ID: 1133140892

View in Genome Browser
Species Human (GRCh38)
Location 16:3743222-3743244
Sequence GGGGCTGTCCTGCGCATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1491
Summary {0: 1, 1: 5, 2: 78, 3: 402, 4: 1005}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133140892_1133140897 -3 Left 1133140892 16:3743222-3743244 CCTGTAATGCGCAGGACAGCCCC 0: 1
1: 5
2: 78
3: 402
4: 1005
Right 1133140897 16:3743242-3743264 CCCTAAAACAGAGGGTTACCTGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133140892 Original CRISPR GGGGCTGTCCTGCGCATTAC AGG (reversed) Intronic
900731695 1:4266104-4266126 GGGGCTGTCCTGTGCATCATAGG + Intergenic
900766715 1:4510814-4510836 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
900810123 1:4795552-4795574 GGGGCTGTCCTGTGCATAGCAGG - Intergenic
900884874 1:5408021-5408043 GGGGCTGGCCTGTGCACTATTGG + Intergenic
901185923 1:7373158-7373180 GGGGCTGTCCTGTGCATTGTAGG + Intronic
901221203 1:7584864-7584886 GGGGCTGTCCGGTGCATTGCAGG - Intronic
901357917 1:8667908-8667930 GGGGCTATCCTGTGCATTGTAGG + Intronic
901407420 1:9058464-9058486 GGGGCTGTCCTGAGCACAGCAGG + Intronic
901521059 1:9785526-9785548 GGGGCTGTCCCGTGCATTGTGGG + Intronic
901800605 1:11706014-11706036 GGGGCTGTCCTGTGCATTGTCGG + Intronic
902142141 1:14365613-14365635 GGGACTGTCCTGTGCATTGCAGG + Intergenic
902171199 1:14612694-14612716 GGGTCTGTCCTGTGCATTTTAGG + Intronic
902191302 1:14765136-14765158 GGGGCTGTCCTGTGCATGGTAGG + Intronic
902197697 1:14809993-14810015 GAGGCTGTCTTGTGCATTGCAGG + Intronic
902207277 1:14878314-14878336 GTGGCTGTCCTGTGCATTGTAGG + Intronic
902278639 1:15358422-15358444 GGGGCTGTCCTGAGCATCTTAGG + Intronic
902289065 1:15425010-15425032 GGGGCTGTCCTGTGCATTGTGGG - Intronic
902605371 1:17566215-17566237 GGGGCTGTCCTGTGCCCTAAAGG + Intronic
902681190 1:18045039-18045061 GGGGCTGGCCTGTGCATTGTAGG + Intergenic
903032586 1:20474657-20474679 GGGGCTGTCCTGTGCACTCTAGG + Intergenic
903344524 1:22675936-22675958 GGGGCGGTCCTGTGCATTGCAGG - Intergenic
903458732 1:23506336-23506358 GGGGCTGTCCTGGCCAATGCTGG - Intergenic
903469585 1:23576681-23576703 GAGGCTGTCCTGTGCATTGCAGG + Intergenic
903508428 1:23854796-23854818 GGGGCTGTCCTGTGCATTGTAGG - Intronic
903607128 1:24583279-24583301 GGGGCTGTCCTGTGCATTATAGG - Intronic
904099450 1:28011444-28011466 GGGGATGTCTTGTGCATTATAGG + Intronic
904490156 1:30853594-30853616 GGGGCTGTCCTGGGCTCTACTGG + Intergenic
904608191 1:31710222-31710244 GGGGCTGTCCTGGGCACTGTAGG - Intergenic
904718594 1:32488599-32488621 GGGACTGTCCTGTGCATTTCAGG - Exonic
904863001 1:33553808-33553830 GGGGCTGTCCTGTGCATTGTAGG + Intronic
904994215 1:34618350-34618372 GGAGCTGTTCTGTGCATTATAGG - Intergenic
905158228 1:36007023-36007045 AGGGCTGTTCTCTGCATTACAGG + Intronic
905522172 1:38608611-38608633 GGGAGTCTTCTGCGCATTACAGG - Intergenic
905775805 1:40666386-40666408 GGGGCTGTCCTGTGCATTGAAGG - Intergenic
905879636 1:41455168-41455190 GGGGCTGTCCTGTGCATTCTAGG + Intergenic
905959439 1:42031504-42031526 GGGGCTGTCCCATGCATTACAGG + Intronic
906500132 1:46335952-46335974 AGGGCTGTCCTGTGTATTGCAGG + Intergenic
907040995 1:51259219-51259241 GGGGCTGTCCTGTACATCACAGG - Intronic
907127888 1:52067822-52067844 AGAGCTGTCCTGTGCATTACAGG + Intronic
907325239 1:53633717-53633739 GGGGCTGTCTTATGCATTGCAGG + Intronic
908028827 1:59978243-59978265 GGGGCTGTCCTGGATATTGCAGG + Intergenic
908330214 1:63063610-63063632 GGACCTGTCCTGTGCATTATGGG - Intergenic
908334440 1:63106383-63106405 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
908435623 1:64102818-64102840 GGGGCTGCCCTGTGTATTACAGG + Intronic
908478541 1:64513206-64513228 GGGGCTGTCCTGTGCATTTTAGG + Intronic
908484822 1:64580725-64580747 GGTGCTGTCCTGTGCATTGTAGG + Intronic
908523092 1:64963858-64963880 GGGGCTGTCTTGTGCGTTATAGG + Intronic
908523898 1:64969312-64969334 GGGGGTGTCCTGTGCATTGTAGG + Intergenic
909342219 1:74544981-74545003 GGGGCTGTCCTATGCATTGTAGG + Intergenic
909430935 1:75587130-75587152 GTGGCTGTCCTGGGCATTGTAGG - Intronic
909954875 1:81767481-81767503 GGGGCTATCCTGTGCCTTATAGG - Intronic
910365382 1:86459793-86459815 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
910564256 1:88625556-88625578 GGAGATGTCCTGTGCATTATAGG - Intergenic
910653090 1:89590989-89591011 GGGGCTGTCCTGTGCAGTGTAGG - Intronic
910990800 1:93053801-93053823 GGGGCTGTCCTGCGCATTGCAGG - Intergenic
911125595 1:94338289-94338311 GGAGCGGTCCTGTGCATTGCAGG + Intergenic
911180351 1:94854860-94854882 GGGGCTGTCCTGCGCACTGGAGG - Intronic
911695150 1:100882318-100882340 GGGGCTGTCCTGTGCATCGCAGG - Intronic
911881112 1:103239130-103239152 GGGCCTGTCCTGGGCACTGCAGG - Intergenic
912198070 1:107423395-107423417 GGGGCTGTCCTGTGCATTGTAGG - Intronic
912436675 1:109667006-109667028 GGCACTGTCCTGAGCATTGCAGG + Intronic
912438705 1:109681258-109681280 GGCGCTGTCCTGAGCATCGCAGG + Intronic
912441226 1:109699703-109699725 GGCGCTGTCCTGAGCATCGCAGG + Intronic
912666149 1:111581452-111581474 GGGGCTGTGCTGTACATTAAAGG - Intronic
912853391 1:113146370-113146392 GGGGCTGACTTGTGCATTGCAGG - Intergenic
913370004 1:118087853-118087875 GGGGTTGTCCTGTGCACTATAGG + Intronic
913538638 1:119797843-119797865 GGGGCTATCCTGTACATTGCAGG - Intronic
914762837 1:150612834-150612856 GGGACTGTCCTGTGCATTTCAGG - Intronic
914809276 1:151014868-151014890 GAGGCTGTCCTGTGCATTATAGG - Intronic
915495444 1:156279334-156279356 TGGACTGTCCTGTGTATTACAGG - Intronic
915621775 1:157090560-157090582 GCGGCTGTCCTGTGCATTCCTGG - Intergenic
915725274 1:158012900-158012922 GGGGCTGTCCTGTACATTGGAGG + Intronic
915904532 1:159868090-159868112 AGGGCTCTCCTGAGCATTTCAGG - Intronic
916000164 1:160607719-160607741 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
916212570 1:162370819-162370841 GGGGCTGTCCTGTGCATTGTAGG - Intronic
916469787 1:165112002-165112024 GAGGCTGTCCTGGGCATTAACGG + Intergenic
916493806 1:165326911-165326933 GGGGCTGCCCTGCACATTGTAGG - Intronic
916622257 1:166511871-166511893 AGGGCTGTCCTGTGCATTGCCGG - Intergenic
916772588 1:167926685-167926707 GCGGCTGTCCTGCGCATTGGAGG - Intronic
917124682 1:171676564-171676586 GGGGCTGTTCTGTGCATTGAAGG + Intergenic
917184343 1:172336125-172336147 GGGGCTGTCCTGTGCCTTATAGG - Intronic
917319836 1:173769141-173769163 GGGACTGTCCTGTGCATTGTAGG + Intronic
917412812 1:174777365-174777387 GTGGCTGTCATGTGCATTACAGG + Intronic
917641473 1:176987097-176987119 GAGGCTGTCCTGTGCCTTATAGG - Intronic
917801902 1:178579336-178579358 GGGGCTGTCCTATGCATTGCAGG - Intergenic
917869005 1:179225675-179225697 GGGGCTGTCCTGTGCATTGTAGG - Intronic
917960287 1:180138228-180138250 GGGGCTGTCCTGAGCAATGAAGG + Intergenic
918211278 1:182353263-182353285 GGGGCTGTCCTGTGCATGGTAGG - Intergenic
918235311 1:182574589-182574611 GGGGCTGTCCTGTGCAAGGCAGG + Exonic
918314355 1:183310681-183310703 GGGGCTGTCCTGTGCATTATAGG - Intronic
919587024 1:199451512-199451534 GGGGCTGTCTTGTGCATTGTAGG - Intergenic
919712806 1:200745174-200745196 GGGGCTGTCCTGTGCATTCTAGG + Intronic
919762062 1:201104223-201104245 GGGGCTGTCCTGTGCATTGCAGG + Intronic
920193644 1:204211878-204211900 GGGCCTGTCCTGTACATTATAGG - Intronic
920405040 1:205702743-205702765 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
921072220 1:211670608-211670630 GGGGCTGTCCTGTGCATTATAGG + Intronic
921320192 1:213931161-213931183 GGGGCTGTCCTGGGCATTGCAGG - Intergenic
921429825 1:215052631-215052653 AGGGCTGTCCTGTTCATTTCAGG - Intronic
921468254 1:215517813-215517835 GGGGTTGTCCTGTGCATTGTAGG - Intergenic
921577092 1:216848024-216848046 GAGGCTGTCCTGTGCATTGTAGG + Intronic
921612577 1:217230045-217230067 GGGGCTGTCCTGTGCATGGCAGG + Intergenic
922236653 1:223727331-223727353 GGGGCTGTCCTGTGAATTATAGG + Intronic
923054822 1:230418073-230418095 GGGGCTGTCCTGAGCACTGCAGG - Intronic
923762581 1:236860191-236860213 GGGGCTGTCCTGGGCACTGCAGG - Intronic
923819027 1:237415077-237415099 TGGGCTGTCCTGTGCATGGCAGG - Intronic
924032171 1:239896709-239896731 GGAGCTGTCCTGTGCATTGTAGG + Intronic
924200815 1:241656750-241656772 GGGGCTGTCTTGTGCATTGTAGG + Intronic
924260901 1:242230082-242230104 GGGGCTATCCTGTGCAATGCAGG - Intronic
924661236 1:246019276-246019298 GGGGCTGTCTTGTGCATTGTAGG - Intronic
924953292 1:248905692-248905714 GAGGCTGTCCTGTGCATTATAGG - Intergenic
1062888850 10:1040362-1040384 GGGTCTGTGCTGTGCATTGCAGG - Exonic
1063270707 10:4507623-4507645 GGGGCTATCTTGTGCATTAGAGG - Intergenic
1063409104 10:5823175-5823197 GGGGCTGTCCTGCGCATTGTAGG + Intronic
1063476420 10:6332547-6332569 GAGGCTGTCCTGTGCATTGTCGG - Intergenic
1063525661 10:6782507-6782529 GGGGCTGTCCTGCACATTGTAGG + Intergenic
1063587616 10:7366822-7366844 GGGGCTGTCCTGTGCATTGCGGG + Intronic
1063831037 10:9953317-9953339 GGTGCTGTCCTGGGCATTGTAGG - Intergenic
1064014387 10:11761342-11761364 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1064061543 10:12141780-12141802 GGGTCTGTCCTGTGTATTTCAGG + Intronic
1064106008 10:12501756-12501778 GAGGCTGTGCTGTGCATTAAGGG - Intronic
1064217794 10:13415201-13415223 GGGGCTCTCCTGTGCAATGCTGG - Intergenic
1065065134 10:21955008-21955030 GAGGCTGTTCTGTGCATTATAGG + Intronic
1065317609 10:24479571-24479593 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1065535536 10:26711692-26711714 GGGGCTGCCATGTGCATTACAGG + Intronic
1065740813 10:28795492-28795514 GAGGCCGTCCTGTGCATTACAGG + Intergenic
1065963069 10:30750070-30750092 GGAGCTGTCCTATGCATTGCAGG + Intergenic
1066425571 10:35304709-35304731 GGGGCTGTCCTGTGCCTTGTAGG + Intronic
1066434284 10:35382612-35382634 GGGGCTGTCCTGTGTACCACAGG - Intronic
1066496279 10:35945207-35945229 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1066533555 10:36366286-36366308 GGGTCTGCCCTGCTCATCACAGG + Intergenic
1067202548 10:44185912-44185934 GGCGCTGTGCTGGGCATGACAGG + Intergenic
1068015778 10:51514934-51514956 GAGGCTGTCCTGTGCATTGTGGG + Intronic
1068067330 10:52148293-52148315 GGAGCTGTCCTGTGCATTGTAGG - Intronic
1068564946 10:58564347-58564369 GGGGCTGTCCTTGGCTTTACAGG + Intronic
1068690587 10:59909823-59909845 GGAGCTGTCCTGTGCATTGTAGG + Intergenic
1068952892 10:62794886-62794908 GGGGCTGACCTGTGCATTGTAGG - Intergenic
1069062544 10:63909352-63909374 GAGGCTGTCCTGTGCATTCTAGG + Intergenic
1069467023 10:68650128-68650150 GGAGCTGTCCTGTGCATTGTGGG + Intronic
1070346256 10:75545160-75545182 GGAGCTGTCCTGTGCATTGTTGG - Intronic
1070371858 10:75790167-75790189 GGGGCCGTCCTGTGCATTGTAGG + Intronic
1070502416 10:77084140-77084162 GGGGCTGACCTGTGCATTGCAGG + Intronic
1071445528 10:85742945-85742967 GGGGCTATTCTGTGCATTGCAGG + Intronic
1071715757 10:88093603-88093625 AGAGCTGTCCTGAGCATTGCAGG - Intergenic
1072018565 10:91375591-91375613 GGTGCTGTCCTGTGCATTATAGG - Intergenic
1072342126 10:94462354-94462376 GGGGCTTTCCTGTGAAATACAGG + Intronic
1072490439 10:95900320-95900342 GGGGCTGTCCTGTGCATCGTGGG + Intronic
1072894102 10:99350873-99350895 GGGACTGTCCTGTGCATTGAAGG + Intronic
1073275072 10:102302834-102302856 GGGGCTGTCCTATGCATTGTAGG - Intronic
1073341984 10:102752174-102752196 GGGGCTGTCCTGAGCATTCCAGG - Intronic
1073593433 10:104777651-104777673 AGGGTTGTCCTGTGCATTGCAGG - Intronic
1073686408 10:105759225-105759247 GGGGCTGTTCTGTGCATTATAGG - Intergenic
1074383949 10:113002453-113002475 GGGGCTGTCCTGGGCATTGCAGG - Intronic
1074429238 10:113379490-113379512 GGGGCTTCCCTGTGCATTATAGG - Intergenic
1074456852 10:113602972-113602994 GGGCCTGTCCCGTGCATTTCAGG - Intronic
1074506474 10:114075374-114075396 GGGGCTGTCCTGGGCATTGTAGG - Intergenic
1074614156 10:115049586-115049608 GGGACTGTCCTGTGCTTTGCGGG - Intergenic
1074699354 10:116079663-116079685 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1074856942 10:117480678-117480700 GGGGGTGTCCTGCCCAGTGCTGG + Intergenic
1074883959 10:117680240-117680262 GGGGCTGTCCTGAGCATTGTAGG - Intergenic
1074958680 10:118418776-118418798 GGGGCTGTCCTGTGCATCAAAGG + Intergenic
1075018147 10:118926331-118926353 GGGGCTGTCCTGTGCATGGCAGG + Intergenic
1075079306 10:119372015-119372037 GGAGCTGTCCTGTGCATTGTGGG + Intronic
1075215511 10:120529269-120529291 GGGGCTGTCCTGTGCCCTGCAGG - Intronic
1075279550 10:121128036-121128058 GGGGCTGTTCTGTGCATTGTAGG + Intergenic
1075363845 10:121864897-121864919 GGAGCTGTCCTGCACATTATGGG - Intronic
1075374241 10:121964992-121965014 GGAGCTGTCCTGCGCATTGTAGG - Intronic
1075471089 10:122690081-122690103 AGGGCTGTCCTGTGCATTGCAGG + Intergenic
1075475677 10:122731359-122731381 GGAACTGTCCTGTGCATTGCAGG - Intergenic
1075507477 10:123037162-123037184 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1075518144 10:123126052-123126074 GGGTCAGTCCTGCTCATCACTGG - Intergenic
1075562787 10:123480589-123480611 GGCACTGACCTGGGCATTACAGG + Intergenic
1075588733 10:123676410-123676432 GGAGCTGTCCTGGGCATCATGGG + Intronic
