ID: 1133139962

View in Genome Browser
Species Human (GRCh38)
Location 16:3736369-3736391
Sequence TAGGGGCTCCAGCACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133139962_1133139968 19 Left 1133139962 16:3736369-3736391 CCACCACAGTGCTGGAGCCCCTA 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1133139968 16:3736411-3736433 CAGGCCCCAATGCCCACTGATGG 0: 1
1: 0
2: 0
3: 13
4: 196
1133139962_1133139967 0 Left 1133139962 16:3736369-3736391 CCACCACAGTGCTGGAGCCCCTA 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1133139967 16:3736392-3736414 TGTGTGCAACAGTGATGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133139962 Original CRISPR TAGGGGCTCCAGCACTGTGG TGG (reversed) Intronic
900104245 1:975516-975538 CAGGGGCTGCTGCACTGGGGAGG + Exonic
900350124 1:2230354-2230376 TGGCGGCTCCAGCACTGTGCTGG + Intronic
900465911 1:2825332-2825354 CAGGGGCTTAAGCTCTGTGGGGG + Intergenic
900689731 1:3973401-3973423 TGGGGACTCCAGCACAGTCGGGG + Intergenic
900689755 1:3973491-3973513 TGGGGACTCCAGCACGGTTGGGG + Intergenic
902566593 1:17315566-17315588 TAGGGGCTCCTGCGCTGTAAGGG - Intronic
902776672 1:18679316-18679338 CCAGGGCTCCAGCACTGAGGAGG + Intronic
903947953 1:26975858-26975880 TTGGGGCTCCAGCATTGTGTTGG - Intergenic
906902788 1:49854626-49854648 TTGGGGCTCCAGGGATGTGGAGG - Intronic
909931478 1:81503795-81503817 GAGGGCCTCCAGCCCTGTGTCGG - Intronic
911433891 1:97830242-97830264 TTGGGCCTCCACCACTGTAGAGG + Intronic
911643092 1:100309705-100309727 TGGGTGCTCCAGCACTAGGGAGG - Intergenic
916720641 1:167482658-167482680 TCGGGCCTCCAGCACCATGGAGG + Intronic
917406726 1:174714633-174714655 TAGTAGCTCCAGTACAGTGGGGG + Intronic
919536830 1:198797781-198797803 TAGGGGCTGCAACAGTTTGGAGG - Intergenic
920186445 1:204162208-204162230 CAGGGACTCCACCACTGTGGTGG - Intronic
920799579 1:209173970-209173992 CAGGGCCTCTAGCCCTGTGGTGG - Intergenic
921080290 1:211733569-211733591 CAGGGGCACCAGCCCTGGGGTGG - Intergenic
922538955 1:226404552-226404574 CAGGGTGTCCAGCACTGTGCCGG - Intronic
923101381 1:230820514-230820536 TAGGAGCTGCAGCATGGTGGAGG + Intergenic
923220722 1:231890557-231890579 CAGGGGCTCCAGCCCTGGTGAGG + Intronic
1062818482 10:517009-517031 CAGGGGCTTCCTCACTGTGGGGG + Intronic
1062920200 10:1273669-1273691 TTGGGGCTCCAGGACTCTGTGGG - Intronic
1063037412 10:2300208-2300230 GAGGGGCTCTATCACTTTGGGGG - Intergenic
1064301330 10:14125611-14125633 GCTGGGCTCCAGCATTGTGGAGG - Intronic
1070741083 10:78903691-78903713 ACGGGGCTCCAGCACAGAGGAGG + Intergenic
1072382436 10:94889257-94889279 TGGGGACTCCAAAACTGTGGAGG - Intergenic
1073079596 10:100850709-100850731 TATGGGGTCCTGGACTGTGGGGG - Intergenic
1073484822 10:103810043-103810065 TAGAGGCTCCAGCAGTAGGGAGG - Intronic
