ID: 1133139462

View in Genome Browser
Species Human (GRCh38)
Location 16:3733551-3733573
Sequence ACTAATGTCTTACCTTAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133139462_1133139464 9 Left 1133139462 16:3733551-3733573 CCACACTAAGGTAAGACATTAGT 0: 1
1: 1
2: 4
3: 27
4: 183
Right 1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133139462 Original CRISPR ACTAATGTCTTACCTTAGTG TGG (reversed) Intronic
900086542 1:900821-900843 ACTAACGTGTTACATTAGCGTGG - Intergenic
901354060 1:8627314-8627336 ACTAATGTCTGCCATTAGTGTGG + Intronic
902155384 1:14481337-14481359 AATAATGGCTAACCTTACTGAGG - Intergenic
903587169 1:24424881-24424903 ACTCATCTCTTACCTTTGGGAGG + Intronic
907298075 1:53468338-53468360 ACTATTCTCTTACGTCAGTGTGG + Intergenic
907399309 1:54214953-54214975 CCTAATGTCAGACCTCAGTGTGG - Intronic
908777438 1:67654243-67654265 ACTAGTGTCTTACCTTTTTTAGG + Intergenic
914872973 1:151490711-151490733 ATTAACATCTTACATTAGTGTGG + Intergenic
915221764 1:154380206-154380228 AGAAATGTCTTCCCTTAGTGAGG - Intergenic
915778537 1:158518955-158518977 ACTACTCTCTTACCTGAGTGAGG - Intergenic
917145919 1:171891410-171891432 ATTAATATCTTACATTAGTATGG + Intronic
917694481 1:177507774-177507796 ATTAACATCTTACATTAGTGTGG - Intergenic
918681109 1:187354925-187354947 ATTAATGTCTTGTATTAGTGTGG - Intergenic
918853292 1:189718861-189718883 TCTTATATCTTACCTTAGTCTGG - Intergenic
921518192 1:216124029-216124051 ATTGATGTCTTACCTTTCTGTGG - Intronic
922231064 1:223686828-223686850 ATTAATGTCTCACACTAGTGAGG + Intergenic
1065816071 10:29483711-29483733 ACTAATGTTTAACCTCAGTATGG - Intronic
1065956824 10:30701185-30701207 ACTAATGTTTAACCTCAGTATGG + Intergenic
1067049341 10:43003140-43003162 ACTAACATCTTACATTAGTAAGG + Intergenic
1067356378 10:45532114-45532136 CATTCTGTCTTACCTTAGTGTGG - Intronic
1068330133 10:55554436-55554458 ATTGACATCTTACCTTAGTGAGG + Intronic
1068344705 10:55759724-55759746 ATTAATATCTTGCATTAGTGTGG - Intergenic
1069522038 10:69129993-69130015 ACTAATGACTCTCCTAAGTGAGG + Intronic
1071546065 10:86530756-86530778 ATTAAAGTCTTGCATTAGTGTGG - Intergenic
1071548086 10:86543883-86543905 ATTAATATCTTACCTTAGTATGG - Intergenic
1071945839 10:90644036-90644058 ATTAATATCTTACATTAGTATGG - Intergenic
1072256165 10:93622403-93622425 ATTAATATCTTGCATTAGTGTGG + Intronic
1072474155 10:95742947-95742969 ATTAACATCTTACATTAGTGTGG + Intronic
1073501024 10:103937247-103937269 ATTAATATCTTACATTAGTATGG + Intergenic
1074494008 10:113963183-113963205 ACTAATGTCCTGCCATAGTCTGG - Intergenic
1074578285 10:114691714-114691736 CATAATGACTTACTTTAGTGTGG + Intergenic
1080179792 11:29411844-29411866 TTTAATATCTTACATTAGTGTGG + Intergenic
1081340452 11:41921157-41921179 ACTAACATCTTACATTAGTATGG + Intergenic
1087074550 11:94117215-94117237 ATTATTATCTTACATTAGTGTGG - Intergenic
1087856384 11:103096590-103096612 ACTAATGTCTTACATTGGTATGG - Intergenic
1088931599 11:114356771-114356793 ATTAATGTTTTGCATTAGTGTGG + Intergenic
1089372045 11:117967971-117967993 ATTAACATCTTACATTAGTGTGG + Intergenic
1089854171 11:121526798-121526820 ACTAATGAATTACCTTAGCAAGG - Intronic