1075620236 10:123922087-123922109 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1076107576 10:127835466-127835488 GGGACTGTCCTGTGCATTTTAGG + Intergenic
1076107656 10:127835983-127836005 GGGACTGTCCTGGGCATTTTAGG - Intergenic
1076139621 10:128068795-128068817 GAGGCTGTCCTTCCCATCACAGG - Intronic
1076168612 10:128302189-128302211 GGGGTGGTCCTGGGTATTACTGG + Intergenic
1076212594 10:128660366-128660388 GGAACTGTCCTGTGCATTGCAGG + Intergenic
1076527130 10:131118957-131118979 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1076605305 10:131685506-131685528 GGGGCTGTCCTGCCCAAGTCTGG + Intergenic
1076923953 10:133471924-133471946 GGGGCCATCCTGTGCATCACAGG + Intergenic
1077294398 11:1818576-1818598 GGGGCTGTCCTGTGCACTTTAGG - Intergenic
1077658446 11:4044947-4044969 GAGGCTGTCCTGTGCATTGCAGG - Intronic
1079001761 11:16763539-16763561 GGGGCTGTCCTGTGCATCAAAGG - Intergenic
1079021222 11:16910715-16910737 GGGGCTGTCCTGTATATTGCAGG - Intronic
1079127712 11:17730757-17730779 GGTGCTGTACTGTGCATTGCAGG - Intergenic
1079445234 11:20551167-20551189 GGGACTGTCCTGTGTATTACAGG + Intergenic
1079452698 11:20610883-20610905 GGGACCGTCCTGTGCATTGCAGG - Intronic
1079453036 11:20613852-20613874 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1079524304 11:21365962-21365984 AGGGCTGTCCTGTGCATTGTAGG + Intronic
1080715076 11:34792321-34792343 GGGGCAGTCCTGTGCATTGTAGG - Intergenic
1080837027 11:35948820-35948842 GGGGTTGTCCTGTGCATTGCGGG + Intronic
1080846614 11:36032581-36032603 GGGGCTGTCTTGTGTATTGCAGG + Intronic
1080887828 11:36382671-36382693 GGGGCTGTCCTGTGCATAGTAGG + Intronic
1081888979 11:46524360-46524382 GAGGCTGTCCTGTGCATTGTAGG - Intronic
1082085873 11:48049148-48049170 AGCGCTGTCCTGTGCATTGCAGG + Intronic
1082107981 11:48241805-48241827 GGGACTGTCCTGTGCATTGTAGG + Intergenic
1082828668 11:57599171-57599193 GGGGCTACCCTGCGCATTTTAGG + Intronic
1083121656 11:60519270-60519292 GGTGCTGTCCTGTGGATCACAGG - Intronic
1083140928 11:60720954-60720976 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1083486632 11:62987094-62987116 GGGCCTGTCCTGTGCATTGCAGG - Intergenic
1083560253 11:63667856-63667878 GGGGCTATCCTACGCACTACAGG + Intronic
1083760594 11:64814745-64814767 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1084854356 11:71972601-71972623 GGGGCTGTCCTGTATATTATAGG + Intronic
1084922439 11:72482036-72482058 GGGGCTGTCATGTGCATTGTAGG + Intergenic
1085058051 11:73419443-73419465 GGCGCTGTCCTGTGCATTATAGG - Intronic
1085150962 11:74252614-74252636 GGGACTGTCCTGTGCATTGTAGG + Intronic
1085331722 11:75657507-75657529 GGGCCTGTCCTGTGCATTGCAGG - Intronic
1085557431 11:77437652-77437674 GGGGCTGTCCTGTGCCTCATAGG - Intronic
1085571233 11:77559628-77559650 GGTGCTGTCCTGTGCACTGCAGG + Intronic
1086486482 11:87308121-87308143 GGAGCTTTCATGCTCATTACTGG - Intronic
1086940052 11:92787003-92787025 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1086945157 11:92837458-92837480 GGGGCTGACCTGTGCATTTTAGG - Intronic
1087305186 11:96480931-96480953 GGGGCTGTCCTGCACATTGTAGG - Intronic
1087511834 11:99104302-99104324 GAGGCTGTCCTGTGCATTTTTGG + Intronic
1087646402 11:100813221-100813243 GGGTCTGTCCTGTGCATTGTAGG + Intronic
1087670515 11:101100827-101100849 GGGGATGTCCTGTGCATTATGGG - Intronic
1087923843 11:103896932-103896954 GGGGCTGTCCTGTGCATTACAGG - Intergenic
1088396859 11:109378622-109378644 GGGGCTGTACTGTGTATTGCAGG - Intergenic
1088470473 11:110183939-110183961 AGGGCTGTCCTGTGCATTGTAGG + Intronic
1089519540 11:119054778-119054800 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1089555465 11:119313734-119313756 GGGGCTGTCCTGTGCCCTATAGG + Intronic
1089565948 11:119371845-119371867 GGGGCTGACCTGCTGATTGCAGG - Intronic
1089575017 11:119435743-119435765 GGGACTGTCCTGCACATTGTGGG - Intergenic
1089982317 11:122782487-122782509 GTGGCTGTCCTGTGCATGATGGG - Intronic
1089992993 11:122879193-122879215 GGGACTGTCCTGTGCATTTTAGG + Intergenic
1090006245 11:123005108-123005130 GGGGCTGTCTTGTGCATTGTGGG + Intergenic
1090150552 11:124379231-124379253 GGGGCTGTCCTGTGTAGCACAGG + Intergenic
1090181778 11:124705808-124705830 GGATCTGTCCTGAACATTACAGG - Intergenic
1090324923 11:125877144-125877166 GGGGCTGTTCTGTGCATTTTAGG - Intergenic
1090381432 11:126330293-126330315 GGGGCTGTCCTGTGCATTGAAGG - Intronic
1090517916 11:127448358-127448380 GGGGCTGTCTTGTGCATTGCCGG + Intergenic
1090698280 11:129270874-129270896 GGAGTTGTCCTGTGCATTACTGG + Intronic
1090761018 11:129837005-129837027 GGGGCCGTCCTGCACATTGCGGG - Intronic
1090762546 11:129849856-129849878 GGGGCTGCCTTGCTCATTAGAGG - Intronic
1091031046 11:132188193-132188215 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1091294884 11:134466624-134466646 GGGGCTGCCCTGGGCAGCACGGG + Intergenic
1091636425 12:2200473-2200495 GGGGCTGTCCTGTGCATGGCAGG - Intronic
1091995437 12:4989201-4989223 GGGGCTGCCCTGTGCATTGTAGG - Intergenic
1093099740 12:15013511-15013533 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1093650209 12:21634500-21634522 GGGGCTGAACTGCGCATTGTAGG - Intergenic
1094030779 12:26009466-26009488 GGGACAGTCCTGTGCACTACAGG - Intronic
1094175738 12:27539006-27539028 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1095559141 12:43544921-43544943 GGGGCTGTGCTGTGCATTGTGGG + Intronic
1095657713 12:44689818-44689840 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1095672704 12:44878497-44878519 GGGGCTGTCCTGTGCCTTGTAGG + Intronic
1095682609 12:44996532-44996554 GAGGCTGTCCTGTGCATTGTAGG + Intergenic
1095980093 12:47967770-47967792 GGGGCTGTTCTGTGCATTATAGG + Intronic
1096970273 12:55659915-55659937 GGGGCTGTTCTGTGCATTGTAGG + Intergenic
1097705472 12:62864145-62864167 AGGGCTGTCTTGCACATTACAGG - Intronic
1097903496 12:64896885-64896907 GGGGCTGTGCTAGGCATTATAGG - Intergenic
1098066981 12:66628777-66628799 GGAGCTGTTCTGGGCATTGCTGG - Intronic
1098910201 12:76201357-76201379 GTGTCTGTCCTGTGCATTGCAGG + Intergenic
1098928580 12:76382437-76382459 GGGGTTGTTCTGTGCATTGCAGG + Intronic
1098973717 12:76880072-76880094 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1099653670 12:85461630-85461652 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1099839834 12:87951667-87951689 GGGGCTGTCCTATGCATTGTAGG + Intergenic
1100364506 12:93907292-93907314 GGGGCTGTCCTGGGCACCAGGGG - Intergenic
1100682049 12:96935590-96935612 GGGGCTGTCCTGGGTATTGTAGG + Intronic
1100686558 12:96992706-96992728 GTGGCTGTCCTGTGCATTGTAGG - Intergenic
1100846006 12:98658785-98658807 GGGACTGTCCTATGCATTATAGG - Intronic
1101057716 12:100936306-100936328 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1101143575 12:101820529-101820551 GGGGCTGTCCTGTGCACTATAGG + Intronic
1101269394 12:103127706-103127728 GGAGGTGTCCTGTGCATTGCAGG - Intergenic
1101308259 12:103553114-103553136 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1101565286 12:105899158-105899180 GGGGCTGTCCTGTGCAATGTAGG - Intergenic
1101633399 12:106517170-106517192 GGGGCTGTCCTGTGCATTGTGGG + Intronic
1101723734 12:107372978-107373000 GGGGCTGTCCTGTGCATGGTAGG + Intronic
1101878620 12:108611377-108611399 GGGGCTGTCCTGTGCACTGTGGG + Intergenic
1101930498 12:109009855-109009877 GGGGCTGTCCTATGCATTGTAGG - Intronic
1101938944 12:109084552-109084574 GGGGCTGTCCTGTGCATTAGAGG - Intronic
1101939506 12:109089464-109089486 GGGGCTGACCTGTGCCTTGCAGG - Intronic
1101948961 12:109159658-109159680 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1102002192 12:109564155-109564177 GGGGCTGTCCCCTGCATTGCAGG + Intronic
1102366478 12:112340578-112340600 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1102602766 12:114045027-114045049 GGGACTGTCCTATGTATTACAGG - Intergenic
1102637133 12:114334322-114334344 GGGCCTGTCCTGTGCATTGTAGG + Intergenic
1102676084 12:114660116-114660138 GGGGCTGTCCTGCGCACTGTAGG - Intergenic
1102711926 12:114935731-114935753 GGGGCTATCCTAGGCGTTACGGG + Intergenic
1102766736 12:115440094-115440116 GGGGCTGCCCTGTGCATTGTCGG + Intergenic
1102792648 12:115660166-115660188 GGGGCTGTCCTGTGCATTGTGGG - Intergenic
1102859404 12:116322225-116322247 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1102882162 12:116493903-116493925 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1102908912 12:116697627-116697649 GGGGCTGTCCTGGGCACTGCAGG - Intergenic
1102941471 12:116946452-116946474 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1103009802 12:117449416-117449438 AGGGCTGTCCTATGCATTAGAGG + Intronic
1103013929 12:117479474-117479496 GGGGCTGTCCTGGGCATTGCAGG + Intronic
1103101786 12:118182406-118182428 GGGGCCGTCCTGTGCATTGCAGG + Intronic
1103136005 12:118508467-118508489 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1103192225 12:119011344-119011366 GGAGCTGTCCTGTGCACTGCAGG + Intronic
1103275074 12:119704584-119704606 AGGGCTGTCCTGGGCATCGCAGG + Intronic
1103278434 12:119733711-119733733 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1103298852 12:119911755-119911777 GGTGCTGTCCTGCACATTGTGGG + Intergenic
1103621267 12:122188813-122188835 GGGGCTGTCCTGGGCATGGTGGG + Intronic
1103809881 12:123604930-123604952 GGGGCTGTCCTGGGCATTGTAGG + Intronic
1103838085 12:123840067-123840089 GCTGCTGTCCTGTGCATTACAGG + Intronic
1103847970 12:123912496-123912518 GGGTCTGTCCTGGGCACTATAGG + Intronic
1103910868 12:124351385-124351407 GGGGCTGTCCTGTGCACTGTGGG + Intronic
1104007259 12:124902204-124902226 GGGGCTGTCCCGTGCATTGTAGG - Intergenic
1104054984 12:125222710-125222732 GGGGCTGTCCTGGGAATTGTAGG + Intronic
1104063664 12:125288694-125288716 GGGGCTGTTCTGCGCATCGTGGG + Intronic
1104449762 12:128859526-128859548 GGGGCTGCCCTGTGCACTACAGG - Intronic
1104582541 12:130021788-130021810 GGGGCTGTCTTGTGCATTATAGG - Intergenic
1104615940 12:130268583-130268605 GGGGCCGTCCTGTGCACTGCGGG - Intergenic
1104717658 12:131026660-131026682 GGGGCTGGCCTGGGCATTGCAGG + Intronic
1105737097 13:23282813-23282835 GAGACTGTCCTGTGCATTGCAGG + Intronic
1106136465 13:26977232-26977254 GGGACTGTCCTGTGCATTCTAGG + Intergenic
1106274549 13:28191513-28191535 GGGGCTGTCTTGTGCATTGTAGG - Intronic
1106309668 13:28543234-28543256 GGAGCTGTCCTGTGCATTGGAGG - Intergenic
1106510151 13:30406223-30406245 GGGGCTGTCCTGTGCATGGTAGG + Intergenic
1106595708 13:31133971-31133993 GGGGCTGTCCTGTGCCTTGTAGG - Intergenic
1107131006 13:36895410-36895432 GGGGCTGTCCTGTGCGTTACAGG + Intronic
1107422906 13:40265986-40266008 GGGGCTACCCTGCACATTGCAGG - Intergenic
1107674933 13:42785850-42785872 GAAGCTGTCCTGTGCATTACAGG + Intronic
1107748169 13:43534824-43534846 GGGTCTGTCCTGAGCATTGTGGG - Intronic
1107879939 13:44824152-44824174 GGGTCTGTCCTGTGCATTGTAGG + Intergenic
1108478176 13:50842055-50842077 GGGGTTGTCCTGTGTATTAGAGG - Intronic
1108784236 13:53874844-53874866 GGTGCTGTCCTGTGCATTGTAGG - Intergenic
1109263413 13:60169650-60169672 GGAGCTGTCCTGTGCATTGCAGG + Intergenic
1109298411 13:60563543-60563565 TGGGCTGTCCTGTGCATTGTAGG + Intronic
1110174570 13:72540340-72540362 GGAGCTGTCCTCTGCATTATAGG + Intergenic
1111708822 13:91785267-91785289 GGGGCTATCCTGAGCATTGTAGG + Intronic
1112038719 13:95523825-95523847 GGGGCTGTCTTGTGCATTGTAGG + Intronic
1112380902 13:98889019-98889041 GTGGCTGTCCTGTGAAATACAGG - Intronic
1112426959 13:99311343-99311365 GGTGCTGTCCTGCGGAGCACAGG + Intronic
1112677223 13:101716019-101716041 GGGGCTGTCCTGTACACTGCGGG - Exonic
1112716336 13:102190469-102190491 GGGGCTGTTCTGGGCATTGTAGG - Intronic
1112761432 13:102697400-102697422 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1112828808 13:103423176-103423198 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
1113361126 13:109632514-109632536 AGGGCTGTCCTGTGCATTGCAGG - Intergenic
1113890066 13:113731049-113731071 GGGGCTGCCCTGTGTGTTACTGG - Intronic
1114218474 14:20675963-20675985 AGGGCTGTCCTGGGTATTGCAGG - Intergenic
1114475929 14:22994854-22994876 GGGGCTGTCGTGTGCACTGCAGG + Intronic
1114542783 14:23474827-23474849 AGGGCTGTCCTGGGCATTGTAGG - Intronic
1115183436 14:30656452-30656474 GGAGCTGTCCTGTGCATTGTAGG + Intronic
1115287112 14:31726886-31726908 GGGGCTGTCCTGTACATTGTAGG + Intronic
1115417383 14:33152147-33152169 GGGGCTTTCCTGCGCACTGTAGG - Intronic
1115740461 14:36382152-36382174 GAGGCTGTCCTGTGCATTATAGG + Intergenic
1116159450 14:41250516-41250538 GGGGCTGTCTGGTACATTACAGG + Intergenic
1116558475 14:46344565-46344587 GGGGTTGTCCTGTGCATTGCAGG - Intergenic
1117032213 14:51684702-51684724 GGGGCTGTCCTGCACATTGTAGG - Intronic
1117378126 14:55134293-55134315 GGCGCTGTCCTGTGCACTGCAGG - Intronic
1117438666 14:55741012-55741034 GGGGCTGTCCTGTGCACTGTGGG + Intergenic
1117439049 14:55743424-55743446 GGAGCTGTCCTGTGCATTATGGG - Intergenic
1117484309 14:56178607-56178629 GGGGCTGTGCTGTGCATTGTAGG + Intronic
1118077504 14:62316557-62316579 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1118282879 14:64445103-64445125 GGGGCTGTCCTGTGCATTAAAGG - Intronic