1074148846 10:110740548-110740570 AAGGGGCTCCATCTCTCTGGTGG - Intronic
1074548501 10:114421134-114421156 TATGGGCTGCAGCAGGGTGGAGG - Intergenic
1074712958 10:116192746-116192768 TGGGGTTTCCAGCACTGTGGAGG - Intronic
1075682260 10:124341424-124341446 CAGAGGCTGCAACACTGTGGAGG + Intergenic
1075913394 10:126145878-126145900 TAGGGCCGTCACCACTGTGGAGG + Intronic
1076610801 10:131725004-131725026 GAGGGGGTCCAACACTGGGGAGG - Intergenic
1077581162 11:3418134-3418156 CAGGGGCTCCAGCACGCAGGTGG + Intergenic
1079910522 11:26303907-26303929 TAGGGGTTTCACCACTTTGGCGG + Intergenic
1081086864 11:38812025-38812047 TAGTGGCTGCAGAACAGTGGTGG - Intergenic
1083780120 11:64913433-64913455 GAGGGGCTCCAGGCCTGGGGTGG - Intronic
1084238094 11:67800972-67800994 TGGGGGCTCCAGCACGCAGGTGG + Intergenic
1084793956 11:71491851-71491873 CAAGGGCTCCAGCTCTGCGGTGG - Exonic
1088998815 11:115031204-115031226 TAGGGGCTCCATTGATGTGGTGG - Intergenic
1089963849 11:122639060-122639082 TAGGGGCTCCAGCAATGTAGAGG + Intergenic
1091785627 12:3241926-3241948 TTGGGGCTCCAGCACACAGGGGG + Intronic
1091832650 12:3560889-3560911 TAGGGGCTCAGAGACTGTGGAGG + Intronic
1094075866 12:26473610-26473632 TAGAGGCTGTAGCACTGTGGAGG - Intronic
1095356228 12:41278876-41278898 TAGGGGCTCCATCACTATGCAGG - Intronic
1095493249 12:42758261-42758283 GAGGGGCTCCTCCACTGTGGAGG - Intergenic
1096526046 12:52211067-52211089 TGGGGCCTCAGGCACTGTGGTGG + Intergenic
1096622821 12:52874921-52874943 CAGGGGCCCTGGCACTGTGGAGG - Intergenic
1097261806 12:57724721-57724743 AAGGCGCTCCAGCTCTGAGGAGG - Intronic
1102107991 12:110342284-110342306 TATGGGCTCTGGCACTGCGGTGG + Exonic
1108923566 13:55707915-55707937 TAGGGACTCCAAAACTGTGGAGG + Intergenic
1109547151 13:63844271-63844293 TAGGACCTCCATCACAGTGGGGG + Intergenic
1112329009 13:98462654-98462676 TAGGGGCCACTGCTCTGTGGAGG - Intronic
1113550398 13:111188497-111188519 TGGGGGATCCAGCACCGTGTAGG - Intronic
1114492684 14:23113288-23113310 AAGAGGCTACAGCTCTGTGGTGG + Intergenic
1115816768 14:37172136-37172158 TAGGGGCTCAAGCACTGCTCCGG + Intronic
1118374850 14:65167745-65167767 TTGTGGCTCCATCACTGTGCTGG + Intergenic
1118734040 14:68689708-68689730 GACGTGCTCCAGCACTGTGGAGG + Intronic
1119443539 14:74645846-74645868 GAGAGGCTCCAGCTCTGTGGAGG - Intergenic
1121634775 14:95446486-95446508 TAGGTTCTGCAGCAATGTGGTGG - Intronic
1122261862 14:100528188-100528210 TCGGGCCTCCAGAACTGTGAGGG - Intronic
1122635614 14:103128320-103128342 GAGGGGCTCCAGCTCTGCGGCGG - Intronic
1127371456 15:58345601-58345623 TAGGGCATCAAGCACTGTGAAGG + Intronic
1129828356 15:78650548-78650570 AAGGGGCACCAGCACTGATGGGG - Intronic
1131306923 15:91253037-91253059 TAAGGGCTCCTGCACTGTCACGG - Intronic
