-46902135 AGGGGGAAGCACAGAGAGGTTGG + Intronic
1174595541 20:51680462-51680484 ATGGAGGAGGACCAGGAGCTTGG - Intronic
1175308573 20:57995127-57995149 AAGGTGAGGCACAAAGAGGTTGG - Intergenic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1178116527 21:29423338-29423360 ATTGGGATGCACGAGGAGGTGGG + Intronic
1178361025 21:31948598-31948620 AGGGAGGAGAAAAAGGAGGTGGG + Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180713730 22:17857595-17857617 ATGTAGAAGCACAAAGAGCTGGG + Intronic
1181020707 22:20100730-20100752 GTGGAGAAGGACATGGGGGTGGG + Intronic
1181413479 22:22742961-22742983 AGAGAGAAACACATGGAGGTTGG + Intronic
1181500589 22:23313590-23313612 AGTGAGGAACACAAGGAGGTGGG - Intronic
1181727886 22:24824247-24824269 ATGGGCAAGGACCAGGAGGTGGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182468392 22:30532175-30532197 ATGGACAGACACAAAGAGGTCGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183333659 22:37234663-37234685 GTGGACCAGCACAGGGAGGTGGG - Intronic
1183340944 22:37281077-37281099 ACGGAGGACCACAAGGAGATAGG - Intergenic
1183602399 22:38847553-38847575 TTGGAGAAGCACCTGGAGGGAGG - Intergenic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
951178562 3:19631343-19631365 ATGGAAAATCACAATGAGATAGG - Intergenic
952635079 3:35519485-35519507 ATAGAGAGGCACAAGGAGTTAGG - Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953485323 3:43289153-43289175 CTGCAGAAGCACAAGGATGGCGG + Intronic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954038635 3:47867671-47867693 AGGGAGCAGAGCAAGGAGGTAGG - Intronic
954425621 3:50441535-50441557 AGGGGCAAGCACAGGGAGGTTGG - Intronic
955495214 3:59524203-59524225 ATGGAGAAGCACGTGGACCTGGG + Intergenic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
957661916 3:83167662-83167684 ATGGAGAAGAACATAGAGATGGG - Intergenic
958838092 3:99170898-99170920 ATGGAGAAGAACAAGTGGATTGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959834016 3:110897061-110897083 ATGGACCAGCATAGGGAGGTAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960168472 3:114431037-114431059 ATGGAGGGGCACAGGGAGGAGGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962878712 3:139555898-139555920 AAGGAGAAGGGCAGGGAGGTAGG + Intergenic
966166584 3:177025887-177025909 CTGTAGAAGCACCAGAAGGTGGG - Intronic
966834120 3:184036341-184036363 TGGGAGAAGGACAGGGAGGTAGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967549634 3:190775595-190775617 ATGAAGGAGCAGACGGAGGTGGG - Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
970239773 4:13996264-13996286 ATGGAGTAGCACATGCAGTTAGG - Intergenic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
971216505 4:24666742-24666764 AAGGAGATGCACAAGGTAGTAGG - Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
973270117 4:48254233-48254255 AGGGAGAATGACAAAGAGGTTGG + Intronic
973272924 4:48279793-48279815 ATCTAGAAGCACAAGGAGTTGGG + Intergenic
973892242 4:55378730-55378752 AAGGAGAGGTACAAGGGGGTTGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976508520 4:85880027-85880049 ATGGATCAGTACCAGGAGGTTGG + Intronic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978414172 4:108458299-108458321 AGGGATAAGCACATGGAGCTGGG + Intergenic
978602629 4:110444606-110444628 AGGTAGAAGTACAAGGAGATTGG - Intronic
980082818 4:128362445-128362467 AGGGAGAACAACTAGGAGGTGGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981649132 4:147036254-147036276 ATGGAGGAGGACAAGGAGCGAGG - Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
984237747 4:177181367-177181389 ATTGAGAAGAACACGGAGCTTGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984824566 4:183913137-183913159 ATGGAGAAGGAGAAGGATTTGGG + Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985394841 4:189531238-189531260 GTGGAGAAGCAAAGGCAGGTGGG + Intergenic
986267888 5:6206004-6206026 CCAGAGAAGCACAAGCAGGTTGG + Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988513720 5:31887504-31887526 ATGGAGGAGAGCTAGGAGGTTGG + Intronic