1118333368 14:64831563-64831585 GGGGCTGCCCTGTGCACTACTGG + Intronic
1118575635 14:67239418-67239440 GGGACTGTCCTGTGCATCATAGG - Intergenic
1118736393 14:68704525-68704547 GGGGCTGTCCTGGCCATTGTAGG + Intronic
1118795167 14:69136769-69136791 GGAGCTGTCCTGTGCACTATAGG - Intronic
1119005784 14:70926596-70926618 GGCGCTGTCATGTGCATTATAGG - Intronic
1119071594 14:71590834-71590856 GGGGCTGTCCTGTGTATTGTAGG + Intronic
1119266720 14:73267095-73267117 AGGGCTGTCCTGTGCTTTGCAGG + Intronic
1119545423 14:75468218-75468240 GGGGCTGGCCTGTGCATTGAAGG + Intronic
1119591506 14:75892601-75892623 GGGACTGTTCTGCGCTTTGCAGG - Intronic
1119624873 14:76164310-76164332 GGGGCTGTGCTGTGCATTGCAGG + Intronic
1119688163 14:76649527-76649549 GGGGGTGTCCTGGGCATTGTAGG - Intergenic
1119722841 14:76902767-76902789 GGGGCTGTCCTTTGCCTTGCAGG + Intergenic
1119798959 14:77425688-77425710 GGGGCTGTCCTGTGGATTGTAGG + Intergenic
1119943661 14:78668593-78668615 AGGGCTGTCCTGTGCATTGTAGG - Intronic
1120354915 14:83419969-83419991 GGGGCTGTCCTGTGAATTGCAGG + Intergenic
1120926553 14:89802991-89803013 GGGGCTGTCCTGGGCATTGCAGG + Intronic
1120987132 14:90343953-90343975 GGGGCAGTCCTGGGCATTGTAGG - Intergenic
1120988653 14:90355641-90355663 AGGGCTGTCCTGAGCCATACCGG - Intergenic
1121162206 14:91754167-91754189 GAGTCTGTCCTGCGCATTGTAGG - Intronic
1121232737 14:92369723-92369745 GGGGCTGTCCTGTACATTATAGG + Intronic
1121238953 14:92414193-92414215 GGGGCTGTCCTGTGCTTTGAAGG + Intronic
1121337152 14:93084390-93084412 GGGGCTGTCCTCTGCATTACAGG - Intronic
1121456142 14:94039981-94040003 GGGGCTGTCCTATGCATTGTAGG + Intronic
1121552599 14:94813695-94813717 GGGGCTGTCCTGCGCACTGTAGG - Intergenic
1121558240 14:94854693-94854715 GGGGCTGTCCTACGCATTGTAGG - Intergenic
1121605396 14:95236557-95236579 GGGGCTGTCCCGTGCATGGCAGG - Intronic
1121623071 14:95363575-95363597 GGGGCTGTCCTGGGCACTGCAGG - Intergenic
1121636352 14:95456451-95456473 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1121718496 14:96092920-96092942 GGGGCTGCCCTGTGCATTGTAGG - Exonic
1121787505 14:96673528-96673550 GGGGTTGTCCTGTGTATTACAGG - Intergenic
1121884294 14:97528857-97528879 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1121951092 14:98171752-98171774 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1121979671 14:98443801-98443823 GGGCCTGTCCTGGGCATTACAGG + Intergenic
1122066402 14:99176683-99176705 GGGGCTGTCCTGCGCATTGCAGG + Intronic
1122443890 14:101755321-101755343 GTGGCTGTCCTGTGCATTGTTGG + Intergenic
1122884927 14:104706729-104706751 GGGACTGTCCTGTGCATTATGGG - Intronic
1122957061 14:105075803-105075825 GGGGCTGTCCTGTGTGTTGCAGG - Intergenic
1122983964 14:105203749-105203771 GGGCCTGGGCTGAGCATTACTGG - Intergenic
1124576414 15:30912806-30912828 GGGGCTGTCCTGTAAATTATAGG - Intronic
1124984271 15:34590880-34590902 GGGGCTATCCTGTGCATTGTAGG + Intergenic
1125449775 15:39796135-39796157 AGGGCTGTCCTGTGCATTAGAGG + Intergenic
1125642704 15:41244634-41244656 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1126056595 15:44735639-44735661 GGGGCTGTCCTGTGAATTTTAGG - Intronic
1126176781 15:45743275-45743297 GGGGCTGTTCTGGGCACTGCGGG - Intergenic
1126369024 15:47926333-47926355 GGGGCTGCCCTGTGCATTGTTGG - Intergenic
1126377016 15:48006969-48006991 GGGGCTGTCCTGTGTATTGTAGG - Intergenic
1126792432 15:52233424-52233446 GGGGCTGTCCCACGCATTGCAGG + Intronic
1127060058 15:55173151-55173173 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1127132465 15:55881863-55881885 GGGGCTGTCTTGTGCATTGAAGG + Intronic
1127284264 15:57518774-57518796 GGGGCTGTCCTGTGCTTCATAGG - Intronic
1127381463 15:58434154-58434176 AGGGCTGTCCTGTGCATTGTAGG - Intronic
1127392502 15:58518116-58518138 GAGGCTGTCCTGTGCATTGAAGG + Intronic
1127461990 15:59207452-59207474 GGGGCTGTACTGGACAATACTGG - Exonic
1127791425 15:62401968-62401990 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1127903863 15:63361518-63361540 AGGACTGTCCTGCACATTGCAGG - Intronic
1128632737 15:69282242-69282264 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1128636912 15:69308475-69308497 GGGACTGTCCTGTGCACTGCAGG + Intronic
1128923210 15:71630918-71630940 GGGGCTGTCCTGTGCGTTGTAGG + Intronic
1129098934 15:73240034-73240056 GGGACTGTCCTGTGCATGGCAGG - Intronic
1129289131 15:74549891-74549913 GGGGCTGTCCAGTGCGTTATAGG - Intronic
1129438972 15:75565472-75565494 GGAGCTGTCCTATGCATTAGAGG + Intronic
1129504128 15:76066900-76066922 GGGGCAGTCCTGTGCATTGTAGG + Intronic
1129590897 15:76914203-76914225 GGAGCTATCCTGTGCATTGCAGG - Intergenic
1129678973 15:77647246-77647268 TGGGCTGTCCTGCCCCTGACAGG + Intronic
1129873661 15:78958040-78958062 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1129923622 15:79341900-79341922 AGGGCTGTCCTGTGCCTTGCAGG - Intronic
1129971084 15:79778706-79778728 GAGGCTATCCTGTGCATTGCAGG + Intergenic
1130001874 15:80054831-80054853 GGGGCTGCCCTGTGCATTACAGG + Intergenic
1130176635 15:81578700-81578722 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1130223321 15:82039645-82039667 GGGGCTGTCCTGTGCAATGTAGG + Intergenic
1130231946 15:82103905-82103927 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1130233337 15:82113173-82113195 GGGCCTGTCCTGTGCATTGCAGG + Intergenic
1130853161 15:87817820-87817842 GGTGCTGTCCTGTGCATTATAGG - Intergenic
1130874185 15:87998067-87998089 GGGGCTGTCCTGAGCATTGTGGG + Intronic
1130898385 15:88188444-88188466 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1130899320 15:88195141-88195163 GGGGCTGTCTTGTGCATTGTAGG - Intronic
1130918603 15:88325242-88325264 GGGGCTGTCCTGTGCATTGTTGG - Intergenic
1130928107 15:88400117-88400139 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1131018991 15:89082021-89082043 GGGGCTGTCCTGGGCACTGGAGG + Intergenic
1131156401 15:90078696-90078718 GAGGCTGTCCTGTGCATTGTAGG - Intronic
1131280680 15:91018709-91018731 GGGGCTGGCCTGTGCATTGTTGG - Intronic
1131393604 15:92069230-92069252 GGGGCTGTTCTGGGCATTGTAGG - Intronic
1131548564 15:93336511-93336533 GGGGGCGTCCTGCGCACTGCAGG - Intergenic
1131555973 15:93399265-93399287 GGGGCTGTCCTGTGTATTGAGGG + Intergenic
1131799734 15:96056672-96056694 GGGGCTGTCCTATGCACTGCAGG + Intergenic
1131888941 15:96951548-96951570 GGGGCTGTCCTGGGCATCTTAGG + Intergenic
1132418654 15:101644392-101644414 GGGGCTGTGCTGTGCATAGCAGG - Intronic
1133140892 16:3743222-3743244 GGGGCTGTCCTGCGCATTACAGG - Intronic
1133278567 16:4652342-4652364 GGGGCCGTCCTGTGCATGGCAGG - Intronic
1133537175 16:6713467-6713489 GGGTCTGTCCTGTGCATTGTAGG + Intronic
1133716787 16:8457769-8457791 GGGGGTGTCCTGTGCATTGTAGG - Intergenic
1133779771 16:8928939-8928961 GAGGCTGTCCTGTGCATTCCAGG - Intronic
1133823404 16:9256800-9256822 GGGGCTGTTCTGCGCACTGTGGG + Intergenic
1133836488 16:9372271-9372293 GGGGCTGTCCCATGCATTGCAGG + Intergenic
1133985288 16:10663686-10663708 GGGGCTGTCCTGTGCATTGGGGG + Intronic
1133995694 16:10746362-10746384 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1134028671 16:10974466-10974488 GGGGCTGTCCTGTGCGTTGTAGG + Intronic
1134083689 16:11341985-11342007 GGGGCTGTCGTGTGCACTGCAGG - Intronic
1134103968 16:11472034-11472056 GGGGCTGTCCTGTGCATTATGGG + Intronic
1134116488 16:11552789-11552811 GGGGGTGTCCTGTGCATTGTAGG - Intronic
1134145423 16:11757053-11757075 GGGTATGCCCTGTGCATTACAGG + Intronic
1134282465 16:12829898-12829920 GGGGCTGCCATGGGCATTATAGG - Intergenic
1134322109 16:13173654-13173676 GGGACTGTCCTGTGCATTTCAGG - Intronic
1134389073 16:13802040-13802062 GGGGTTGTCCTGCACATTGTAGG - Intergenic
1134390953 16:13819594-13819616 GGAGCTGTTCTGCGCATTGTAGG + Intergenic
1134562617 16:15223622-15223644 GGGGCTGTCTTGCGCATTGTAGG - Intergenic
1134628834 16:15742103-15742125 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1134669967 16:16047628-16047650 GGGGCTGTCCTGCGCACTGTAGG - Intronic
1134689802 16:16183773-16183795 GGGGCTGTCGTGTGCATTGTGGG - Intronic
1134779369 16:16881874-16881896 GGGGCTGCCCTGGGCATTGTAGG + Intergenic
1134801017 16:17084830-17084852 GGGGTTGTCCTGTGAATTATAGG + Intergenic
1134816715 16:17211887-17211909 GGGACTGTCCTGCGCACTGTAGG + Intronic
1134820609 16:17243963-17243985 GGGGATGTCCTGTGCATTGCAGG + Intronic
1134827423 16:17295797-17295819 AGGGTCGTCCTGTGCATTACAGG - Intronic
1134834761 16:17351757-17351779 GGTGCTTTCCTGTGCATTATGGG + Intronic
1134864571 16:17593244-17593266 GGGTCTGTCCTGTGCATTGTAGG - Intergenic
1134872143 16:17661667-17661689 GGGGCTGTCCTGTGTATTATGGG - Intergenic
1134891314 16:17843998-17844020 GGGTCTGTCCTCTGCATTTCAGG + Intergenic
1134900835 16:17936320-17936342 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
1134923157 16:18135249-18135271 GGGGCTGTCTTGCGCATTGTAGG - Intergenic
1135053576 16:19212193-19212215 GGAGCTGTCCTGTGCGCTACAGG - Intronic
1135059037 16:19255346-19255368 GGGCCTGTCCTGTGCATTGTAGG + Intronic
1135079661 16:19423242-19423264 GGGGCTGTCTTGTGCATTAGAGG + Intronic
1135164695 16:20128773-20128795 GGGGCTGTCTTGTGCATTGTAGG - Intergenic
1135232804 16:20725587-20725609 GGGGCTGTCATATGCATTACAGG + Intronic
1135237397 16:20770415-20770437 GAGGCTGCCCTGTGCATTATGGG - Intronic
1135336831 16:21608704-21608726 GGGGCTGACCTGCACATTGTAGG - Intronic
1135350078 16:21721461-21721483 GGTGCTGTCCTACGCATTGTAGG - Intronic
1135391365 16:22096141-22096163 GGGGCCGTCCTATGCATTGCAGG - Intronic
1135392737 16:22107328-22107350 GGAGCTGTCCTGTGCATTTCAGG - Intronic
1135827115 16:25738574-25738596 GGGTCTGTCCTGAGCATTGTGGG - Intronic
1135934648 16:26769276-26769298 GGAGCTGTCCTGTTCATTGCAGG - Intergenic
1136031473 16:27506347-27506369 GGGGCTGTCCTGTGTATTGCAGG + Intronic
1136054331 16:27677191-27677213 GGGGCTGACCTGCATATTGCAGG - Intronic
1136083967 16:27871237-27871259 GGGGCTGGCCTGTGCATTGTGGG - Intronic
1137395176 16:48112029-48112051 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1137789713 16:51164859-51164881 GGGGCTGTCCTGTGCAGTGTAGG - Intergenic
1137884050 16:52083387-52083409 GTGGCTGTCCTGGGCATTGTAGG + Intergenic
1138347651 16:56329899-56329921 GGGGCCGTCCTGCACACTATGGG - Intronic
1138621560 16:58215440-58215462 GAAGCTGTCCTGTGCATTACAGG - Intergenic
1139201855 16:64985792-64985814 GAGGCTGTTCTGCGCATTGTAGG - Intronic
1139212832 16:65097481-65097503 AGGGCTGTCCTGTGCACTGCAGG + Intronic
1139701464 16:68710498-68710520 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1139974630 16:70799645-70799667 TGGGCTGTCCTGTGCCTTGCAGG - Intronic
1140053173 16:71501182-71501204 GGAGCTGTCCTGTGCATTGTGGG - Intronic
1140069232 16:71634726-71634748 GGGGCTGTCCTGGCCATAAAGGG + Intronic
1140139215 16:72238916-72238938 GGGGCTGTCCTATGCATTTTAGG - Intergenic
1140217815 16:73022480-73022502 GTGGCTGTCCTGGGCATCGCAGG + Intronic
1140251863 16:73301432-73301454 GGGGCTGTCTTGTGCATTGTAGG + Intergenic
1140436988 16:74955336-74955358 GGGGCTGTCCTGTGCGTTGCAGG - Intronic
1140698044 16:77554437-77554459 GGGGCTGTCCTGAGTATGGCAGG - Intergenic
1140703998 16:77609222-77609244 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1140742648 16:77955350-77955372 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1140906344 16:79412528-79412550 GGGGCTGTCCTGTGTATTGCAGG + Intergenic
1140999775 16:80297435-80297457 GGGGCTGTCCCGTGCATCAGAGG + Intergenic
1141222506 16:82084261-82084283 GGCACTGTCCTGTGCATTACGGG + Intronic
1141343251 16:83222921-83222943 GGGGCTGTCCTGTGAATTGTAGG + Intronic
1141344889 16:83235259-83235281 GGGGCTGACCTGTGCATTGGAGG - Intronic
1141347602 16:83261584-83261606 GGGGCTGTCCTGGGCATTGCAGG - Intronic
1141484845 16:84331911-84331933 GGGGCTGTCCTGTGCAGTGTAGG + Intergenic
1141516109 16:84546245-84546267 GGGAGTGTCCTGTGCATTGCAGG + Intronic
1141660963 16:85441186-85441208 GGGGCTGTCCTGTGGATTGTAGG + Intergenic
1141681055 16:85544213-85544235 GGGACTGTCCCGTGCATTGCAGG - Intergenic
1141720661 16:85753501-85753523 GGGGCTGTCCTGCGCCCTGTGGG + Intergenic
1141929290 16:87190733-87190755 GAGGCTGTCTTGCCCATTGCAGG - Intronic
1142032102 16:87843753-87843775 GGGGGTGTCCCGTGCATTGCAGG - Intronic
1142788194 17:2242025-2242047 GGGGCTGTCCTGTGCGTTGTAGG - Intronic
1143212979 17:5203262-5203284 GAGGCTGCCCTGCCCATCACAGG + Intergenic
1143281492 17:5757960-5757982 GGGGCTGTCCTGGACATTGCAGG + Intergenic
1143298839 17:5893693-5893715 GGGGCTGTCCTGTACATTGAGGG - Intronic
1143527357 17:7480085-7480107 TGAGCTTTCCTGCGCATTCCTGG - Intronic
1144200896 17:12941487-12941509 GGGGCTGTCTTGTGCACTGCAGG - Intronic
1144335152 17:14262021-14262043 GAGGCCGTCCTGTGCATCACAGG + Intergenic
1144486488 17:15669830-15669852 GGGGCTGTCCCGTGCATTGTAGG + Intronic
1144689679 17:17252457-17252479 TGGGCTGTCCTGGGCACTGCAGG + Intronic
1144914531 17:18712460-18712482 GGGGCTGTCCCGTGCATTGTAGG - Intronic
1146180653 17:30696197-30696219 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1146198863 17:30838006-30838028 AGGGCTGTCCTGTGCATTGTAGG + Intronic