1132888896 16:2194816-2194838 TGGGGGCTTCAGCTCTGGGGAGG - Intronic
1133139962 16:3736369-3736391 TAGGGGCTCCAGCACTGTGGTGG - Intronic
1136236171 16:28914817-28914839 CCGGGGCTTCAGCACTTTGGAGG - Intronic
1136564333 16:31061107-31061129 CAGGGGCTCCAGGGGTGTGGGGG + Exonic
1138353541 16:56360032-56360054 TTGGGGTTCCAGTTCTGTGGGGG - Intergenic
1140965374 16:79961229-79961251 TAGGGTGTTCAGCACTGTGCCGG + Intergenic
1141729180 16:85810364-85810386 TAGAGGATCCAGCAGGGTGGAGG + Intergenic
1142000484 16:87661501-87661523 TTGGGGGTCCAGGACTGGGGAGG + Intronic
1143307886 17:5962071-5962093 TTGGGGCTGCAGCAATCTGGTGG - Intronic
1143319865 17:6061276-6061298 TAGGGGATCTGGCACTGGGGTGG + Intronic
1144956488 17:19021350-19021372 TAGGGCCTCTAGCCCTGTGGTGG + Exonic
1147658704 17:42105542-42105564 GAGAGGCTCCAGCACTGGGGAGG + Intronic
1148866162 17:50629782-50629804 TAGGGGCTTCAGGGATGTGGGGG + Intergenic
1149555225 17:57568837-57568859 AGGGGGCTGGAGCACTGTGGTGG + Intronic
1150219718 17:63489234-63489256 GAGAGACTCCAGCCCTGTGGGGG + Intronic
1151674337 17:75589908-75589930 GAGCGGCTCCAGCAGTGAGGCGG + Intergenic
1152145193 17:78564188-78564210 TAGGGGATCCGGCAGTGGGGAGG - Intronic
1160245897 18:77159105-77159127 TCGGGCCTCCAGAACTGTGGGGG + Intergenic
1160376284 18:78415043-78415065 TGGGGTCTGCAGGACTGTGGAGG - Intergenic
1161721141 19:5903417-5903439 TAGGGGGTCCAGCAGGGTTGGGG - Intronic
1161779344 19:6280338-6280360 TACGGGTTCGAGCCCTGTGGAGG + Intergenic
1162556804 19:11392034-11392056 CAGTGGCTCTAGCACTTTGGGGG - Intronic
1165008829 19:32828373-32828395 TTGTGGCTGCAGCACTGGGGGGG + Intronic
1165719763 19:38070865-38070887 GTGGGGCTCAAGCACTCTGGAGG - Intronic
1168585122 19:57585502-57585524 TAGTGGCTTCACCAGTGTGGTGG + Intronic
926103203 2:10133801-10133823 GAGTGGCTCCAGCAAGGTGGTGG + Intergenic
926689888 2:15725879-15725901 TCTGGGCTCCAGAACTGTGAGGG - Intronic
928258166 2:29742830-29742852 TAGGGGCTGCAGCTGTGTGTAGG - Intronic
930402534 2:50908581-50908603 TAAGGTCTTCAGCACTGTGAAGG + Intronic
935577103 2:104722550-104722572 TAGGTCCTCCTTCACTGTGGAGG + Intergenic
935848955 2:107198121-107198143 GAGTGGCTGCAGCAGTGTGGAGG + Intergenic
936187794 2:110318449-110318471 CAGGGACTCCAGCTTTGTGGAGG + Intergenic
936618084 2:114068656-114068678 CAGGGGCTTCAGCACTGTAGGGG - Intergenic
941462768 2:165791373-165791395 TGAGGGCTCCAGCACTTTCGTGG + Intronic
944138772 2:196432034-196432056 TTGGGGCTAGATCACTGTGGAGG + Intronic
944503881 2:200390068-200390090 AAGGTGCACCAGCACTGTGGTGG - Intronic
945073157 2:206011445-206011467 TGGGGGCTCTAGCTCTCTGGAGG - Intronic
946052702 2:216877403-216877425 TAGGGTTTCCAGAACTATGGGGG + Intergenic
946400150 2:219464350-219464372 CTGGGGCTGCAGCACTGTGCAGG - Intronic