989023827 5:37042682-37042704 AAGGAGAAGCACCAGCATGTCGG - Intronic
989113485 5:37929640-37929662 ATGGAGACCCACAAGGACCTGGG + Intergenic
989279023 5:39620822-39620844 GTGGAGAAGAAAAAGGATGTAGG - Intergenic
989563213 5:42874736-42874758 ATAAAGAAGCACAAGGCTGTTGG - Intronic
991100665 5:62789055-62789077 ATGAAGAAGTCAAAGGAGGTAGG + Intergenic
991636422 5:68710590-68710612 TTGGAGAAGGACAAGGAGAGGGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992536612 5:77711751-77711773 ATAGACAAGCACAATGAAGTAGG - Intronic
992896897 5:81253438-81253460 ATGCAGAAGCACAGGGTGGTCGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993787474 5:92161047-92161069 ATAGACATGTACAAGGAGGTTGG + Intergenic
994095018 5:95840353-95840375 AGGGATAAGCACAAGGTGATTGG + Intergenic
994255304 5:97586654-97586676 ATGTAGAAGAACAAAGAAGTTGG + Intergenic
994414525 5:99451654-99451676 AGGGGGTAGCACAAGGAGGCGGG - Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
997385025 5:133465629-133465651 ATGGAGGAGCACAGTGGGGTTGG + Intronic
997670376 5:135666485-135666507 ATCGAGGAGCAGAAGGATGTAGG - Intergenic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
999172305 5:149605969-149605991 CTGGAGAAGGACAAGCAGGGAGG + Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999327893 5:150654698-150654720 ATGGAGATACAAAAGGAAGTCGG - Intronic
999680790 5:154058204-154058226 ATGGAAAAGCACAAGGTGTTAGG + Intronic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000122934 5:158215004-158215026 ATGGGGAAGTACAAAGAGTTGGG + Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1000441372 5:161267710-161267732 ATGGAGAAGCCCTAGGAAGCAGG - Intergenic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1001186381 5:169577627-169577649 AAGGAGAAGCACAGGGTGTTAGG + Intergenic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1003093251 6:3121991-3122013 ATGTAGAAGAAAAAGGAGATGGG + Intronic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004933010 6:20479786-20479808 ATGGACAAGAACAAGAAGGGAGG - Intronic
1005360115 6:25023738-25023760 ATGAAGAACTCCAAGGAGGTCGG + Intronic
1005411067 6:25547362-25547384 ATAAAGAAGAACAAGAAGGTTGG + Intronic
1005996168 6:30932653-30932675 AAGGAGTAGAACAAGGAGTTGGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007963541 6:45983209-45983231 ATGCAGCAGCACAGGGAGGGAGG + Intronic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008784396 6:55148498-55148520 ATGGAGAAGCACATGGTAGGTGG - Intronic
1008785037 6:55158187-55158209 CTGGGGAAGCACAAGGGGATGGG + Intronic
1011702192 6:89966322-89966344 TTGCAGAAGCACAAGAAGGGAGG - Intronic
1013956838 6:115852183-115852205 ATGGAGAAGCACAAAAAGTCAGG + Intergenic
1014754651 6:125289617-125289639 AGGGAGAGTCACTAGGAGGTTGG - Intronic
1015018392 6:128442288-128442310 AGGGAGCTGCAAAAGGAGGTAGG - Intronic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015356649 6:132285279-132285301 GTGGAAAAGCACAAGGTGTTAGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1016199238 6:141387546-141387568 ATGGAGATGTGCAAGGAGATAGG - Intergenic
1016474256 6:144409479-144409501 ATGGGAAAGCACAAGGAAGGTGG - Intronic
1018358801 6:163045027-163045049 CTGGAGTATCTCAAGGAGGTAGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1020441160 7:8218300-8218322 ATGGAGAAGTTCAGGAAGGTAGG - Exonic
1022520687 7:31005120-31005142 AGGGAGAAGTTCAAGGACGTTGG + Intergenic
1023602247 7:41891637-41891659 ATGGAGCAGCACAAGGGTATGGG - Intergenic
1024213481 7:47227340-47227362 ATGGAGATGCCCTAGGAGGTGGG - Intergenic
1024450689 7:49539419-49539441 ACGCAGAAGCAGAAGGAGATGGG + Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1026079053 7:67200906-67200928 ATTGAGAACCACAAGTAGTTTGG + Intronic
1026587029 7:71664149-71664171 ATGCAAAAGCCCAAGGATGTGGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026697773 7:72611032-72611054 ATTGAGAACCACAAGTAGTTTGG - Intronic