1146231540 17:31115244-31115266 GGGGCTGTCCTGTGCATTTCAGG - Intronic
1146239767 17:31209047-31209069 GGGGCTGTACTGCGCATTGTGGG + Intronic
1146522035 17:33532889-33532911 GGGGCTCTCCTGTGCATTGTAGG + Intronic
1146595726 17:34166866-34166888 GGAGCTGTCCTGTGCATTGTAGG + Intronic
1146683146 17:34822953-34822975 GGGGCTGTCCTGTGCATGGTAGG + Intergenic
1146841569 17:36159935-36159957 GGGGCTGTCCTGCACCTGGCAGG + Intergenic
1146853880 17:36247896-36247918 GGGGCTGTCCTGCACCTGGCAGG + Intronic
1146866209 17:36337131-36337153 GGGGCTGTCCTGCACCTGGCAGG + Intronic
1146869787 17:36371788-36371810 GGGGCTGTCCTGCACCTGGCAGG + Intronic
1146877142 17:36422868-36422890 GGGGCTGTCCTGCACCTGGCAGG + Intronic
1147069079 17:37937743-37937765 GGGGCTGTCCTGCACCTGGCAGG + Intergenic
1147072666 17:37972412-37972434 GGGGCTGTCCTGCACCTGGCAGG + Intergenic
1147080605 17:38017280-38017302 GGGGCTGTCCTGCACCTGGCAGG + Intronic
1147084188 17:38051950-38051972 GGGGCTGTCCTGCACCTGGCAGG + Intronic
1147096550 17:38141240-38141262 GGGGCTGTCCTGCACCTGGCAGG + Intergenic
1147100136 17:38175916-38175938 GGGGCTGTCCTGCACCTGGCAGG + Intergenic
1147428972 17:40360040-40360062 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1147759220 17:42786885-42786907 GGGACTGTCCTGTGCATTGTAGG + Intronic
1147887431 17:43693569-43693591 GGGGCTGTCCTGTAGATTGCAGG + Intergenic
1148139858 17:45320549-45320571 AGGGCTGTCTTGTGCATTGCAGG + Intergenic
1148208744 17:45795446-45795468 GGGGCTGGCCTGTGCATTTTAGG + Intronic
1148955518 17:51350647-51350669 GGGGCAGTCCTGTGCATTTTGGG - Intergenic
1149012975 17:51876547-51876569 GGGAATGTCCTGTGCATTGCAGG + Intronic
1149304942 17:55338600-55338622 GGGGCTGTCCTGTGCATTGTGGG + Intergenic
1149479570 17:56991814-56991836 GAGGCTGTCCTGTGCATTGTAGG + Intronic
1149486333 17:57045875-57045897 GGGGCTGCCGGGCGCAGTACGGG - Intergenic
1149845263 17:60005729-60005751 GGGGCTGTCCTGCACCTGGCAGG - Intergenic
1149857737 17:60097424-60097446 GGGGCTGTCCTGCACCTGGCAGG - Intergenic
1149999585 17:61425439-61425461 GGGGCTGCCCTGTGCATTGTAGG - Intergenic
1150083081 17:62258952-62258974 GGGGCTGTCCTGCACCTGGCAGG + Intergenic
1150383612 17:64740187-64740209 GGGGCTGTTCTGTGCATTATGGG + Intergenic
1150453799 17:65291012-65291034 GGGTCTGTCCTGTGCATTGTAGG + Intergenic
1151286842 17:73118348-73118370 GGGGCTGTCCTGTGCATGGTAGG + Intergenic
1151350999 17:73532180-73532202 GGGGCTGTCCTGTCCATTGTAGG - Intronic
1151360971 17:73588665-73588687 GAGGCTGTCCTGAGCACTGCGGG - Intronic
1151396072 17:73823860-73823882 GGGGCTGTCCCGGGCCTTGCCGG - Intergenic
1151401253 17:73857461-73857483 GGGGCTGTCCCATGCACTACAGG - Intergenic
1151433802 17:74081861-74081883 AGGGCTGTCCTGCACATTGTAGG - Intergenic
1151562167 17:74876455-74876477 GGGGCTGTCCTGTGCATTGTTGG - Intergenic
1151692489 17:75695201-75695223 GGGGCTGTCCTGTGCTTTGCAGG + Intronic
1151867276 17:76812364-76812386 GGGGCTGTCCTGTGTATTGCAGG + Intergenic
1152422702 17:80202713-80202735 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1152450750 17:80378017-80378039 TGGGCTGTCCTGTGCACTGCAGG + Intronic
1152527054 17:80894307-80894329 GGGGCTGTCCTGGGCACCAGGGG - Intronic
1153284408 18:3445051-3445073 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1153512447 18:5870244-5870266 AGGGCTGTCCTGTGTATTATGGG + Intergenic
1153560701 18:6369404-6369426 GGGGCTGTCCTGTGCATTGTGGG - Intronic
1153675574 18:7453432-7453454 GGGCCTGTCCTGTGCATGGCAGG + Intergenic
1154175475 18:12085448-12085470 GGGGCTGTGCTGCCCATGGCGGG + Intergenic
1154196057 18:12267938-12267960 GGGGTTGTCCTGTGCATTGCAGG - Intronic
1154961145 18:21309876-21309898 GGGGCTGTTTTGTGCATTGCAGG - Intronic
1155001131 18:21687860-21687882 AGTGCTGTCCTGTGCATTATAGG + Intronic
1155498755 18:26466571-26466593 GGGGCTGTCCTGTGCAATATAGG - Intronic
1155576632 18:27254909-27254931 GGGGCTGTTCTGTGCATTGCAGG - Intergenic
1156061824 18:33086827-33086849 GGGACTGTCCTGTGCATTGTAGG + Intronic
1156400392 18:36734307-36734329 GAGGCTGTCCTGTGCATTATAGG + Intronic
1156437631 18:37150285-37150307 GAGGCTGTCCTGTGCATTGTAGG + Intronic
1157333828 18:46722639-46722661 GGGACTGTCCTGTGCATTATAGG + Intronic
1157404089 18:47409085-47409107 GGGACTATCCTGCACATTATAGG + Intergenic
1157716055 18:49888187-49888209 GGGACTCTCCTGTGCATTACTGG + Intronic
1157722184 18:49933668-49933690 GGTGCTGTCCTGTGCATCATAGG - Intronic
1157794888 18:50564329-50564351 GGAGCTGTCCTGTGCATTACAGG + Intronic
1157864427 18:51168572-51168594 GAGGCTGTCCTGTGCACTATGGG - Intergenic
1157992320 18:52511614-52511636 GGGGCTGTCTTGTGCATTGTAGG - Intronic
1158011235 18:52730293-52730315 GGAGCTGACCTGTGCATTATAGG - Intronic
1158395357 18:57075240-57075262 AGGGCTGTCCTGTGCATTGTAGG + Intergenic
1158443613 18:57499675-57499697 GTGGCCATCCTGTGCATTACAGG - Intergenic
1158509495 18:58077936-58077958 GGGGCTGTCCGGTGCATTACAGG - Intronic
1158572919 18:58612010-58612032 GGGGATGTCCTGTGCATTGCAGG + Intronic
1158590143 18:58772240-58772262 GGGGCTGTCCTGTGTATTGGAGG - Intergenic
1159004223 18:62998493-62998515 GGTGCTGTCCTGTGCATTGTGGG + Intergenic
1159019412 18:63131079-63131101 GGGGCTGCCCTGTGCATTGTGGG - Intronic
1159058124 18:63486747-63486769 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1159103823 18:63983135-63983157 GGGGCTGTCTTGTGCATTGTAGG - Intronic
1160101432 18:75923229-75923251 GAGGCTGTCCTGTGCATTGTAGG + Intergenic
1160132011 18:76233852-76233874 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1160677402 19:398799-398821 GGGGCCGTCCTGGGCACTGCTGG + Intergenic
1160733524 19:651672-651694 GGGGCTGTCGGGCGCCGTACCGG + Exonic
1160779690 19:872302-872324 GGGGCTGTCCTGGGCCCTGCAGG - Intronic
1160809552 19:1007526-1007548 GGGGCCGTCCTGGGCACTGCAGG - Intronic
1160811628 19:1015363-1015385 GGGGCCGTCCTGGGCACTGCGGG - Intronic
1160924810 19:1538861-1538883 GGGGCTGTCCTGGGCATTGCAGG - Intergenic
1160940326 19:1617795-1617817 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1160990897 19:1859934-1859956 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1160996230 19:1883324-1883346 GGGTCTGTCCTGGGCACTGCAGG - Intronic
1161028445 19:2047296-2047318 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161055439 19:2188556-2188578 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161059255 19:2206918-2206940 GGGGCTGTCCTGGGCAGTGCAGG + Intronic
1161078960 19:2300912-2300934 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161104260 19:2435484-2435506 GGGCCTGTCCTGGACATTTCAGG - Intronic
1161120335 19:2522169-2522191 GGGGCCGTCCTGGGCACTGCAGG - Intronic
1161121187 19:2527707-2527729 GGGGCTGTCCTGGGCACTGCAGG + Intronic
1161123906 19:2545263-2545285 GGGCCTGTCCTGGGCACTGCAGG - Intronic
1161129258 19:2578691-2578713 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161138430 19:2634266-2634288 GGGGCCGTCCTGGGCACTGCGGG + Intronic
1161138760 19:2636004-2636026 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161141994 19:2653623-2653645 GGGGCTGTCCTGGGCACTGCGGG + Intronic
1161144687 19:2670679-2670701 GGGGCTGTGCTGGGCACTGCAGG + Intronic
1161148518 19:2694456-2694478 GGGGCCGTCCTGGGCACTGCAGG - Intronic
1161148615 19:2694886-2694908 AGGGCTGTCCTGGGCACTGCAGG - Intronic
1161154717 19:2726716-2726738 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161155166 19:2728772-2728794 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161156508 19:2734605-2734627 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161162617 19:2769461-2769483 GGAGCTGTCCTGGGCACTGCAGG - Intronic
1161165995 19:2787827-2787849 GGAGCTGTCCTGGGCACTGCAGG - Intronic
1161212807 19:3076381-3076403 GGGGCTGTCCTGGGCACTGCAGG + Intergenic
1161214468 19:3086724-3086746 AGGGCTGTCCTGGGCATTGTTGG - Intergenic
1161216633 19:3097834-3097856 GGGGCTGCCCTGGGCACTGCAGG + Intronic
1161233657 19:3187694-3187716 GGGGCCGTCCTGGGCACTACAGG - Intronic
1161234887 19:3192910-3192932 GGGGCCGTCCTGGGCACTGCAGG - Intronic
1161236741 19:3201960-3201982 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161237054 19:3203544-3203566 GAGGCTGTCCTGGGCACTTCAGG - Intronic
1161247143 19:3259384-3259406 GGGGCCGTCCTGGGCACTGCAGG - Intronic
1161280509 19:3443050-3443072 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161281066 19:3446004-3446026 GGAGCTGTCCTGGGCACTGCAGG - Intronic
1161286259 19:3469906-3469928 GGGGCCGTCCTGGGCACTGCAGG - Intergenic
1161294845 19:3514401-3514423 GCGGCCGTCCTGGGCACTACAGG + Intronic
1161323175 19:3650541-3650563 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161328638 19:3675776-3675798 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161377726 19:3948815-3948837 GGGGCTGTCCTGGGCACTGCAGG - Intergenic
1161391831 19:4025150-4025172 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161424609 19:4196089-4196111 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161461323 19:4399605-4399627 GGGGCCGTCCTGGGCACTGCGGG - Intronic
1161475046 19:4480056-4480078 GGGTCTGTCCTGGGCATTGCAGG + Intronic
1161548308 19:4895837-4895859 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161558489 19:4957704-4957726 GGGGCCGTCCTGGGCACTGCAGG + Intronic
1161564959 19:4996876-4996898 GGGGCTGTCCTGGGCCCTGCAGG + Intronic
1161733086 19:5974160-5974182 GGGGCTGTCCTGTGCGTTGCAGG - Intronic
1161745663 19:6058181-6058203 GGGGCCGTCCTGAGCACTGCAGG + Intronic
1161917695 19:7241767-7241789 GGGACTGCCCTGTACATTACAGG - Intronic
1161938046 19:7384199-7384221 GGGGCTATCCTGTGCATTGTAGG + Intronic
1162102463 19:8347938-8347960 GGGGATGGCCTGTGCATTGCAGG - Intronic
1162795708 19:13086558-13086580 GGGGCTGTCCTGTGCACCGCAGG + Intronic
1162830469 19:13281530-13281552 GGGGCTGTCCTGGGCATCGGCGG + Intronic
1162834207 19:13305574-13305596 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1162977932 19:14219336-14219358 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1163013015 19:14437070-14437092 GAGGCTGTCCTGTGCACTGCAGG + Intronic
1163016647 19:14459878-14459900 GGGGCTGTCCTGCATACTAGAGG + Intronic
1163054571 19:14708616-14708638 TGGGCCGTCCTGTGCATTATAGG + Intronic
1163076745 19:14899344-14899366 TGGGCTGTCCTGTGCATTGTAGG - Intergenic
1163110513 19:15158153-15158175 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
1163205616 19:15800409-15800431 GGGGCTGTTCTGTGCATTGTAGG + Intergenic
1163213551 19:15859407-15859429 GGGGCTGTCCTGTACATTGCAGG - Intergenic
1163741617 19:19017426-19017448 GGAGCTGTCCTGGACATTGCAGG - Intronic
1163834731 19:19566261-19566283 GGGGCTGTCCTGTACACTGCAGG + Intronic
1164412849 19:28020298-28020320 GGGGCTTTCCTATGCATTATAGG - Intergenic
1164517343 19:28947723-28947745 GGGGCTTTCCTATGCATTGCAGG - Intergenic
1164740178 19:30570043-30570065 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1165215722 19:34270876-34270898 GGGGCTGTCTTGTGCATTATGGG + Intronic
1166714332 19:44956958-44956980 GGGGCTGCCCTGTGCATTTTAGG + Intronic
1167072173 19:47227712-47227734 GGGGCTGTCCTCAGCAGTCCCGG - Intronic
1167092786 19:47356068-47356090 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1167092986 19:47357580-47357602 GGGGCTGTCCTGTGCATCGTAGG - Intronic
1167554375 19:50184362-50184384 GAGGCTGTCCTGTGCATTGTAGG + Intergenic
1168214833 19:54917777-54917799 GGGGCTGCCCTGGGCATTGTAGG - Intergenic
1168260847 19:55193625-55193647 GGGGCCGTCCTGCGCATTGTAGG - Intronic
1168275182 19:55274068-55274090 GGGGCCGTCCTGTGCACTACAGG - Intronic
1168291019 19:55357602-55357624 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1168314409 19:55478150-55478172 AGGGCTGTCCTGTGCACTGCAGG - Intronic
1168358889 19:55721605-55721627 GGAGCTGTCCTGTACATTACTGG + Intronic
1168374110 19:55861067-55861089 GGGGCTCTCCTGTGCATTGTAGG + Intronic
1168379157 19:55905734-55905756 AGGACTGCCCTGTGCATTACAGG + Intronic
1168439643 19:56352962-56352984 AGGGCTGTCCTGTGCATTGTAGG + Intronic
1168451970 19:56473668-56473690 AGGGCTGTCCTGTGCATTGCAGG - Intronic
1168508629 19:56957026-56957048 AGGGCTGTGCTGTGCATTGCAGG - Intergenic
1168693605 19:58392674-58392696 GGGGCTGTCCTGCACACTATAGG - Intronic
925344772 2:3163212-3163234 GAGACTGTCCTGTGCATTACTGG + Intergenic
926143639 2:10383813-10383835 GGGGCTGTCCTGTGCATTGTGGG + Intronic
926769908 2:16361687-16361709 TGGACTGTCCTGTGTATTACAGG + Intergenic
926875913 2:17478490-17478512 GGGACTGTCCTGTGCATTATGGG + Intergenic
926932866 2:18057584-18057606 GGGCCTGTCCTGTGCATTGTAGG - Intronic
927029978 2:19110865-19110887 GGTGCTGTCCTGTGCATTGTAGG + Intergenic
927757537 2:25721201-25721223 GGGGCTGACCTGGGCATTGCAGG - Intergenic
927879024 2:26677454-26677476 TGGGGTGTCCTGTGCATTATAGG - Intergenic
928073889 2:28245168-28245190 GGGGCTGTCATGTGCATTGTAGG - Intronic
928199411 2:29237872-29237894 GGATCTGTCCTGTGTATTACAGG - Intronic
928227493 2:29464774-29464796 GGAGCTGTCCTGTGAATTATAGG - Intronic