1091575673 12:1732114-1732136 ACTAACATCTTGCATTAGTGTGG + Intronic
1092139063 12:6170379-6170401 ATTAACATCTTACATTAGTGTGG - Intergenic
1092802748 12:12186850-12186872 TCTAATGTCTGGCTTTAGTGAGG - Intronic
1094237722 12:28187668-28187690 ACTCATGTCTTTCCTTAGCTTGG + Intronic
1094304839 12:29007088-29007110 ACTAACTTCTTGCTTTAGTGTGG - Intergenic
1094418888 12:30248990-30249012 GCTAATATATTACATTAGTGTGG - Intergenic
1094775560 12:33723213-33723235 ACTAATGTCTCATCATAATGTGG + Intergenic
1097944973 12:65357468-65357490 ATTAACATCTTACATTAGTGTGG + Intronic
1099089628 12:78289266-78289288 ACTAATGCCATACCTATGTGAGG + Intergenic
1100233655 12:92635539-92635561 ATTAATGTCTTGCGTTAGTGTGG - Intergenic
1101666676 12:106823154-106823176 ACTAATCTACTACCTTAATGAGG - Intronic
1104247133 12:127054701-127054723 ACTAATGTCTCAGCATTGTGAGG - Intergenic
1105245207 13:18643970-18643992 ATTTATGTCTCACCTGAGTGAGG - Intergenic
1105632187 13:22181166-22181188 ACTAACATCTTACATTAATGTGG + Intergenic
1106489235 13:30202163-30202185 ACTAACATCTTACATTAGTGTGG - Intergenic
1107781111 13:43903191-43903213 ACTAATGTGTTATCTGAGAGAGG + Intergenic
1108482323 13:50886616-50886638 ATTAATATCTTGCATTAGTGTGG - Intergenic
1109111481 13:58326178-58326200 ATTAATTTCTTACATTAATGTGG - Intergenic
1114311364 14:21470640-21470662 CCTAATGTCTTACGTTATTTGGG + Intronic
1116598232 14:46881549-46881571 ATTAACGTCTTACATTATTGTGG - Intronic
1117389764 14:55251568-55251590 ACAAATGTATCACCGTAGTGTGG + Intergenic
1117414608 14:55482372-55482394 ATTAAGATCTTACATTAGTGTGG - Intergenic
1120157699 14:81112258-81112280 AATAATGTCTAACATTATTGAGG - Intronic
1121962105 14:98270418-98270440 AGGAATGCCTTGCCTTAGTGGGG - Intergenic
1123813362 15:23951843-23951865 ATTAACCTCTTACATTAGTGGGG + Intergenic
1124040609 15:26099461-26099483 ATTAATATCTTACATTAGTATGG + Intergenic
1126369675 15:47932687-47932709 ACTAATGTCTAACCCTATGGGGG + Intergenic
1126393471 15:48185337-48185359 ATTAACATCTTACATTAGTGTGG - Intergenic
1127301931 15:57663338-57663360 ACTCATGTCTCACCTTAGTTTGG + Intronic
1130435650 15:83896565-83896587 ATTAACATCTTGCCTTAGTGTGG - Intronic
1130844453 15:87731695-87731717 GCTAATGTACTTCCTTAGTGAGG + Intergenic
1133139462 16:3733551-3733573 ACTAATGTCTTACCTTAGTGTGG - Intronic
1133310243 16:4840987-4841009 ACTAATGTGTTATCTTTTTGTGG - Intronic
1136699422 16:32117360-32117382 TATAATGTCTTACCTAAGGGTGG - Intergenic
1136799914 16:33060531-33060553 TATAATGTCTTACCTAAGGGTGG - Intergenic
1137691977 16:50434830-50434852 ACTGATGTCTTACATTAGTATGG - Intergenic
1140543468 16:75782699-75782721 ACTAACATCTTGCTTTAGTGTGG + Intergenic
1143738812 17:8936206-8936228 ATTAATATCTTCCATTAGTGCGG + Intronic
1144277347 17:13686175-13686197 ATTAATATTTTACATTAGTGTGG + Intergenic
1146165762 17:30587163-30587185 TTTAATATTTTACCTTAGTGAGG + Intergenic
1146338857 17:32002019-32002041 ATTAACGTCTTAGATTAGTGTGG - Intergenic
1149088369 17:52748661-52748683 AGTAATGTCTTACTTTAGAAAGG - Intergenic
1150242140 17:63643187-63643209 ATTAATATCTTACATTAGTATGG - Intronic
1153532375 18:6060523-6060545 ATTATTATCTTACATTAGTGTGG + Intronic