1027220564 7:76211266-76211288 AGGCAGAGGCACAAGGAGGCAGG + Intronic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028245014 7:88466508-88466530 AGGCAGGAGCACAAGAAGGTGGG + Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1029175799 7:98663530-98663552 ATGGAGAAGGACAGGGAAGGTGG + Intergenic
1030688834 7:112512178-112512200 ATGGAGAAGCACATAGACGGAGG - Intergenic
1030797681 7:113809061-113809083 ATGCAGAAAGGCAAGGAGGTGGG + Intergenic
1031071117 7:117162983-117163005 ATGGAGAAGCAAAACAAAGTTGG - Intronic
1031736520 7:125369300-125369322 ATGGAGAAGTACATTGAGCTTGG + Intergenic
1031812796 7:126392859-126392881 GTGGAGAAGAACAAGGAGTTTGG - Intergenic
1032411812 7:131699738-131699760 AGGTAGAAGCATAAGGATGTGGG + Intergenic
1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG + Intronic
1034260558 7:149752804-149752826 ATGGGGAAGCCCAGGGAGGCCGG + Intergenic
1035387171 7:158481369-158481391 ATGCAGCTGTACAAGGAGGTGGG + Intronic
1036438729 8:8760808-8760830 ATGGAAAATCCCAAGGTGGTGGG - Intergenic
1036728995 8:11245238-11245260 ATGGAGAGGCAGAAGGATTTAGG + Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1037788591 8:21918095-21918117 AGGGAGAAACACGGGGAGGTTGG + Intergenic
1037805412 8:22055819-22055841 ATGGAGAAGCACAGGGGGAGGGG - Intronic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039597973 8:38808228-38808250 ATGGAAAGGCACATGAAGGTAGG + Intronic
1039693526 8:39885331-39885353 ATGGACAATCAGCAGGAGGTGGG - Intergenic
1041753653 8:61288754-61288776 ATGGAGAATCACCAGGAAGCAGG + Intronic
1042112250 8:65392953-65392975 ATGAGGAAGCACTAGGAGTTGGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1045037326 8:98185757-98185779 ATGGAGACAGTCAAGGAGGTAGG - Intergenic
1045865226 8:106857726-106857748 ATGGAGAGGCACAGGGCTGTGGG - Intergenic
1045884359 8:107078531-107078553 ATGGAGCTGCACAAGGCTGTGGG - Intergenic
1047297122 8:123580989-123581011 ATGGAGAAGGAAGAGCAGGTGGG + Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1050386827 9:5099800-5099822 GGGTAGAAGCCCAAGGAGGTTGG - Intronic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1054785655 9:69207729-69207751 ATAGCCAAGCACAAGGTGGTGGG + Intronic
1054963740 9:70998639-70998661 ATGGAGGAGGACAAGTAGGTTGG - Intronic
1055326111 9:75131806-75131828 ATGAAGCAGCAAAAAGAGGTAGG + Exonic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055720060 9:79163409-79163431 ATAAAGAATCACTAGGAGGTAGG - Intergenic
1055903549 9:81267863-81267885 AGAGACAAGAACAAGGAGGTGGG - Intergenic
1056190029 9:84175945-84175967 ATGGAGAAGAACAAGCAGCGTGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057472345 9:95368906-95368928 ATGCAGACGCACCAGCAGGTGGG + Intergenic
1057823287 9:98351727-98351749 ATGGACAAACACAAAGAAGTTGG - Intronic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059584959 9:115596120-115596142 ATGGAGAAGTTCAAGGCGCTTGG - Intergenic
1059735085 9:117092708-117092730 ATGATGAAGTTCAAGGAGGTAGG - Intronic
1061222550 9:129260583-129260605 ATGGAAAAGCACGAGGACCTTGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1187675164 X:21709332-21709354 ATGGAGAATCATGGGGAGGTTGG - Intronic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1192869868 X:75175128-75175150 ATGCAAAAACACAAAGAGGTAGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1196770958 X:119292715-119292737 ATAGAGAAGCCCAAGAAGATAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197888021 X:131238364-131238386 ATGGGGAAGTACAAGAAGGTGGG + Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198485725 X:137085672-137085694 CTGGAGAAACACTAGCAGGTAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200158295 X:153990023-153990045 GTAGAGAAACACAAGGAGGCTGG - Intergenic
1200175930 X:154116339-154116361 ATGGGGAAGCACCAGGGGGTCGG - Intergenic
1200230415 X:154441154-154441176 ATGGAGAACGGCAAGGTGGTGGG + Exonic
1201330244 Y:12811569-12811591 ATAGAAAAGGACAAGGAGTTAGG - Intronic