928545611 2:32326706-32326728 GGAGCTGTCCTGAGCATTGTAGG - Intergenic
928586132 2:32760473-32760495 GGGGCTGTGCTGTGTATTACGGG - Intronic
928622257 2:33102284-33102306 GGGGCTGTTCTGTGCATTATAGG + Intronic
928730417 2:34225389-34225411 GAGGCTGTCCTGTGCATTGTAGG - Intergenic
928938663 2:36705867-36705889 GAGGCTGTCCTGGGCATTGCAGG + Intronic
929392043 2:41480778-41480800 GGGGCTGTCCTATGCATTGTAGG + Intergenic
929916294 2:46138807-46138829 GGGGCTGTGCTGTGTACTACAGG - Intronic
929918771 2:46157490-46157512 GGAGCTGTCCTGTGCATTGCAGG - Intronic
930002168 2:46868899-46868921 AGGGCTGTCCTGTGCATTTCAGG - Intergenic
930129499 2:47835120-47835142 GGGGCTGTCCTGTGCACTGTAGG + Intronic
930274633 2:49297137-49297159 GGAGCTGTCCTGTGCATTGCAGG + Intergenic
930325790 2:49915576-49915598 AGGGCTGTCCTGTGCACTTCCGG + Intergenic
930574688 2:53132017-53132039 GGGGCTGTCTTGTGCATTGTAGG - Intergenic
930764397 2:55070159-55070181 GGGGCTGTCTTGTGCATTCTAGG + Intronic
930836635 2:55801035-55801057 GGAGCTGTCCTGTGCATTGCAGG - Intergenic
931095381 2:58934467-58934489 AGGGCTGTCCTGTGCATTGTAGG + Intergenic
931234848 2:60404422-60404444 GGGTCTGTCCTGTGCATTATAGG - Intergenic
931412792 2:62049524-62049546 GGGGCTGTCCTGTGCATTAGGGG - Intronic
931525727 2:63150427-63150449 TGGGCTGTCCTGTGCATTGTAGG - Intronic
931649394 2:64454469-64454491 GGGGCTGTCCTGCGCGGGGCGGG - Exonic
931730459 2:65148551-65148573 GGAGCTGTCCTGTGCATTGTAGG + Intergenic
931745765 2:65290792-65290814 GGGGCTGTCCTGTGCATTGTGGG - Intergenic
931801454 2:65762155-65762177 GGGGCTGTCTTGAGCATTATAGG - Intergenic
932083542 2:68737435-68737457 GGGCCTGTCCTGTGAATTATAGG + Intronic
932112614 2:69014246-69014268 GGGGCTGTCCTGCGCGTTGTAGG + Intronic
932122559 2:69115069-69115091 GGGCCTGTCCTGTGCATTGGAGG + Intronic
932489023 2:72106710-72106732 GGGGCTGCCCTGTGCATTGGAGG + Intergenic
933227748 2:79770160-79770182 ATGGCTGTCCTGTGCATTGCAGG - Intronic
933246186 2:79977425-79977447 GGGGCTGTCCTGTACACTACAGG - Intronic
933294980 2:80479385-80479407 GAGGCTGTCCTGCGCACTATAGG - Intronic
933594498 2:84269229-84269251 GGAGCTGTCCTGTGGATTGCAGG - Intergenic
933822367 2:86125179-86125201 GGGTCTGTCCTGTGCATTGTAGG + Intronic
933841127 2:86286369-86286391 GGGGCTGTCCTGTGCATGATAGG - Intronic
934026963 2:88009227-88009249 GGGGCTGTCCTGTGCATTATAGG + Intergenic
935210510 2:100935928-100935950 GGGACTCTCCTGCATATTACAGG + Intronic
935620992 2:105129388-105129410 GGGACTGTCCTGTGCATTGTAGG - Intergenic
936067895 2:109345845-109345867 GAGGCTGTCCTGGGCATTGCAGG + Intronic
936523686 2:113228473-113228495 GAGGCTGTCCTGTGCATTGTAGG + Intronic
936838754 2:116742397-116742419 GGAGCTGTCCTGTGCATTACAGG + Intergenic
937027980 2:118714939-118714961 GGAGCTGTCCTGTGCATTATAGG + Intergenic
937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG + Intergenic
937370014 2:121290837-121290859 GGGGCTGTTCTATGCATTATAGG - Intergenic
937429579 2:121826864-121826886 AGGGCTGTCCTGTGCATTGCAGG - Intergenic
937849616 2:126620892-126620914 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
937880831 2:126863325-126863347 GGGGCTGTCCTGTGCATTTTAGG + Intergenic
938645699 2:133327945-133327967 GGGGCTATCCTGGGCATTGTAGG - Intronic
938933837 2:136111581-136111603 GGGGCTGTCCTGTGTATTGTAGG + Intergenic
938995399 2:136672621-136672643 GGGGTTGTCCTGTGCTTTATAGG + Intergenic
939136991 2:138308721-138308743 GGGTCCGTCCTGTGCATTATAGG + Intergenic
939699417 2:145371696-145371718 GAGGCTGTCCTATGCAATACAGG + Intergenic
939729808 2:145768837-145768859 TGGGCTGTCCTGTGCATTGTAGG - Intergenic
939885633 2:147678355-147678377 GAGGCTGTCCTGTGCATTACAGG + Intergenic
939943123 2:148375996-148376018 GGGGCTTTCCTGTGCATTGTAGG + Intronic
940162594 2:150729487-150729509 GGGGATGTCCTCTGCATTGCAGG - Intergenic
941030797 2:160509907-160509929 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
941102801 2:161315234-161315256 GGGGCTGTCTTGCGCATCATAGG - Intronic
941174315 2:162178402-162178424 GGGGCTGTCCTATGTATCACAGG + Intronic
941213216 2:162669721-162669743 GGGGCTGTCCTATGCAATACAGG - Intronic
941684186 2:168430704-168430726 GTGGCTGTCCTGTACATTGCAGG - Intergenic
941773940 2:169371576-169371598 GGGTCTGTTCTGTGCATTGCAGG - Intergenic
942238716 2:173939014-173939036 GGGGCTGTCCTCTGCATTGTAGG - Intronic
942283048 2:174386544-174386566 GGAGCTGTCCTGTGCATTGTAGG + Intronic
942414707 2:175746535-175746557 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
942571541 2:177320554-177320576 AGGGCTGTCCTAGGCATTGCAGG + Intronic
942891149 2:180990292-180990314 GGGTCTGTCCTATGTATTACAGG - Intronic
942934132 2:181533487-181533509 GGGGTTGTCCTGTGCATTGTAGG + Intronic
944213600 2:197231678-197231700 GGGGCTGCCCTGTGCATCATAGG - Intronic
944452880 2:199860798-199860820 GAGGCTGTCCTGTGCACTAAAGG + Intergenic
945006310 2:205411149-205411171 GGGGCTGTCCTATGCAGTATAGG - Intronic
945259885 2:207833597-207833619 GGGGGTGTCCTGTGCATCATAGG + Intronic
945289575 2:208113683-208113705 GAGGCTGTCCTGTGCATTGCAGG + Intergenic
945296546 2:208176547-208176569 GGGGCTGTCCTGTGCATTGTGGG - Intronic
945592184 2:211747277-211747299 GAGGCTTTCCTGTGCATTGCAGG + Intronic
946102413 2:217337363-217337385 AGGCCTGTCCTGTGCATTGCAGG - Intronic
946344647 2:219099257-219099279 AGGGCTGTCCTGTGCACTACAGG + Intronic
946469019 2:219939454-219939476 GAGGCTGTCCTGCCCATCACAGG + Intergenic
946646711 2:221845161-221845183 GAGGCTGTCTTGTGCATTGCAGG - Intergenic
947069761 2:226275096-226275118 GGGGCTGTCCTGTGCCTTGTAGG - Intergenic
947150159 2:227107321-227107343 GAGGCTGTCCTGTGAATTACAGG - Intronic
947150912 2:227114308-227114330 GGGGCTGACTTGTGCATTATAGG - Intronic
947361159 2:229346681-229346703 AGGGCTGTTCTGTGCATTATAGG - Intergenic
947798561 2:232910502-232910524 GGGGCTGCCTTGTGCATCACAGG - Intronic
948098447 2:235354946-235354968 GGGGCTGTCCTGTCCATTGGAGG - Intergenic
948178633 2:235962818-235962840 GGGGCTGTCCTGTGCATTGTAGG + Intronic
948258614 2:236586450-236586472 GGGGCTCTCCTGTGCACAACTGG - Intergenic
948395123 2:237639820-237639842 GGCGCTGTCCTATGCATTATAGG + Intronic
948400730 2:237683064-237683086 GCGGCTGTCCTGTGCATTGCAGG - Intronic
948411522 2:237766093-237766115 GGGGCTAGCATGGGCATTACTGG + Intronic
1169341842 20:4802256-4802278 GGGACTGTCTTGTGCATTGCAGG + Intronic
1169471497 20:5889596-5889618 AGGACTGTCCTGTGCATTGCAGG - Intergenic
1169588468 20:7113980-7114002 GAGGCTGTCCTGTGCATTGCAGG + Intergenic
1169807707 20:9576479-9576501 GAGGCTGTCCTGTGCATCATAGG - Intronic
1170314200 20:15025718-15025740 GGTGCTGTCCTGTGCATTGTGGG + Intronic
1170586018 20:17734723-17734745 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1170604414 20:17864928-17864950 GGGGCTGTCCTGTGTATTGCAGG - Intergenic
1170703243 20:18723130-18723152 GGGGCTGTCCTGTGCGTTGTTGG + Intronic
1170838303 20:19903651-19903673 GGGGCTGTCCTGGTCATTGGAGG - Intronic
1171236186 20:23526895-23526917 GGGGCTGCCCTGTGCCTTGCAGG - Intergenic
1171372854 20:24672904-24672926 GGGGTTGTCCTGGGCATTGTAGG - Intergenic
1172608895 20:36234723-36234745 GTGGCTGTCCTGTGCATTGTAGG - Intergenic
1172857718 20:38019785-38019807 AGGGCTGTCTTGTGCATTGCAGG + Intronic
1173235742 20:41244054-41244076 GGGGCTGTCCTGTAAATTGCAGG + Intronic
1173353686 20:42267676-42267698 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1173487847 20:43454852-43454874 GGGGCTGTCCTGTGCCTTGCAGG + Intergenic
1173565005 20:44032304-44032326 GGGGCTGCCCTGTGCATTGCAGG + Intronic
1173609932 20:44359638-44359660 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1173756148 20:45518218-45518240 AGGGCTGTCCTGAGCAGTATAGG - Intergenic
1173810866 20:45954279-45954301 GGGGCGGTCCTGTGCATTATGGG - Intronic
1173818585 20:46006296-46006318 GGGGCTGTCGTGTGCATTGTAGG - Intergenic
1173907389 20:46638820-46638842 GGGGCTGTCCTGTGCATGGGAGG + Intronic
1173925462 20:46778122-46778144 GGGGCTGTCCTGTGCTTTACAGG + Intergenic
1173948241 20:46968638-46968660 GGAGCTGTCCTGTGTGTTACGGG + Intronic
1173981582 20:47228263-47228285 GGGGCTGCCCTGTGCATTCTAGG - Intronic
1174103236 20:48143252-48143274 GGGGCTGTCCTGGGCATTGTAGG + Intergenic
1174119563 20:48252506-48252528 GGGGCTGGCCTGTGCATTGCAGG + Intergenic
1174172983 20:48628532-48628554 GGGGCTGTCCTGGGAACCACAGG + Intronic
1174176553 20:48649178-48649200 TGGGCTGTCCTGGACATTATAGG - Intronic
1174191540 20:48744120-48744142 GGGGCTGTCATGTGCATTATAGG + Intronic
1174191800 20:48745922-48745944 GGGTCTGTCCTGTACATTGCAGG - Intronic
1174204734 20:48829984-48830006 GGGCGTGTCCTGTGCATTTCAGG + Intergenic
1174212629 20:48891982-48892004 GGGGCTGTCCTGGGTATTGTAGG + Intergenic
1174272515 20:49380134-49380156 GGAGCTGTCCTGTGCATTGTAGG - Intronic
1174276177 20:49405931-49405953 AGGGCTGTCTCGTGCATTACAGG - Intronic
1174285578 20:49470525-49470547 GGGGCTGTCCTGTGCATTGGAGG - Intronic
1174308284 20:49630843-49630865 GGAGCTGTCCTGCTCATTGTCGG - Intergenic
1174412960 20:50347795-50347817 GGGGCTGTCCCATGCATTGCAGG + Intergenic
1174422594 20:50409364-50409386 GGGGCTGTCCTGGGCGTTGTGGG + Intergenic
1174433914 20:50491701-50491723 GGAGCTGTCCTGTCCATTATAGG + Intergenic
1174498741 20:50968580-50968602 GGGGCTGTCCTGGACATTGTAGG - Intergenic
1174504985 20:51011518-51011540 GGGACTGTCCTGTGCATTGTAGG - Intronic
1174509228 20:51038432-51038454 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1174510309 20:51046262-51046284 GGGGCTGTCCTATGCATTACAGG - Intergenic
1174559298 20:51418428-51418450 GGGGCTATCCTGTGCATGAAAGG - Intronic
1174563969 20:51451481-51451503 GGCGCTGTCCTGGGCACTGCAGG - Intronic
1174589298 20:51632499-51632521 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1174605305 20:51757123-51757145 GAGGCTGTCCTGGGCATTGTAGG - Intronic
1174607797 20:51773532-51773554 GGGGCTGTGCTATGCATTACAGG + Intergenic
1174671818 20:52315274-52315296 CAGGCTGTCCTGTGCATTGCAGG - Intergenic
1174688793 20:52482026-52482048 GGGGCTGTCATGTGCACTATAGG - Intergenic
1174705202 20:52648072-52648094 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1174706214 20:52658827-52658849 GAGGCTGTCCTGGACATTGCAGG - Intergenic
1174708903 20:52684704-52684726 GGGGCTGTCTTGTGCATTGCAGG - Intergenic
1174746836 20:53072030-53072052 GGGGCTGCCCTGTGCATTACGGG - Intronic
1174763318 20:53228531-53228553 GGGGCTGTCCTGGGCATTTTGGG + Intronic
1174777796 20:53361734-53361756 GGGACTGTCTTGTGCATTACGGG - Intronic
1174797150 20:53531689-53531711 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1174832547 20:53826226-53826248 GAGGCTGCCCTGTGCATTATAGG + Intergenic
1174858051 20:54065521-54065543 GGGGCGGTCCTTGGCATTGCAGG - Intronic
1174859498 20:54077300-54077322 GGGGCTGTCCTGTGCATCGTAGG + Intergenic
1174886846 20:54345082-54345104 GAGGCTGTCCTGTGCATTGCAGG - Intergenic
1174896663 20:54456700-54456722 ACGGCTGCCCTGCACATTACTGG + Intergenic
1174917467 20:54668682-54668704 GGGGCTGCCCTGCGCACTGCAGG + Intergenic
1174962994 20:55178853-55178875 GGGGCTGTCCTGTGTATTGTAGG + Intergenic
1175052438 20:56167753-56167775 GGGGCTGTCCTGGGCCTTACAGG - Intergenic
1175069979 20:56325043-56325065 GGAGCTGTCTTGTGCATTATAGG + Intergenic
1175151744 20:56940375-56940397 GGGCCTGTCCTGGGCATTGTAGG + Intergenic
1175159866 20:57000260-57000282 GGGGCTGTCCTGCACAGTGTAGG + Intergenic
1175166536 20:57048252-57048274 GGGGCTGCCCTGGGCATTGCAGG - Intergenic
1175178138 20:57126026-57126048 GAGGCTTTCCTGGGCATTATAGG - Intergenic
1175197276 20:57252947-57252969 GGAGCTGTCCTGTGTATTATAGG - Intronic
1175207368 20:57321757-57321779 GGGGCTGTCCTGTGCTTTGCAGG + Intergenic
1175306151 20:57977013-57977035 GGGGCTGTCCTGGGCATCGTAGG + Intergenic
1175476686 20:59280397-59280419 GGGGCTGTCCTGTGTGTTGCAGG + Intergenic
1175485485 20:59342929-59342951 GGGGCCATCCTGTGCATTGCGGG + Intergenic
1175501414 20:59453573-59453595 TGGCCTGTCCTGTGCATTGCAGG + Intergenic
1175531368 20:59675734-59675756 GGGGCTGTGCTGTGCATTGCAGG - Intronic
1175688061 20:61045732-61045754 GGTGCTGTCCTGTGCATTGTAGG + Intergenic
1175770755 20:61622708-61622730 GGGGCTGCCCTGTGCATTGTGGG + Intronic
1175792620 20:61751204-61751226 GGGGCTGTCCTGTGTGCTACAGG + Intronic
1176068417 20:63212862-63212884 GGGGCTGTCCTGTGCATTGTTGG - Intronic
1176958171 21:15129912-15129934 GGGGCTGTCCTCTCCATTGCAGG - Intergenic
1177677642 21:24322549-24322571 GAGGCTGTCCTGAGCATTGTAGG + Intergenic
1177786716 21:25679559-25679581 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1177888287 21:26773231-26773253 AGGAATGTCCTACGCATTACAGG + Intergenic
1178029679 21:28510111-28510133 GGGTCTGTCCTGTGCATAATAGG + Intergenic
1178305500 21:31487237-31487259 GGGGCTGTCCTGTGCCTTGTAGG - Intronic
1178412267 21:32374690-32374712 GGGGCCATCCTGGGCATTACAGG + Intronic
1178490067 21:33044315-33044337 GGGGCTGTCCTGCGCAGTGTAGG + Intergenic
1178528141 21:33350187-33350209 GGGGCTGTCCAGTGCAGTGCAGG + Intronic
1178581202 21:33839902-33839924 GGGACTGTCCTGTGCACTGCAGG - Intronic