1154995304 18:21635063-21635085 ACTGATGGCTTCCCTTTGTGTGG + Intergenic
1155005092 18:21721849-21721871 ATTAATATCTTACATTACTGTGG + Intronic
1157296937 18:46452198-46452220 ACTAACATCTTGCATTAGTGTGG - Intronic
1158400919 18:57121137-57121159 ACTAGCATCTTGCCTTAGTGTGG - Intergenic
1159098400 18:63931701-63931723 ATTAACATCTTACATTAGTGTGG + Intronic
1160027506 18:75230654-75230676 ACTAAGGTCATACCTGCGTGTGG - Intronic
1168456454 19:56513941-56513963 ATTAATATTTTACATTAGTGTGG + Intronic
925220476 2:2135499-2135521 ACTAATTTCTTACCTGAGCAGGG + Intronic
926265393 2:11313178-11313200 ATTAACATCGTACCTTAGTGTGG - Intronic
930182871 2:48382497-48382519 ATTAATGTCTTGCATTAGTGTGG - Intergenic
932742893 2:74305473-74305495 ATTAACATCTTACATTAGTGTGG + Intronic
932934770 2:76089777-76089799 ATTAACATCTTACATTAGTGTGG + Intergenic
935459527 2:103312764-103312786 ATTCACATCTTACCTTAGTGCGG + Intergenic
935578525 2:104735630-104735652 ATTAATGTCTTACATTAGGGGGG - Intergenic
937550985 2:123091449-123091471 ACTAATGCCTTACATCAGTATGG + Intergenic
939237102 2:139508940-139508962 ACTAATGTATCACTTTTGTGCGG + Intergenic
939509160 2:143085320-143085342 AGAAATGACTAACCTTAGTGAGG + Intergenic
939798090 2:146672854-146672876 ATTAACATCTTACATTAGTGTGG - Intergenic
941161509 2:162040802-162040824 ATTAATGTCTTGCATGAGTGTGG - Intronic
941745040 2:169078250-169078272 AATAATGTCATACATTAGTAAGG - Intronic
943318754 2:186420215-186420237 ACTAACATCTTACATTAGTATGG - Intergenic
1170933401 20:20789832-20789854 ACTAACATCTTACGTTAGTGTGG - Intergenic
1171155524 20:22869441-22869463 ATTAATATCTTGCATTAGTGTGG - Intergenic
1174576343 20:51540533-51540555 ATTAATGTTTTACATTAGTATGG - Intronic
1175934095 20:62507200-62507222 ACTAACATCTTCCATTAGTGTGG + Intergenic
1177897169 21:26867344-26867366 AATGATGTCATACCTTACTGTGG + Intergenic
1178792757 21:35715021-35715043 AGTGATGTCTGAACTTAGTGAGG + Intronic
1179256490 21:39720780-39720802 ATTAACATCTTACCTTAGTATGG - Intergenic
1182914148 22:34012684-34012706 ATTAATGTCTCACATTAGTATGG + Intergenic
1184083574 22:42243688-42243710 ACTAATATCTCATATTAGTGTGG - Intronic
1184584505 22:45438603-45438625 ATTAATGTCTCATGTTAGTGTGG - Intergenic
949163255 3:907752-907774 ACTAAGATCTTGCATTAGTGTGG + Intergenic
956006607 3:64785816-64785838 ATTAATATCTTACCTTAGTGTGG - Intergenic
956188460 3:66584734-66584756 ACTAATATCTTGAGTTAGTGTGG + Intergenic
959184144 3:103022889-103022911 ATTAATATCTTGCATTAGTGTGG - Intergenic
961485266 3:127211650-127211672 ACTTCTGTCCCACCTTAGTGGGG - Intergenic
961940691 3:130634721-130634743 ATAAATGTCCTACCTTTGTGCGG + Intronic
962496771 3:135947734-135947756 ATTAATGTCTTACATTAGTATGG + Intergenic
963073755 3:141327729-141327751 ATTCATGTATTACATTAGTGTGG - Intronic
963277223 3:143344585-143344607 ACTAATGCCTTACCTTCTTAGGG - Intronic
964241841 3:154603050-154603072 AATAATCTCTGACCTTAGGGAGG - Intergenic
965419733 3:168443094-168443116 ACAAAAGACTCACCTTAGTGGGG - Intergenic
966276005 3:178170137-178170159 ATTAATATCTTACATTAGTGTGG - Intergenic
966379745 3:179332207-179332229 ACTAACATCTAACATTAGTGTGG - Intronic
967077235 3:186014462-186014484 ACTAATGCCTTATATTAGTAAGG + Intergenic