948455465 2:238102580-238102602 TAGGGGTCCCAGCACAGGGGTGG - Intronic
948587208 2:239026909-239026931 CAGGTGCTCCGGGACTGTGGCGG - Intergenic
948643671 2:239390743-239390765 TCGGGGCTCCAGGCATGTGGCGG - Intronic
948663406 2:239520330-239520352 CAGGGGTTCCAGCACAGTTGGGG - Intergenic
948757423 2:240167630-240167652 CAGGGGCTCTAGAATTGTGGGGG - Intergenic
1169428190 20:5512399-5512421 TAGAGGCCCTAACACTGTGGTGG - Intergenic
1170545935 20:17435910-17435932 TAGGAGCACCAGCTCTGCGGGGG + Intronic
1170708419 20:18767053-18767075 TAGAGGCTCCATCACTGAGCAGG + Intergenic
1172097988 20:32469950-32469972 CACGGGCTCCCGCACTGTGCAGG - Intronic
1172715825 20:36962779-36962801 TAGGGTCTCCACCACTGAGCTGG + Intergenic
1174000670 20:47372233-47372255 TAAGGGCTGGAGCACTGTGCTGG - Intergenic
1179155515 21:38847631-38847653 AAAGGGCTCTTGCACTGTGGAGG - Intergenic
1179551648 21:42147207-42147229 CATGGGCTCCAGCACGGGGGTGG + Intergenic
1179911371 21:44450721-44450743 CAGGGGCTCCAGGGCTCTGGGGG - Intergenic
1180088879 21:45523868-45523890 GAGGGGCTCCAGCACCCGGGAGG - Intronic
1180961155 22:19762978-19763000 TGGGGGCTCCAGCGCTGGGCTGG + Intronic
1181009059 22:20029603-20029625 GAGGGACTCCAGGAGTGTGGGGG + Intronic
1181085916 22:20439273-20439295 GAGGGGCCCCAGCACTGGGAGGG - Intronic
1183649341 22:39145295-39145317 TCTGGGCTCCTGCACTGCGGAGG - Intronic
1185246557 22:49776098-49776120 CAGAGGCTCCAGCACCGAGGCGG + Exonic
950185636 3:10943732-10943754 TATGGTCTCCAGCACTGAGTAGG - Intergenic
950494613 3:13326155-13326177 TAGGGGCCACAGCCCTGTAGAGG - Intronic
953243751 3:41172183-41172205 TAGGGGCCCCAGCACAGTCGGGG - Intergenic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
959846792 3:111042016-111042038 TAGGACTTCCAGCACTGTGTTGG - Intergenic
960418884 3:117418911-117418933 TTGTGGATCCAGCACTGTGTAGG + Intergenic
961642919 3:128376121-128376143 GTGGGGCTCTAGCACTTTGGTGG - Intronic
962808132 3:138941162-138941184 TAGGGGCTGCCACACAGTGGTGG + Intergenic
968716100 4:2161193-2161215 AAGGGGCTCCCACAGTGTGGCGG - Intronic
969726332 4:8920494-8920516 AAGGGGCTCCAGCTCTCTGTGGG + Intergenic
973081796 4:46002786-46002808 TCAGAGCTCCAGCACTGTGCTGG + Intergenic
979515797 4:121608591-121608613 ATGTGGTTCCAGCACTGTGGAGG - Intergenic
981081757 4:140644145-140644167 TAGGGCCTCCCGTAGTGTGGTGG + Intronic
981197783 4:141941119-141941141 TAGGGCCTCCACAACTGTGCTGG - Intergenic
982841602 4:160194815-160194837 TGTGGTCTCCAGCTCTGTGGAGG + Intergenic
984759012 4:183348044-183348066 GATGGGCTCCACCACTGTGCTGG - Intergenic
985546116 5:510012-510034 GAGGGGCTCCAACGATGTGGAGG + Intronic
985894600 5:2740800-2740822 CAGGGTCTCCAGCACTGGGAAGG + Intergenic
986125114 5:4877162-4877184 GAGTGTCTCCTGCACTGTGGTGG - Intergenic