1178737894 21:35169192-35169214 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1178822053 21:35984290-35984312 GGGGCTGTTCTGTGCATGATAGG + Intronic
1178905876 21:36635571-36635593 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
1178924209 21:36761638-36761660 GGGGATGTCCTGTGCCTTAAAGG - Intronic
1179117961 21:38511797-38511819 GGGGCTGCCCTGTGCATGGCAGG + Intronic
1179374069 21:40833882-40833904 GGAGCTGTCCTGTGCATTACAGG + Intronic
1179389449 21:40974221-40974243 GGGGTTGTCCTGTGCATAACAGG + Intergenic
1179454963 21:41493017-41493039 GGGGCTGTCTTGTGCCTTGCGGG + Intronic
1180831268 22:18907582-18907604 GATGCTGTCTTGCGCATTGCAGG + Intronic
1181064219 22:20298180-20298202 GGAGCTGCCCTGTGCATTGCAGG - Intergenic
1181068585 22:20318791-20318813 GATGCTGTCTTGCGCATTGCAGG - Intronic
1181114644 22:20623757-20623779 GGAGCTGTCCTGTGCTTTGCAGG + Intergenic
1181781614 22:25197891-25197913 GGAGCTGTCCTGTGCACTGCAGG - Intergenic
1181788669 22:25246121-25246143 GGGGCTGCCCTGTGCACTGCAGG + Intergenic
1181820357 22:25470821-25470843 GGGGCTGCCCTGTGCACTGCAGG + Intergenic
1181872575 22:25911631-25911653 AGGGCTGTCCTGTACATTGCGGG + Intronic
1181921080 22:26320901-26320923 GGGACTGTCCTGTGCATTGTAGG - Intronic
1181925963 22:26358876-26358898 GGGGCTGTCCTGGGCACTGGAGG - Intronic
1182012357 22:27011462-27011484 GGGGCTGTCTTGTGCATTGTGGG + Intergenic
1182171975 22:28239984-28240006 GGAGCTGTCCTGTGCATTGTAGG + Intronic
1182253116 22:29017704-29017726 GGGGCTGTCCTGGGCATGCTAGG + Intronic
1182262110 22:29080837-29080859 GGGGCTCTCCTGTGCATTCTAGG - Intronic
1182653129 22:31868331-31868353 GGGGCTGTCCTGTGCATTGCTGG - Intronic
1182656598 22:31895242-31895264 GGGGCTGCCCTGTGCATTATAGG - Intronic
1182779411 22:32855688-32855710 GGGGCTGTCCTGAGTATTATGGG + Intronic
1182868936 22:33628917-33628939 GGGGCTGTCTTGTGCATTGTGGG - Intronic
1183273028 22:36873735-36873757 GGGGTTGTCCTGAGCATTGCAGG + Intronic
1184043726 22:41959121-41959143 GGGGTTGTCCTGCCCATTGTAGG + Intergenic
1184369782 22:44074987-44075009 GGAGCTCTCCTGAGCATTGCGGG + Intronic
1184544819 22:45160472-45160494 GTAGCTGTCTTGCGCCTTACTGG - Intergenic
1184633645 22:45807303-45807325 GGCACTGTGCTGCGCATCACCGG + Intronic
1203281354 22_KI270734v1_random:132853-132875 GATGCTGTCTTGCGCATTGCAGG + Intergenic
949274331 3:2260243-2260265 GAGGGTGTCCTGCGCATTATAGG + Intronic
949402959 3:3684494-3684516 GGGGCTCTCCTGTGTATTGCAGG - Intergenic
949675684 3:6450169-6450191 GGAGCTGTCCTGCACATTGTAGG - Intergenic
949839832 3:8307690-8307712 GGGGCTGTCATGTGCTTTGCAGG + Intergenic
949844300 3:8354272-8354294 GGGGCTGTCCTGTGCATTGAAGG + Intergenic
949902413 3:8827868-8827890 GGGGCTGTCCTGTGCATTGTTGG - Intronic
950482975 3:13255990-13256012 GGGGCTGCCCTGTGCATTGTAGG - Intergenic
950540754 3:13610865-13610887 GGGGCTCTCCTGCCCCTTTCTGG - Intronic
950678822 3:14570979-14571001 GGAGCTGTCCTGTGCACTGCAGG + Intergenic
950689263 3:14642707-14642729 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
950944161 3:16927644-16927666 GGGGCTGTTCTGTGCATTGTAGG + Intronic
951276295 3:20690278-20690300 AGGGCTGTCCTGTGCATTGAGGG + Intergenic
951403437 3:22263848-22263870 GGGGCTGTCCTGTGCATGGGAGG - Intronic
951609786 3:24479345-24479367 GGGGCTGCCCTGTGCAATATAGG - Intronic
951801990 3:26606035-26606057 GGAGCTGTCCTGTGCATTGCAGG - Intergenic
952224411 3:31360179-31360201 GGGGCCATCCTGTGCATTTCAGG - Intergenic
952399412 3:32949719-32949741 TGGGCTGTCCTGTGCATTGTAGG + Intergenic
952848473 3:37708650-37708672 GGAGCTGTCCTGTGCATTGTGGG - Intronic
953013927 3:39054323-39054345 GGAGCTGTCCTATGCATCACAGG + Intronic
953097003 3:39787726-39787748 AGGGCTGTCCTGTGCATTGTTGG - Intergenic
953144345 3:40260682-40260704 GGGGCTGTCCTATGCATTGTAGG - Intergenic
953167661 3:40479732-40479754 GGGGATGTCCTGTTCATTATAGG + Intronic
953243926 3:41173959-41173981 GGGGCTGTCCTGCATATTGTAGG - Intergenic
953294859 3:41704692-41704714 GGGGCTGTCCCGTGCATTCTGGG - Intronic
953349942 3:42207909-42207931 GGGGCTGTCCTGTACATTGTGGG + Intronic
953682163 3:45047718-45047740 GGGGCTGTCCTGGGCATTGTAGG + Intergenic
953735137 3:45487677-45487699 GGGGCTGTCTTTTGCATTGCAGG - Intronic
954035959 3:47851336-47851358 GAGGCTGTCCTGGGCCTGACAGG - Intronic
954789343 3:53119660-53119682 GGGGCTGTCCTGTGCATTGTAGG - Intronic
955016895 3:55079218-55079240 GGGGCTGTCCTGGGCTTTGTAGG - Intergenic
955036485 3:55273092-55273114 GGCATTGTCCTGTGCATTACAGG + Intergenic
955142702 3:56285412-56285434 GGGGCTGTCCTGTGCATTGCAGG - Intronic
955152293 3:56379992-56380014 GGAGCTGTCCTGTGCATTGCAGG + Intronic
955219430 3:57011537-57011559 GGGGCTGTCCTGTGCATTGGAGG - Intronic
955318948 3:57960670-57960692 GGGGCTGTCCTCTGCATTGTAGG + Intergenic
955371865 3:58358633-58358655 GGGGGTCTCCTGTGCATTACAGG + Intronic
955609258 3:60739583-60739605 GAGGCTGTCCTGTGCATTGCAGG + Intronic
955671744 3:61409726-61409748 GGAGTTGTCCTGCTCATCACAGG + Intergenic
955680136 3:61491661-61491683 GGGGCTGGCCTGCGTATTGTTGG - Intergenic
955694215 3:61619489-61619511 GTGGCTGTCCTGTGCACTACTGG - Intronic
955775420 3:62427507-62427529 GGGGCTGTCCTGTGCACTACAGG + Intronic
955805560 3:62730363-62730385 GGGGCTGTGCTGTGCATTGTAGG - Intronic
955934931 3:64093645-64093667 AGGGCTGTCCTGTGCATTGTAGG - Intergenic
955936630 3:64108869-64108891 TGGGCTGTCCTGTGCACTTCAGG + Intronic
955938867 3:64128975-64128997 GAGGCTGTCCTGTGCATTGTGGG + Intronic
955983452 3:64549679-64549701 AGGGCTGCCCTGCGCACTATAGG + Intronic
956017982 3:64904468-64904490 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
956100053 3:65758690-65758712 GGGGCTGTCCTGTGCATTGTAGG - Intronic
956195516 3:66650192-66650214 GAGGCTGTGCTGGGCATTGCAGG - Intergenic
956282402 3:67571298-67571320 AGGGCTGTCCTGTGCATTGTAGG - Intronic
956298008 3:67735852-67735874 GGGGCTGTCCTGTACATTGTAGG - Intergenic
956358590 3:68420711-68420733 GGGGTTGTCCTGGGCATTGCAGG - Intronic
956380691 3:68661635-68661657 GGGGCTGTTCTGTGCATTGTAGG + Intergenic
956431470 3:69190783-69190805 GGAGATGTCCTGTGCATTATAGG + Intronic
956435171 3:69228145-69228167 AGGGCTGTTCTGTGCATTATAGG - Intronic
956469415 3:69550651-69550673 GGGGCTGTCCTATGCATGATGGG + Intergenic
956481347 3:69676816-69676838 GGGGCTGCCCTGTGCATTGGAGG - Intergenic
956516996 3:70060692-70060714 GGGACTGTCCTGTGCATTGTAGG - Intergenic
956661095 3:71598616-71598638 GGGGCTGTGCTGTGCATTATAGG - Intergenic
956732256 3:72207361-72207383 GCGGCTGTCCTGTGCATTGGAGG + Intergenic
956786936 3:72650653-72650675 GGGGCTGTGCTGTGCATTGTAGG - Intergenic
956822391 3:72965674-72965696 GGGACTGTCCTGTTCATTATAGG + Intronic
956846150 3:73184887-73184909 GGGACTGTTCTGTGCATTGCAGG - Intergenic
956992159 3:74779485-74779507 GAGGCTGTCCTGTGCATTATGGG + Intergenic
957172316 3:76753786-76753808 GGGGCTGCTCTTAGCATTACAGG + Intronic
957504144 3:81097883-81097905 GGGGCTGTCCTGTGCATTTTAGG + Intergenic
957997263 3:87706301-87706323 GGGGCTGTCCTGGGCATTGCAGG + Intergenic
958045130 3:88275090-88275112 GGGGCTTTCCTGTGCCTTGCAGG - Intergenic
958069988 3:88597790-88597812 GGGGCTGTCCCACCCATTACAGG + Intergenic
958918989 3:100081820-100081842 AGGGCTGTCCTGTGCATTGTAGG + Intronic
958944753 3:100350574-100350596 GGGGCTGTCCTGTGCATGGTAGG + Intronic
959498810 3:107081517-107081539 GGGGCTGTCCTGTGCTTTGAAGG + Intergenic
960466184 3:117998540-117998562 GGGGCTGTCTTGTGCACTATAGG + Intergenic
961026541 3:123563318-123563340 GGGGCTGGGCTGCTCATTCCAGG + Intronic
961429645 3:126872198-126872220 GGGGCTGTCCTGGGCACTGTAGG - Intronic
961472866 3:127127599-127127621 GGGGCTGTCCAGTGCATTGTAGG + Intergenic
961733597 3:128985962-128985984 GGGGCTGTTCTGTGGATTGCTGG - Intronic
962068588 3:132009896-132009918 GTGGCTATCCTGTGCATTATAGG - Intronic
962100991 3:132342438-132342460 GGAGCTCTCCTGTGCATTATAGG - Intronic
962399694 3:135047874-135047896 GGGGCTGTCCTGTGCATTTAAGG - Intronic
963077485 3:141360740-141360762 GGGGCTGTCCTGTGTATTATAGG + Intronic
963090517 3:141479399-141479421 GGGAATGTCCTGTGCATTATAGG - Intergenic
963574473 3:147042701-147042723 GGGGCTGTCCTGAGCTCTGCAGG + Intergenic
963675804 3:148309543-148309565 GGGTCTGTCCTGTGCATTGCAGG + Intergenic
963711318 3:148750879-148750901 GGGACTGTTCTGTGCATTGCAGG - Intergenic
963850793 3:150208569-150208591 GGGGCTGTCCTGCACCTTCTAGG - Intergenic
963897472 3:150702654-150702676 GGGACTGTCCTGTGAATTACAGG - Intronic
964156799 3:153595434-153595456 GGGGCTGTCCAGTGCATTGTAGG - Intergenic
964190668 3:153997447-153997469 AGGACTGTCCTGCACATTCCTGG + Intergenic
964472275 3:157068228-157068250 GGGGCTGTCCTGTGCCCTGCTGG - Intergenic
964473540 3:157078370-157078392 GGGGCTGTCGTGAGCGTTGCTGG - Intergenic
964711099 3:159672637-159672659 GGGGCTGTCCTGTGCATTGTAGG - Intronic
964915028 3:161830100-161830122 GGTGCTGTCCTTTGCATTATAGG - Intergenic
965418640 3:168428439-168428461 GTGGCTGTCCTGTACATTACAGG + Intergenic
965622129 3:170652336-170652358 GGGGCTGTCCTGCGCTTTGTAGG + Intronic
965659095 3:171021865-171021887 GGACCTGACCTGCCCATTACTGG - Intronic
965725138 3:171707760-171707782 GGGGCTGTCCTATGCATTGTAGG - Intronic
966490720 3:180525650-180525672 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
966830198 3:184001615-184001637 GGGGCTATCCTGTGCATTGTAGG - Intronic
967510799 3:190309250-190309272 AGTGCTTTCCTGTGCATTACTGG + Intronic
967671595 3:192242304-192242326 GGAGCTGTCCTGTTCATTATGGG + Intronic
967706458 3:192656603-192656625 GAGGCTGTCCTGTGCATTGCAGG - Intronic
967906372 3:194504297-194504319 GGGGCTGTCCTGTGCACTGCAGG + Intergenic
968278992 3:197461245-197461267 AGGGCTGTTTTGTGCATTACAGG - Intergenic
968752161 4:2395902-2395924 GGGGCTCTCCTGTGCATTGTGGG + Intronic
969170121 4:5355597-5355619 GGGGCTGTCCTGTGCACTGTGGG + Intronic
969396893 4:6927662-6927684 GCGGCTGTCCTGTGCATTGGAGG + Intronic
969605027 4:8198083-8198105 GGGGCTGTCCTGTGCACTGGAGG - Intronic
969864519 4:10065553-10065575 GGGGCTGTCCTGTACATTGCAGG - Intergenic
969881348 4:10176785-10176807 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
970105751 4:12581391-12581413 GGGGCTCTCCTGTGCATTGTAGG - Intergenic
970263396 4:14253852-14253874 GGGGCTGTCCTGTGCAATGTAGG + Intergenic
970375448 4:15452454-15452476 AGGGCTGTCCTGTGCATCATAGG + Intergenic
970392915 4:15633988-15634010 GGTGCTGTCCTGTGGATTATAGG + Intronic
970394285 4:15650178-15650200 GGGGCTGTCCTGTGCGTTGTAGG - Intronic
970434893 4:16023726-16023748 GGGGCTGTTGTGAGCATTACGGG + Intronic
971346459 4:25815921-25815943 GGGGCTGTCCTGTGTGTTACGGG - Intronic
972601266 4:40575108-40575130 GGGGTTTTCCTGTGCATTATAGG - Intronic
972979969 4:44685304-44685326 GAGGCTGTCCTGTGCATTACAGG - Intronic
973700643 4:53533780-53533802 GGGGCTGTCCTGGGCATTGTAGG - Intronic
973741380 4:53922548-53922570 GGGACTGTCCTGTGCACTGCAGG - Intronic
973803696 4:54503224-54503246 GGGGCTGTCCCGTGCATTGTAGG + Intergenic
973895582 4:55409562-55409584 AGGGCTGTCCTGTGCATTGTAGG + Intronic
975437558 4:74370980-74371002 GAGGCTGTCCTATGCATTGCAGG + Intronic
975651859 4:76601323-76601345 GGGCCTTTCCTGTGCATTGCAGG - Intronic
975844216 4:78507856-78507878 GGGGCTTCCCTGTGCATTATGGG - Intronic
976013736 4:80524389-80524411 GGATCTGTGCTGCGTATTACAGG + Intronic
976251066 4:83052436-83052458 GGGGCTGTCCTGTGTATTGCAGG + Intronic
976264290 4:83175440-83175462 GGGCCTGTCCTGTGCATTGTAGG - Intergenic
976568335 4:86578246-86578268 GGAGCTGTACTGTGCACTACAGG - Intronic
976610509 4:87025705-87025727 GGGGCTGTCCTGTGTATTGCAGG - Intronic
976657623 4:87505994-87506016 GGGGCTGTCCTGTGCCTTGTAGG + Intronic
977439306 4:97042191-97042213 GAGGCTGTCCTGTGCATTGTAGG - Intergenic
977439399 4:97043267-97043289 GGGCCTGTCTTGTGCATTGCAGG - Intergenic
977531541 4:98206589-98206611 GAGGCTGTCCTGTGCATTGTAGG + Intergenic
977853432 4:101858306-101858328 GGAGCTGTTGTGTGCATTACAGG - Intronic
978232921 4:106422864-106422886 GGGGCTGTCCTGTGCATTGTGGG + Intergenic
978317606 4:107457075-107457097 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
978331726 4:107620679-107620701 GAGGCTGTCCTATGCATTATAGG - Intronic
979287531 4:118942764-118942786 GGAGCTGTCCTGTGTATTGCAGG - Intronic
979527360 4:121731357-121731379 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
980706143 4:136498482-136498504 AGGGCTGTCCTACACATTACAGG + Intergenic
981205383 4:142034340-142034362 GGGACTGTCCTATGCATTGCAGG - Intronic
981519259 4:145644821-145644843 GTGGCTGTCCTGTGCATTGAAGG + Intronic
981579237 4:146235888-146235910 GGGGCTGTCCTCTGCCTTGCCGG + Intergenic
981715514 4:147748005-147748027 GGAGCTGTCCTGTGCACTGCAGG - Intronic
982115228 4:152093459-152093481 GGAGCTGTCCTGGGCATTGCAGG + Intergenic
982228363 4:153186112-153186134 GGGTCTGTGCTGTGCATTGCAGG - Intronic
983274423 4:165600246-165600268 AGAGCTGTCCTGTGCATTGCAGG + Intergenic
984983539 4:185305214-185305236 GGGGCTGTCCTGTGTACTGCAGG - Intronic
985381548 4:189399954-189399976 GGGACTGTCTTGAGCATTATAGG - Intergenic