971089995 4:23331139-23331161 ACTTATGCCTTACCTTAAAGAGG - Intergenic
971550547 4:27950204-27950226 GCAAATGTATTACTTTAGTGTGG + Intergenic
971584972 4:28393772-28393794 ACTAATATATTACCTCAGTGTGG - Intronic
972663335 4:41139951-41139973 ATTAGTGTCTTGCATTAGTGTGG - Intronic
974251569 4:59392084-59392106 ACTTAAGTTTTACCTTAGTCTGG - Intergenic
975315068 4:72942661-72942683 AGTAATTTCTTACATTAGAGTGG - Intergenic
975736022 4:77382065-77382087 ACTCATGACTTTCCTTGGTGAGG - Intronic
976986073 4:91299999-91300021 AATTATGTTTTACCTTAGTGTGG + Intronic
979369247 4:119863567-119863589 ATTAATATCTTATATTAGTGTGG + Intergenic
980441838 4:132858265-132858287 ATTAATACCTTACATTAGTGGGG + Intergenic
981492915 4:145359809-145359831 ATTAATTTCTTACGTTAGTATGG - Intergenic
983549129 4:168996436-168996458 ACTAACATCTTACCTTAGTGTGG + Intronic
984320387 4:178188496-178188518 ATTAATGTCTTACATTAGTTTGG - Intergenic
984592781 4:181635499-181635521 ACAAGGGTCTTACCTAAGTGGGG + Intergenic
986967291 5:13289342-13289364 ACTAATATCTTGTGTTAGTGTGG + Intergenic
989553530 5:42764054-42764076 ACTAATATCTTGCATTAGTATGG + Intronic
989843928 5:46115673-46115695 AACAATGTTTTACCCTAGTGGGG - Intergenic
991288555 5:65008190-65008212 ACTAACATCTTACATTAGTATGG - Intronic
991937331 5:71815191-71815213 AGTAATGTCTTACCTTGGTTTGG + Intergenic
992411948 5:76513900-76513922 ATTAATGTCTTACATTAGTGTGG - Intronic
992961981 5:81965065-81965087 ATTAACGTCTTGCATTAGTGTGG - Intergenic
993158729 5:84260866-84260888 AATAATGTCTTGTGTTAGTGAGG - Intronic
996573922 5:124961878-124961900 ACTATTGTATTACCTTGGTTGGG - Intergenic
996758341 5:126959614-126959636 ATTAATGTCTTACATTAGTGTGG - Intronic
998185624 5:139977150-139977172 ATTAACATCTTACATTAGTGTGG - Intronic
999039258 5:148388924-148388946 AGAAATGACTAACCTTAGTGAGG - Intronic
999633419 5:153595339-153595361 ATTAAAATCTTACATTAGTGTGG + Intronic
999685039 5:154095119-154095141 CCTAACATCTTGCCTTAGTGTGG - Intronic
1000100882 5:158015096-158015118 ATTCATGTCTGACCTTAGTAGGG - Intergenic
1000690157 5:164307458-164307480 TCTAATATCTTACTTTACTGTGG - Intergenic
1003772439 6:9321070-9321092 AATAATGCCTTACATTTGTGTGG - Intergenic
1004862028 6:19814241-19814263 ATTAACATCTTACCTTAGTATGG - Intergenic
1005900388 6:30212437-30212459 ATTAACATCTTACCTCAGTGTGG - Intronic
1006210628 6:32391028-32391050 ATTAACATCTTACATTAGTGTGG - Intergenic
1008160693 6:48071612-48071634 ATTAATATCTTACATTAGTTTGG + Intergenic
1009543162 6:64991620-64991642 ACTAATTTATTACAATAGTGTGG + Intronic
1010049877 6:71490263-71490285 AATAATATCTTACGTTAGTTTGG - Intergenic
1011105734 6:83778279-83778301 ACAAATGTCCTACTCTAGTGAGG + Intergenic
1011425320 6:87222641-87222663 ATTAATATCTTACATTAGTTTGG + Intronic
1012666458 6:101977047-101977069 ACTAATGACTTAAATGAGTGAGG + Intronic
1012836713 6:104278784-104278806 ACAAATGACTAAGCTTAGTGAGG - Intergenic
1013030879 6:106331505-106331527 AGTAATGACTAAACTTAGTGAGG + Intergenic
1013413834 6:109906582-109906604 ATTAATGTCTTGCATTAATGTGG + Intergenic
1015135925 6:129870474-129870496 ACTGCACTCTTACCTTAGTGAGG + Intergenic
