ID: 1133139464

View in Genome Browser
Species Human (GRCh38)
Location 16:3733583-3733605
Sequence AACTGCGTGCTGCAATATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133139460_1133139464 26 Left 1133139460 16:3733534-3733556 CCGTGGCAGCAAATGTGCCACAC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG 0: 1
1: 0
2: 0
3: 2
4: 49
1133139462_1133139464 9 Left 1133139462 16:3733551-3733573 CCACACTAAGGTAAGACATTAGT 0: 1
1: 1
2: 4
3: 27
4: 183
Right 1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133139464 Original CRISPR AACTGCGTGCTGCAATATAC TGG Intronic
911704083 1:100990557-100990579 AAGTGCCTGCTGCAATTTTCTGG + Exonic
912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG + Intronic
913554423 1:119950723-119950745 CACTGTGTGCTGCCATACACAGG - Exonic
914444970 1:147742335-147742357 AACTGCCTGCTCCAATATGAGGG - Intergenic
915125555 1:153661118-153661140 AACTAGGTGCTGAAAAATACCGG - Intronic
1063171070 10:3510461-3510483 ACCTGCCTGCTGCAATTTAAAGG - Intergenic
1093103217 12:15053144-15053166 AACTGAGTATTCCAATATACTGG - Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1112527482 13:100165711-100165733 AACTGCATGCTGAAGTGTACAGG - Intronic
1118690237 14:68331603-68331625 AACTGGGTTCTGCAATTTCCTGG + Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1127586888 15:60386922-60386944 AGCTGCGTCCTGAAATAGACAGG + Intronic
1131956782 15:97744726-97744748 TACTGAGTGCTTCAATATTCTGG + Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1142403906 16:89875422-89875444 TTCTGCGTGCTGAAAGATACTGG + Intronic
1149630489 17:58117943-58117965 TACTGAGTGCTGCTGTATACTGG - Intergenic
1155845863 18:30706082-30706104 AGCTGCGTGCTGCATGATTCAGG - Intergenic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
929370037 2:41212013-41212035 AAGTGCCTGCTGTAATATATTGG - Intergenic
931230277 2:60368610-60368632 AAGTGCCTGCTTCAATATAAAGG + Intergenic
939942847 2:148371669-148371691 AACTGCCTGATGTAATAAACAGG - Intronic
944816260 2:203379007-203379029 AACTGCAAGCTGCAATTTAGTGG - Intronic
947087318 2:226467809-226467831 AATAGAGTGCTGCAATAGACTGG + Intergenic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1169879448 20:10330586-10330608 TACTGCGTGTTGAAAGATACGGG + Intergenic
1170133220 20:13045167-13045189 AACTGGGTGCTGGAATATGCAGG - Intronic
956288296 3:67634162-67634184 CACTGAGCACTGCAATATACTGG - Intronic
962520710 3:136195762-136195784 AACTGCGGGCTGCAACCCACGGG - Exonic
962756245 3:138467547-138467569 ATCTGCAGGCTGGAATATACAGG - Exonic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
968028859 3:195465799-195465821 AAATGAGTTCTGCAACATACTGG + Intergenic
974973535 4:68861260-68861282 CACTTCATGCTGCAATAAACTGG + Intergenic
975655907 4:76641055-76641077 AACTGTGGGCTGAAATATACTGG + Intronic
984525490 4:180853789-180853811 AAATATATGCTGCAATATACAGG - Intergenic
987187867 5:15443939-15443961 TATTGCTTTCTGCAATATACAGG - Intergenic
987747673 5:21997152-21997174 ACCTGTTTGCTGCAATATGCTGG - Intronic
988942990 5:36164606-36164628 AAGGGCGTGCTGCTATTTACAGG + Intronic
990599421 5:57342527-57342549 AACTGTGTGCTTCAACACACAGG - Intergenic
991767851 5:70006945-70006967 ACCTGTTTGCTGCAATATGCTGG - Intergenic
991847085 5:70882023-70882045 ACCTGTTTGCTGCAATATGCTGG - Intergenic
991936743 5:71809674-71809696 ATCTGTGTGCTGGAATATAATGG - Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1018246015 6:161824701-161824723 AACTGCGTGTAGCAATGAACAGG + Intronic
1024655021 7:51445053-51445075 AATTTCCTGCTGCAGTATACTGG - Intergenic
1027571775 7:79877117-79877139 AACTGCATTGTGCAATTTACTGG + Intergenic
1035978556 8:4341243-4341265 AACTGCCTTCTGAAAAATACTGG - Intronic
1039190398 8:34967162-34967184 AACTGTGTCCTGCAATATCTTGG - Intergenic
1052786677 9:32834759-32834781 AACTGCATGCAGCAACATGCAGG + Intergenic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG + Intronic
1194263149 X:91722500-91722522 ATCTGCCTGCTCCAAAATACTGG - Intergenic
1197917210 X:131548968-131548990 AACTGAGTGCTACACTTTACAGG - Intergenic