986567446 5:9128854-9128876 GGGGCTGCCATGTGCATAACAGG + Intronic
986616013 5:9618334-9618356 GGGGCTGTCCTGAGCATTGTAGG - Intergenic
986623549 5:9702420-9702442 GGGGCTGTCCTGTGCATTTTAGG - Intronic
986633474 5:9797290-9797312 GGGGCTATCCTGTGCATTGTAGG - Intergenic
986761266 5:10882169-10882191 GGGGCTGCCCTGTGCATTATTGG + Intergenic
986786970 5:11123471-11123493 GGGGCAGTCCTGAGCATTGTGGG - Intronic
986856078 5:11870306-11870328 TGGGCTGTCCTTTGCATTACAGG - Intronic
987004303 5:13693668-13693690 GGAGCTGTCCTGTGCATCATAGG - Intronic
987217054 5:15748202-15748224 GGGCCTGTCCTGTGCATTGCAGG - Intronic
987858651 5:23454916-23454938 GGGGTTGTTCTGTGCATTTCAGG - Intergenic
988440195 5:31225072-31225094 GGGACTGTCCTGTGCATTGCAGG - Intronic
989000906 5:36759259-36759281 GGGGTTGTCCTACACATTATAGG - Intergenic
989106596 5:37868765-37868787 GTGGCTGTCCTGTGCATTGTAGG + Intergenic
989180962 5:38576478-38576500 AGGGTTGTCCTGTGCATTATAGG + Intronic
990349787 5:54904373-54904395 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
990609678 5:57444712-57444734 GGGGCTGTCCTGGGCATTGCAGG + Intergenic
990748778 5:58989031-58989053 GAGGCTGTCCTGTGCATTGTAGG + Intronic
990813247 5:59752704-59752726 GGGGCTCTCCTGTGCATTGTAGG - Intronic
991028210 5:62053029-62053051 GGGGCTTTCCTGTGCATTGTAGG + Intergenic
991511989 5:67388214-67388236 GGGGTTGTCCTGTGCTTTTCAGG - Intergenic
991605119 5:68393479-68393501 GGGCCTGTCCTGTGCATTGTAGG - Intergenic
991611867 5:68457844-68457866 GAGGCTGTCCTGTGCATTATAGG + Intergenic
991706339 5:69362223-69362245 GGGACTGTCCTGTGAACTACAGG + Intronic
991948639 5:71926366-71926388 GGTGCTGTCCTGTGCATTGTAGG - Intergenic
992515670 5:77490284-77490306 AGAACTGTCCTGTGCATTACAGG + Intronic
992615641 5:78543628-78543650 GGGGCTGCCCTGGGCTTTGCTGG - Intronic
993034836 5:82745404-82745426 GGTGTTGTCCTGTGCATTGCAGG + Intergenic
993480134 5:88414640-88414662 GGGACTGTCCTGTGCATTGTAGG - Intergenic
993512365 5:88787394-88787416 GGGGCTGTCATGAGGATTGCAGG - Intronic
994110158 5:95993514-95993536 GGGGCTGTCTTGTGCATTGTGGG - Intergenic
994672641 5:102780909-102780931 GGGGCTGTCCTGTGCATTGGAGG + Intronic
994678690 5:102858430-102858452 GGGGCTGTCCTGTGTATTACAGG - Intronic
995280060 5:110324307-110324329 GGGGCTGTCCTGTGCGTTGTGGG + Intronic
995355389 5:111231362-111231384 GGGGCTGTCCTGTGCACTGTAGG + Intronic
995446908 5:112254764-112254786 GGGGGTATGCTGAGCATTACTGG - Intronic
995484559 5:112627238-112627260 GGGGATGTCCTGTGCATTGTAGG + Intergenic
995512664 5:112923873-112923895 GGGGCTGTCCTGTGTGTTACAGG - Intergenic
995530151 5:113084407-113084429 GGGTCTGTCCTGTGCATTGTAGG + Intronic
995733705 5:115274258-115274280 GGGCCTGTTCTGTGCATTATAGG - Intronic
995744354 5:115388236-115388258 ATGGCTGTCCTGTGCATTATAGG + Intergenic
995794635 5:115928692-115928714 GGGGGTGTCCTGTGCATTGCAGG + Intergenic
997526293 5:134555252-134555274 GGGCCTGTCCTGCCCCTCACTGG + Intronic
997833627 5:137174635-137174657 GGGACTGTCCTGCACATTCTGGG - Intronic
997926726 5:138036971-138036993 GGGGCTGTCCTGTGCCGTAAAGG - Intronic
997994401 5:138574359-138574381 GGGGCTGTTCTGTGCATTGTAGG + Intronic
998212450 5:140210323-140210345 GGGGCTGTCCTGTGTATTGTAGG + Intronic
998497274 5:142601673-142601695 GGGGCTGCCCTGTGCATTGTAGG - Intronic
998576189 5:143319690-143319712 GGGGCTGTCCTGTGCCTTGTAGG - Intronic
998585285 5:143420683-143420705 GGGGCTGTGCTATGCATTGCAGG - Intronic
998833176 5:146180879-146180901 GGGGTTGTCCTGTGCACTGCAGG + Intronic
999122373 5:149219150-149219172 TGGGCTGTCCTGTGCATTGTAGG + Intronic
999255513 5:150208003-150208025 GGGGCTGTCCTGCGCATGGAAGG - Intronic
999417402 5:151410856-151410878 GGGACTGTCCTGTGCATTGCAGG + Intergenic
999423821 5:151468565-151468587 GGGGCTGTCCTGTGCATTGTGGG + Intronic
999531078 5:152464169-152464191 GGGGTTGTCCTGTGGATTGCAGG - Intergenic
999588464 5:153117502-153117524 GGGGCTGTCTTGTGCATTGTAGG - Intergenic
999613594 5:153397876-153397898 GAGGCTGTCCTGCGCATTGAAGG + Intergenic
999621357 5:153477910-153477932 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
999626405 5:153525332-153525354 GGGTTTGTTCTGTGCATTACAGG - Intronic
999630969 5:153571100-153571122 GGGGCTGTCCTGCACAATGGAGG + Intronic
1000113549 5:158132539-158132561 GGGGTGGTCCTGTGCATTGCAGG + Intergenic
1000162893 5:158617443-158617465 GGGCCTGTTCTGTGCAGTACAGG + Intergenic
1000218478 5:159187770-159187792 GAAGCTGTCCTGTGCATTATAGG - Intronic
1000324014 5:160158338-160158360 GGTGCTGTCCTGTGCATCTCAGG - Intergenic
1000329800 5:160197617-160197639 GGGGCTGTCCTGTGCATCTCTGG + Intronic
1000614772 5:163414596-163414618 GAGGCTGTCTTGTGCATTGCAGG + Intergenic
1000761875 5:165236116-165236138 AGGGCTGTCCTGCACACTATAGG + Intergenic
1000883913 5:166728812-166728834 GGGTCTGTCCTGTGCATTTTAGG - Intergenic
1000957582 5:167560965-167560987 GGGGCTGTCCTGTGCATCACGGG - Intronic
1001005852 5:168049202-168049224 GGGGCTGTCCTGTGTATTATAGG - Intronic
1001017961 5:168158566-168158588 GGGCCTGTCCTGTGCATTGTAGG + Intronic
1001041306 5:168337483-168337505 GGGGCTGTCCTGTGCACTGCAGG - Intronic
1001174142 5:169449556-169449578 GAGGCTGTTCTGTTCATTACAGG + Intergenic
1001193051 5:169648205-169648227 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1001320135 5:170674060-170674082 GGGGCTGTTCTGGGCATTGTAGG + Intronic
1001479308 5:172076506-172076528 GGGGGCGTCCTGTGCATTATAGG + Intronic
1001529347 5:172451487-172451509 AGGGCTGTCCTGTGGATTGCAGG - Intronic
1001611256 5:173003961-173003983 GAGGCTGTCCTGTGCAGTACAGG - Intronic
1001804106 5:174568694-174568716 GGGGCTGCCCTGTGCCTTGCAGG - Intergenic
1001831231 5:174791021-174791043 GGGGCTGTCCTGTGCATTGCGGG - Intergenic
1001850142 5:174956600-174956622 GGGGCTGTCCTGTGCATTGCAGG - Intergenic
1001889024 5:175323546-175323568 GGTGCTGTTCTGTGCATTACAGG - Intergenic
1002618937 5:180472822-180472844 GGGGATGTCCTGGGCATTGCAGG - Intergenic
1002761370 6:205069-205091 GGGGCTGTCCTGTACAATGCAGG - Intergenic
1002877911 6:1227359-1227381 GAGGCTGTCCTGTGCATTGCAGG + Intergenic
1003066817 6:2910867-2910889 GGTGCTGTCCTGTGCAGTGCAGG + Intergenic
1003182609 6:3804949-3804971 GGTGCTGTCCTGGGCATAACAGG - Intergenic
1003286690 6:4740440-4740462 GGGGCTGTCCTGAGAATCTCAGG - Intronic
1003423787 6:5982952-5982974 AGGGCTGTCCTGTGCATTGTAGG + Intergenic
1003430991 6:6037206-6037228 GGAGCTGTCCTGTGCATTGTAGG - Intergenic
1003535760 6:6973981-6974003 GGGGCTGCCCTGTGCACTGCAGG - Intergenic
1003657112 6:8022278-8022300 GGTGCTGTCCTGTGCATTGCAGG - Intronic
1003779282 6:9405013-9405035 GGGGCTGTTCTGTGCGTTGCAGG - Intergenic
1003928631 6:10901572-10901594 GGTGCTGTCCTGCGCATCAGAGG + Intronic
1003968932 6:11280055-11280077 GGGGCTGCCTTGTGCATTATAGG + Intronic
1003974525 6:11329822-11329844 GGGGATGTCCTGTGCATTATAGG - Intronic
1004299316 6:14442894-14442916 GGGGCTTTCCTGCGAATTCCAGG + Intergenic
1004325111 6:14667521-14667543 GGGGCTGTTCTGTGCTTTGCAGG - Intergenic
1004355183 6:14924310-14924332 GGGGCTGTCCTGTGCGTTGTAGG - Intergenic
1004528012 6:16427251-16427273 GGGGCTGTCCTGTGTGTTGCAGG + Intronic
1004854518 6:19735635-19735657 GGGACTGTCCTGTACATTGCAGG + Intergenic
1005025782 6:21461651-21461673 GAGGCTGTCCTGAGCATTATAGG + Intergenic
1005112357 6:22296623-22296645 GGGGCTGTCCCGTGCATTGAAGG + Intronic
1005163218 6:22889825-22889847 GGGCCTGTCCTGTGCATTGTAGG + Intergenic
1005256301 6:24007076-24007098 GGGGCTGTCTTGTGCATTGTGGG - Intergenic
1005387448 6:25299580-25299602 GGGGCTGTCCTGTGCATGATAGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005517245 6:26566404-26566426 GGGGCTGTTCTATGCATTACAGG + Intergenic
1005815388 6:29547718-29547740 GGTGCTGTCCTGTGCATTGTAGG - Intergenic
1006264006 6:32901396-32901418 GGGGCTGTCCTGGGCATTGTAGG + Intergenic
1006362674 6:33595523-33595545 GGGGCTGTCCCGTGCATTGTAGG - Intergenic
1006594679 6:35184409-35184431 GGGGCTGTCCTGTGCTTCAGAGG + Intergenic
1006705033 6:36012527-36012549 TGGGCTGTCCTGTGCATTGCAGG + Intronic
1006817793 6:36864700-36864722 GGTGCTGTCCTGTGCATTGAAGG - Intronic
1007062007 6:38949100-38949122 GGTGCTGTCCTGGGCATTGTAGG - Intronic
1007138042 6:39541911-39541933 GGAGCTGTCCTGTGCATTGTAGG - Intronic
1007368398 6:41410038-41410060 GGGGCCGTCCTGTGCGTTATAGG + Intergenic
1007404944 6:41629757-41629779 AGGGCTGTCCTGCTCATTGTAGG - Intergenic
1007832703 6:44650976-44650998 GGGGCTGCCCTGTGCATTGTAGG - Intergenic
1007834195 6:44662293-44662315 GGGGCTGTCCTGAGCATGATAGG - Intergenic
1007984013 6:46189379-46189401 GGGGCTGTCCTGTGCACTGCAGG + Intergenic
1008034115 6:46728364-46728386 AGGGCTGTCCTGTGCACTACAGG - Intronic
1008034261 6:46729710-46729732 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1008129694 6:47706611-47706633 GGGGCTGTCCTGTGAATTGTAGG - Intronic
1008487844 6:52054685-52054707 GGGGCTGTTCTGTGCATTATAGG + Intronic
1008521636 6:52367207-52367229 GGGGCTGTCCTGTGCATTTTAGG - Intronic
1008567671 6:52785100-52785122 GGGGCTGTCCTGTTCATGATAGG - Intergenic
1008571806 6:52823936-52823958 GGGGCTGTCCTGTTCATGATAGG - Intergenic
1009213478 6:60891341-60891363 GGGGCTGTTCTGCACAATGCAGG + Intergenic
1010179839 6:73073397-73073419 GAGGCTGTCCTGGGCATTGTAGG + Intronic
1010688161 6:78876604-78876626 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1010806999 6:80249097-80249119 GGGGCTGTTCTGTGCATTGTAGG + Intronic
1011058058 6:83228365-83228387 GGGGCTGTCCAGTGCACTACAGG + Intronic
1011203283 6:84862180-84862202 GAGGCTGTCCTGTGCATTGTAGG + Intergenic
1011497320 6:87949497-87949519 GGAGGTGTCCTGTGCACTACAGG - Intergenic
1012967935 6:105695714-105695736 GGGACTGTCCAGGGCATTATAGG + Intergenic
1013158551 6:107519302-107519324 TGGGCTGTCCTGTGCATTGTAGG - Intronic
1013158731 6:107520988-107521010 TGGGCTGTCCTGTGCATTGTAGG + Intronic
1013324182 6:109027708-109027730 GGAGCTGTCCTGTGCATTGCAGG - Intronic
1013603051 6:111722764-111722786 GAGGCTGTCCTGTGCATTGCAGG - Intronic
1013924527 6:115453316-115453338 GTGGCTGTCCTGTGCATTGTAGG - Intergenic
1014203988 6:118635861-118635883 TGGGCTTTCCTCCCCATTACTGG - Intronic
1014678801 6:124402137-124402159 GGGGCTGTCCTGTTCATTGTAGG - Intronic
1014682311 6:124446955-124446977 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1015346095 6:132161517-132161539 GAGGCTGTCCTGTCCACTACAGG - Intergenic
1015994513 6:138984478-138984500 GAGGCTGTCCTGTGCACTGCAGG + Intronic
1016013836 6:139164461-139164483 TGGGCTGTCCAGTGCATTACAGG + Intronic
1016775529 6:147900486-147900508 GGGGCAATCCTGTTCATTACGGG - Intergenic
1016868303 6:148791208-148791230 GGAACTGTCCTGTGCATTGCAGG - Intronic
1017183516 6:151577185-151577207 GGGCCAGTCCTGTGCATTGCAGG + Intronic
1017225288 6:152014254-152014276 GGGGCTGTCTTGTGCATTTTAGG + Intronic
1017310928 6:152976868-152976890 GGGACTGTCCTGTGCATTGTAGG + Intronic
1017391475 6:153944421-153944443 GAGGCTGTCCTGTGCATTTTAGG - Intergenic
1017729139 6:157299623-157299645 GGGGCTGTACTGGACAATACCGG + Intronic
1017761328 6:157572185-157572207 GGGGCTGTCCTGCACATTGTAGG + Intronic
1018165469 6:161090421-161090443 AGGGCCGTCCTGCGCATTGTAGG + Intronic
1018165487 6:161090516-161090538 AGGGCTGTCCTGCGCATTGTAGG + Intronic
1018165505 6:161090611-161090633 AGGGCCGTCCTGCGCATTGTAGG + Intronic
1018165544 6:161090801-161090823 AGGGCCGTCCTGCGCATTGTAGG + Intronic
1018178352 6:161198426-161198448 GGGGCTGTTCTGTGCATTGTAGG - Intronic
1018376603 6:163218949-163218971 GGGGCTGTCCTGTGCGTTGGAGG - Intronic
1019445405 7:1068370-1068392 GGGGCTGTCCTGCTCCCTGCCGG - Intronic
1020208035 7:6134590-6134612 GGGGCTGTCCGGTGCATTCGAGG + Intronic
1020261541 7:6533177-6533199 GGGGCTGTCCTGCACATTAGAGG - Intronic
1020352795 7:7240265-7240287 GAGGCTGTCCTGTGCATTTTAGG - Intronic
1021206647 7:17788439-17788461 GGAACTATCCTGCGCATTATAGG - Intergenic
1021369940 7:19832097-19832119 CAGGCTGTCCTGTGCATTATGGG - Intergenic
1021416173 7:20387686-20387708 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1021470047 7:20991656-20991678 GGGGTTGTCCTGTGAATTGCAGG + Intergenic
1021476833 7:21071433-21071455 GGGGCTGTCCTGAGCGTTACAGG - Intergenic
1021799276 7:24287733-24287755 GGGGCTGTCCTGGGCATGGTAGG - Intronic
1021936262 7:25635150-25635172 GGGTCTGTCCTGTGCATAGCAGG - Intergenic
1022029408 7:26478895-26478917 GGGGCTGTCATGAAGATTACAGG - Intergenic
1022132335 7:27416048-27416070 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1022225728 7:28361013-28361035 AGGGCTGTTCTGTGCATTACAGG - Intronic
1022262655 7:28721252-28721274 GGGGCTGTCTTGTGCATTGTAGG - Intronic
1022288375 7:28976992-28977014 GGGGCGGGCCTGTGCATTGCAGG + Intergenic
1022410045 7:30132422-30132444 GAGGCTGTCCTGCACATTGCAGG - Intergenic
1022541167 7:31136510-31136532 GGGACTGTCCTGGGCATCGCCGG - Intergenic
1022626594 7:32043140-32043162 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1022633562 7:32109496-32109518 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1022771276 7:33475510-33475532 GGGGCTATCCTGTGCATTGTAGG + Intronic