1016267145 6:142245848-142245870 ATTAAAGTCTTATATTAGTGTGG - Intergenic
1019627432 7:2025085-2025107 ACTAAAGTCTTACATTACTGTGG - Intronic
1020218001 7:6210155-6210177 ATTAACATCTTACATTAGTGTGG - Intronic
1020775929 7:12453765-12453787 ATTAGTGTCTTACATTAGTATGG + Intergenic
1022782289 7:33598553-33598575 ATTAATATCTTTCATTAGTGTGG - Intronic
1027612824 7:80383795-80383817 ATTAACATCTTACATTAGTGTGG + Intronic
1028430221 7:90737627-90737649 AATGATGCATTACCTTAGTGTGG + Intronic
1030075207 7:105730912-105730934 ATTAACGTCTTACATTAGTGTGG - Intronic
1031116068 7:117670184-117670206 ACAAATGTACTACTTTAGTGTGG - Intronic
1031924096 7:127621505-127621527 ATTAATGTCTTACATTGGTATGG + Intergenic
1032629812 7:133636732-133636754 ACTGATGTCTGATCTTAATGAGG - Intronic
1034153321 7:148934210-148934232 ACTAGTGCCTCACCTTAGTGAGG - Intergenic
1035981785 8:4380674-4380696 ATTAATGTCTTATGTTAGTATGG - Intronic
1037233143 8:16684799-16684821 ATTAACATCTTACATTAGTGTGG - Intergenic
1037318370 8:17620480-17620502 ATTAATTTCTTACGTTAATGTGG + Intronic
1037443725 8:18943699-18943721 ACTATTGTTTTACCTGAGTAGGG - Intronic
1038636336 8:29290565-29290587 ACTAACATCTTGCCTTGGTGTGG - Intergenic
1042189564 8:66171950-66171972 ACTATTGTCTTTTCTTATTGGGG + Intronic
1045876757 8:106990732-106990754 ACTAATGTGGTTCCTTGGTGAGG - Intergenic
1046515279 8:115251429-115251451 ACTAATACCTTTCTTTAGTGTGG + Intergenic
1048130390 8:131689634-131689656 ACAAATGTCTTGTCTAAGTGGGG - Intergenic
1048714600 8:137253883-137253905 ACTAACATCTTACTTTAGTAAGG - Intergenic
1049638688 8:143704232-143704254 ATTAACATCTTGCCTTAGTGTGG + Intronic
1050059405 9:1689659-1689681 ATTAACATCTTACATTAGTGTGG + Intergenic
1050452369 9:5796935-5796957 ATTAATGTCTTGCATTAGTATGG - Intronic
1050778009 9:9292548-9292570 ACTAACATCTTACATTAGTATGG + Intronic
1052564112 9:30124808-30124830 ACTAACATCTTACGTTAGTGTGG - Intergenic
1055459063 9:76499765-76499787 ATTAATATCTTACATTAGTGTGG + Intronic
1055826178 9:80327693-80327715 ATTAATATCTTGCATTAGTGTGG - Intergenic
1058283003 9:103141935-103141957 ACTAATGTCTTTCACTGGTGTGG + Intergenic
1060682147 9:125576326-125576348 ACTAATATCTTGCATTAGTGTGG - Intronic
1185828770 X:3278275-3278297 ACTTATGTCTTAGCTTATTGAGG - Intronic
1186227583 X:7417675-7417697 ATTAATCTCTTGCATTAGTGTGG + Intergenic
1187007175 X:15243929-15243951 ACTACTGTCCTAGCATAGTGTGG - Intronic
1189162787 X:38827611-38827633 ATTAACATCTTACGTTAGTGTGG - Intergenic
1190762038 X:53444868-53444890 ACTAATGTGTTGCCTGAGTCAGG - Intergenic
1193146875 X:78085599-78085621 ATTAATATCTTGCATTAGTGTGG - Intronic
1193230192 X:79035145-79035167 ACTAATGTCTTACCTTTGTGGGG + Intergenic
1193231527 X:79052443-79052465 ACTTATGTTTTACCTTAGGAGGG + Intergenic
1193926054 X:87487051-87487073 ACTAATTACTTAGATTAGTGAGG + Intergenic
1194500911 X:94679602-94679624 ACAGTTGTCTTACCTTACTGTGG + Intergenic
1194529317 X:95025567-95025589 ACTAATTTCTTATATTAGTTGGG + Intergenic
1195512170 X:105728664-105728686 GTTAATGTCTTGACTTAGTGTGG + Intronic
1198806042 X:140495704-140495726 ATTAACGTCTTACGTTAGTGTGG + Intergenic
1199516138 X:148677455-148677477 ATTAATGTCTTACCTCAGAGAGG + Intronic