989036240 5:37175127-37175149 AAGGGGCTCCAGGGCTGTAGAGG + Intronic
992803034 5:80310387-80310409 GAGGGGCTCCCACAGTGTGGTGG + Intergenic
995354517 5:111223626-111223648 TAGGAGCTCCAGCAGTGCCGAGG + Intergenic
999133096 5:149299500-149299522 CAGCTGCTCCAGCACTGCGGAGG - Exonic
1000026612 5:157364168-157364190 CAGGGGCACCAGAACAGTGGAGG + Intronic
1001163100 5:169338768-169338790 TCAGGACTCCAGCACTCTGGAGG + Intergenic
1001200755 5:169714117-169714139 CAGGAGCTCCAGCAGTGTTGGGG + Exonic
1003167456 6:3693323-3693345 TGGGGCATCCAGGACTGTGGGGG + Intergenic
1005016675 6:21381050-21381072 TGGGGGCTCCACCACTTTGCTGG - Intergenic
1007806857 6:44456846-44456868 TGGGGGCTCCAGGGGTGTGGAGG + Intergenic
1013253780 6:108361819-108361841 AAGGGGCACCAGAAGTGTGGGGG - Intronic
1017394538 6:153981678-153981700 TAGGGTTTCCAGTACTGTTGTGG + Intergenic
1018714059 6:166518061-166518083 TAGGGTCTCCACCACTGAGCTGG + Intronic
1019424752 7:969239-969261 TAGAAGCTCCAGCCCTGTGGGGG - Exonic
1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG + Intronic
1021074865 7:16289798-16289820 TAGGACTTCCAGTACTGTGGTGG - Intronic
1023925440 7:44665968-44665990 TATTCGCTGCAGCACTGTGGGGG - Intronic
1031535862 7:122932274-122932296 GTGGGGCTCCAGGAATGTGGAGG - Intergenic
1033234597 7:139628233-139628255 TCTGGCCTCCAGAACTGTGGGGG + Intronic
1034969783 7:155411629-155411651 CTGTGGCTCCAGCAATGTGGTGG - Intergenic
1035205086 7:157289842-157289864 AAGGGGCTCAAGCACAGTGTGGG + Intergenic
1035611474 8:968389-968411 TGGGGGCTCCATCAGTGTGGAGG + Intergenic
1035644756 8:1210473-1210495 GAGGGGCTCAAGCCCTGAGGCGG + Intergenic
1037315488 8:17595694-17595716 CAGGGCCTCTAGCCCTGTGGTGG + Intronic
1040280169 8:46036873-46036895 TAGGGGCCCCACCAGGGTGGAGG + Intergenic
1041518014 8:58724111-58724133 TATGTGCTCCAGCACTGTGCTGG - Intergenic
1041682432 8:60606873-60606895 TAGGGCCTCCAGGCCTGTGATGG + Intronic
1045213605 8:100124685-100124707 GAGGGGCTCCAGCTGTGTTGAGG + Intronic
1046846558 8:118922487-118922509 CAGAGGCTCCAGCAGAGTGGGGG + Intergenic
1049543091 8:143217403-143217425 GTGGTGCTCCAGCACTCTGGAGG - Intergenic
1051929114 9:22363909-22363931 GAGGGGCTCCAACAGTGTAGTGG + Intergenic
1056271884 9:84954964-84954986 TAGGGGCTCTGGCACTGTGCTGG - Intronic
1058109680 9:101018537-101018559 CAAGGGCTCCTGCACTGCGGGGG - Intergenic
1061724275 9:132573068-132573090 ACGGGGCCCCAGCACTGAGGAGG - Exonic
1062636043 9:137492477-137492499 GCGGGGCTCCAGCACAGGGGAGG + Intronic
1196185486 X:112740554-112740576 TGGGAGCTCCAGCCCTGAGGTGG + Intergenic
1199677521 X:150200531-150200553 TTGTGGCTGCAGCACTGTAGAGG - Intergenic
1199944677 X:152655748-152655770 TTGGGTCTCCAGCACCCTGGAGG + Exonic
1201979301 Y:19890476-19890498 TCAGAGCTCCAGCACTGTGCTGG + Intergenic