1022788552 7:33663649-33663671 GGGGCTGTGCTGTGCATTGTGGG - Intergenic
1022922853 7:35033942-35033964 GGGGCTTTCCTGTGCACTGCAGG - Intronic
1022977084 7:35568712-35568734 GGGGCTGCCCTGTGCATTTTAGG - Intergenic
1023036858 7:36138761-36138783 GGGGTTGGCCTGTGCATTACGGG - Intergenic
1023255501 7:38308541-38308563 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1023486749 7:40695749-40695771 GGGGCTGTCTTGTGCACTATAGG + Intronic
1023503151 7:40872097-40872119 GGGGCTGTGCTGTGCATTGCTGG - Intergenic
1023583736 7:41707431-41707453 GGGGCTGTCCTGTGCATGGTAGG - Intergenic
1023615557 7:42016099-42016121 GGGGTTGTCCTGGGCATTGTAGG - Intronic
1023728636 7:43169322-43169344 GGGGCTGACCTGCGCATGGCAGG + Intronic
1024010359 7:45261202-45261224 GGAGCTGACTTGCGCATTTCAGG + Intergenic
1024274043 7:47663331-47663353 GGGGCTTTCCTTCCCATTTCAGG + Intergenic
1024346656 7:48321224-48321246 GGGGCTTTCCTGTGCATTGTAGG - Intronic
1024381937 7:48706488-48706510 GGGATTGTCCTGTGCATTAGAGG - Intergenic
1024638414 7:51309735-51309757 GGGGTTGTTCTGTGCATCACAGG + Intronic
1025248231 7:57334088-57334110 GGGGCTGTCCTTGGCATTGTGGG - Intergenic
1026811308 7:73468352-73468374 GGAGCTGTCCTGTGCATTATAGG - Intronic
1026814717 7:73501571-73501593 GGTGCTGTCCTGTGCATTGTAGG - Intronic
1026962007 7:74414896-74414918 GGGGTTGACCTGCCCGTTACTGG + Intergenic
1027418925 7:78001179-78001201 GAGGCTGTCCTGTGCATTGCAGG - Intergenic
1027729358 7:81850552-81850574 GGGGTTGTCCTGTGCATTGCAGG + Intergenic
1028512840 7:91644167-91644189 GGGACTGTCCTGTGCATTATAGG + Intergenic
1028610300 7:92702893-92702915 GGGGCTGTCCTGTGTATTGTAGG + Intronic
1028960869 7:96748886-96748908 GGGTCTGTCCTGTGCATTGAGGG + Intergenic
1029024766 7:97404539-97404561 GGGGCTGTACTGTGCATTGTAGG + Intergenic
1029935981 7:104424663-104424685 GGAGCTGTCCTGTGCATTGCAGG - Intronic
1029946665 7:104540445-104540467 GGGACTGTCCTGTGCATTATAGG - Intronic
1030045437 7:105490936-105490958 GGGACTGTCCTGTGCGTTGCAGG - Intronic
1030107517 7:105999466-105999488 GGGGTTGTCCTGTGCATTGGAGG + Intronic
1030490035 7:110220788-110220810 GGGGCTTTCCTGTGCATTGCAGG - Intergenic
1030638801 7:111980617-111980639 GGGGCTGTCCTGGGCTTTGTAGG + Intronic
1031079757 7:117246940-117246962 GGGGCTGTCCTGTACATTATAGG + Intergenic
1031869654 7:127077980-127078002 GGACCTGTCCTGTGCATTGCAGG - Intronic
1032067148 7:128780094-128780116 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1032151330 7:129432713-129432735 GGGGCTGTCCTGTGCATCGTAGG - Intergenic
1032184797 7:129715290-129715312 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1032268426 7:130383979-130384001 GGGGCTGTCCTGTGCATCCACGG + Intronic
1032354973 7:131202581-131202603 GGGACTGTCCTGGGCATTATAGG + Intronic
1032872173 7:135997986-135998008 GGAGCTGTCCTGTGCATTACAGG + Intergenic
1032934467 7:136712967-136712989 TGGGGTGTCCTGTGCATTGCAGG + Intergenic
1033029994 7:137816905-137816927 GGGGCCATCCTGTGCATTGCAGG + Intronic
1033217612 7:139504879-139504901 GGGGCTGTCCTGTGCATAGTAGG - Intergenic
1033273486 7:139953706-139953728 AGGCCTGTCCTGCCCATTCCTGG - Intronic
1034957403 7:155343665-155343687 GGGGCTGTCCTGTGCAGGGCTGG + Intergenic
1035269030 7:157709132-157709154 GGGGCTGTGCTGCCCATGGCTGG + Intronic
1035345078 7:158192336-158192358 GGGTCTGTCCTGCGCCGTATGGG + Exonic
1035716243 8:1757218-1757240 GGGGCTGCCCTGGGCATTGTCGG + Intronic
1036258873 8:7225295-7225317 GGGGCTGTCCTGTGTATTGAAGG - Intergenic
1036307747 8:7614215-7614237 GGGGCTGTCCTGTGTATTGAAGG + Intergenic
1036310928 8:7683891-7683913 GGGGCTGTCCTGTGTATTGAAGG - Intergenic
1036358601 8:8062216-8062238 GGGGCTGTCCTGTGTATTGAAGG + Intergenic
1036652993 8:10657437-10657459 AGGGCTGTCCTGTGTATTGCAGG - Intronic
1036958486 8:13216727-13216749 GGGTCTGTCCTGTGCATTATAGG + Intronic
1037360461 8:18068672-18068694 GGGGCTGTCATGTGCATTGCAGG - Intronic
1037360475 8:18068745-18068767 GGGGCTGTCATGTGCATTGCAGG - Intronic
1037766963 8:21778045-21778067 GGGGCTGTGCTCCGCCTTCCTGG - Intronic
1038444105 8:27591478-27591500 GGGGCTGCCCTACGGATTTCGGG + Intergenic
1038445660 8:27602274-27602296 GGGGCTGTCCTGAGCAGTTCAGG - Intronic
1038500272 8:28037888-28037910 GGGGCTGTCCTGTGAATTGCAGG - Intronic
1038578524 8:28726604-28726626 GGGGCTGTCTTGTGCACTATAGG + Intronic
1039602021 8:38847312-38847334 GAGGCTGTCCTGTGCATTGTAGG - Intronic
1039942387 8:42102286-42102308 GGGGCTGTCCTGTGCATTATAGG + Intergenic
1040057599 8:43073802-43073824 GGGACTGTCCTGTGCATTTTGGG - Intronic
1040929758 8:52721366-52721388 GGGGCTGTCCTGTACATTTTAGG + Intronic
1041097200 8:54361729-54361751 GTGGCTGTCCTGCTCACTGCAGG - Intergenic
1041354024 8:56981051-56981073 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1041354950 8:56990646-56990668 GGGGCTGTCCTGTGCATTATAGG + Intronic
1041941237 8:63390429-63390451 GGGGCTGTCCTGTGCACTGCAGG - Intergenic
1042826446 8:72984871-72984893 GGTGCTGACCTGTGCATTGCAGG - Intergenic
1044895580 8:96888078-96888100 GGGGCTGTCCCGTGCATTGTGGG + Intronic
1044963514 8:97554138-97554160 CAGGCTGTCCTGTGCATTAGAGG + Intergenic
1045052318 8:98338462-98338484 GGGGCTGTCCTGGTCATTGTAGG + Intergenic
1045068728 8:98477859-98477881 GGGGCTGTCCTGTGCTTTGTAGG + Intronic
1045237542 8:100367198-100367220 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1045325683 8:101116158-101116180 GGGGCTGTCCTGGGCACTGTAGG - Intergenic
1045350313 8:101332330-101332352 AGGACTGTCCTGCACATTGCAGG + Intergenic
1045458682 8:102407910-102407932 GGGGCTATCCTATGCATTATAGG + Intronic
1045552785 8:103187390-103187412 GGAACTGTCCTGAGTATTACAGG - Intronic
1045759523 8:105587790-105587812 GGGGCTGTCCTTTGCATTGTAGG + Intronic
1045826840 8:106408089-106408111 TGGGCCGTCCTGTGCATTGCAGG - Intronic
1046052032 8:109035117-109035139 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1046105904 8:109666302-109666324 GGGGCTGTCCTTTGCATTGTAGG + Intronic
1046126870 8:109920904-109920926 AGGGCTGTCCTGCGCATTGTGGG + Intergenic
1046182327 8:110667319-110667341 GGGGGTGTCCTGTTCATTATAGG + Intergenic
1046747323 8:117890413-117890435 GGGGCTCTTCTGCGCATTGTAGG - Intronic
1047179656 8:122574993-122575015 GGGGTTGTCCTGAGTATTACAGG + Intergenic
1047206038 8:122803493-122803515 AGGGCTGTCCTGTGCATCATAGG + Intronic
1047277792 8:123418851-123418873 GAGGCTGTCCTGTGTATTGCAGG + Intronic
1047311115 8:123692936-123692958 TGGGCTGTCCTGTGCACTGCAGG + Intronic
1047426779 8:124753721-124753743 AGGGCTGTCCTGTGCATTGCAGG + Intergenic
1047508656 8:125499494-125499516 GGGGCTGTCCTGTTCCTTGCAGG + Intergenic
1047636225 8:126765561-126765583 GGGGCTGTCCCGTGCATTGCAGG - Intergenic
1048152707 8:131909717-131909739 GGGGCTGTCCTATGCACTATAGG + Intronic
1048449408 8:134520245-134520267 AGGGCTGTCCTGTGCCCTACAGG - Intronic
1048774520 8:137931405-137931427 GAGGCTGCCCTGTGCATTGCAGG + Intergenic
1048790555 8:138099597-138099619 GGGTCTGTCCTGCACATTACAGG - Intergenic
1050690769 9:8224069-8224091 AGGGCTGTCCTGTGCATTGCAGG + Intergenic
1050727920 9:8673856-8673878 GGGGCTGTCCTGTGCCTTGCAGG + Intronic
1050843164 9:10178734-10178756 GGGGCTTTCCTGTGCATTATAGG + Intronic
1051098662 9:13495842-13495864 GGGGCTGTCCTGTGCATTCTAGG - Intergenic
1051333376 9:16045397-16045419 GGGGCTGTCTTGTGAATTACAGG + Intronic
1051617090 9:19016633-19016655 GGGCCTGTCCTGTGCATTGTAGG - Intronic
1051854626 9:21549870-21549892 GGGGCTGTCCTGTGCATTGTGGG - Intergenic
1052380621 9:27767096-27767118 GGAGCTGCCCTGTGCATTAGAGG + Intergenic
1052898617 9:33771033-33771055 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1053128525 9:35601878-35601900 GGGGCTGTCCTGTGTATTGTAGG - Intergenic
1053153863 9:35760352-35760374 GGGGCTGTCCTGTGCATCGTAGG + Intergenic
1053179867 9:35959854-35959876 AGGGCTGTCCTGTGCATTGTAGG + Intergenic
1053224815 9:36345439-36345461 GGGGCTGGCCTGGGGACTACAGG + Intronic
1053545613 9:39020198-39020220 GGGCCTGTCCTGTGCATTATAGG + Intergenic
1053553838 9:39113076-39113098 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1053809939 9:41841897-41841919 GGGCCTGTCCTGTGCATTATAGG + Intergenic
1053817947 9:41933231-41933253 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1054108200 9:61076893-61076915 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1054612657 9:67254232-67254254 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1054620654 9:67345531-67345553 GGGCCTGTCCTGTGCATTATAGG - Intergenic
1054745521 9:68850400-68850422 GGGGCTGTTCTGTGCATTGTAGG + Intronic
1054764703 9:69033843-69033865 GGGGCTGTCCTGCACATCACAGG + Intergenic
1054812709 9:69447452-69447474 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1054849845 9:69836344-69836366 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1055073146 9:72188273-72188295 GAGGCTGCCCTGCTCATCACAGG + Intronic
1055106932 9:72522898-72522920 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1055110758 9:72556994-72557016 GGGGCTGTCCTGTGCACTGCAGG - Intronic
1055317858 9:75052224-75052246 GAGGCTGTCCTGTGCATCAAAGG - Intergenic
1055425881 9:76196228-76196250 GTGGGTGTGCTGCGCACTACAGG - Intronic
1055454844 9:76462457-76462479 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1055779202 9:79800977-79800999 GGGGCAGTCCTGTGCATTTTAGG + Intergenic
1055931126 9:81560675-81560697 GGGACTGTCCTGTGCAATACAGG - Intergenic
1055936686 9:81610663-81610685 GGGGCCGTCCTGGGCGTTGCAGG + Intronic
1055939990 9:81640105-81640127 AGGGCTGTCCTGTGCATTGTAGG - Intronic
1056078589 9:83065914-83065936 GGCTCTGGCCTGTGCATTACAGG - Intergenic
1057401788 9:94729659-94729681 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1057443285 9:95097058-95097080 GGGGGTGTCCTGTGCACTGCAGG - Intergenic
1057521485 9:95764012-95764034 GGGGCTGTCCTTTGCATTGTAGG - Intergenic
1057949156 9:99356158-99356180 GGGGCTGTTCTGTGCATCAGAGG + Intergenic
1058112988 9:101052411-101052433 AGGGCTGTCCTGTGCATTGCAGG - Intronic
1058609013 9:106755000-106755022 GTGGCTGTCCTGAGCACTGCAGG + Intergenic
1058622527 9:106898547-106898569 GAGGCTGTCCTGGGCATTGTAGG - Intronic
1058717920 9:107738950-107738972 AGGGCTGTGCTGTGCATTGCAGG - Intergenic
1059000168 9:110340477-110340499 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1059562669 9:115350467-115350489 GGGGCTGTCTTGTGCATTGTAGG - Intronic
1059582946 9:115572141-115572163 GGAGCTGTCCTGTGCATTATAGG + Intergenic
1059846216 9:118279876-118279898 GGGGCTGTCCTGTGCATCGTAGG + Intergenic
1060233361 9:121841754-121841776 GGGTCTGTCTTGTGCATTTCAGG + Intronic
1060624788 9:125102052-125102074 GGTGCTGTCCTGTGCACTGCAGG + Intronic
1060651786 9:125333887-125333909 GGGCCTGTCCTGTGCATTTTAGG + Intronic
1060654034 9:125356342-125356364 GAGGCTGTCCTGTGCATTATAGG + Intronic
1061012780 9:127965246-127965268 GGGGCTGTCCTGCGCACTGTGGG + Intronic
1061328222 9:129876847-129876869 GGGGCCGTCCTGTGCATTGTAGG + Intronic
1061598397 9:131647885-131647907 GGGGCTGTCCTGTGTATTGTAGG + Intronic
1061676810 9:132221963-132221985 GGGGCTGTGCTCCGCACTGCTGG - Intronic
1185587453 X:1250282-1250304 GGGGCTGTCCTGGGCACTGGTGG + Intergenic
1185695895 X:2194298-2194320 GGGGCCATCCTGTGCACTACAGG - Intergenic
1185834997 X:3337356-3337378 GGGGCCATCGTGTGCATTACAGG - Intronic
1185871684 X:3670027-3670049 GGGGCCGTCCTGCACACTTCAGG - Intronic
1185992700 X:4910024-4910046 GGGGCTGTCTTGTGTATTGCAGG - Intergenic
1186049635 X:5577049-5577071 GGGGCTGTCGTGTGCATTGTAGG - Intergenic
1186157288 X:6738705-6738727 GGGGCTGTGCTGTGCATTGTCGG - Intergenic
1186210718 X:7247792-7247814 GGGCCTGTCCTGTGCATTGCAGG - Intronic
1186227651 X:7418724-7418746 GGGGGTGTCCTAGGCATTATAGG - Intergenic
1186239605 X:7552413-7552435 GGGGCTGTCCTGGGCATTGTAGG - Intergenic
1186249495 X:7650871-7650893 GGGGCTGACCTGGGCATTGGAGG + Intergenic
1186250848 X:7664578-7664600 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1186256970 X:7732528-7732550 GGGGCTGTCCTATGCATTGCAGG + Intergenic
1186282188 X:8004671-8004693 AGGGCTGTCCTCTGCATCACAGG + Intergenic
1186397526 X:9224863-9224885 GGGGCTGTCCTGTGCATTGCGGG + Intergenic
1186412982 X:9360197-9360219 GGGGCTGTCTTGGGCATTGCAGG + Intergenic
1186414269 X:9369867-9369889 GGGGCTGTCCTAGGCATTGTGGG - Intergenic
1186431633 X:9510181-9510203 GGGGCTGTCCTGGGCAGTGTAGG - Intronic
1186436910 X:9550943-9550965 GGGGCTGTCCTGCACACTGTAGG - Intronic
1186459798 X:9739381-9739403 GGGGCTGTCCTGTGCATGGCGGG - Intronic
1186502590 X:10064195-10064217 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1186514947 X:10160021-10160043 GAGGCTGTCCTGTGCATTGTAGG + Intronic
1186560502 X:10607417-10607439 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1186578834 X:10795056-10795078 TGGGCTGTCCTGTGCATTGTAGG + Intronic
1186614416 X:11171770-11171792 GGGGCTGTCCTGTGCATTACAGG + Intronic
1186614874 X:11175765-11175787 GGGGCCGTCCTGTGCATTGTAGG - Intronic
1186633859 X:11380770-11380792 GGGGCTGCACTGTGCATTACAGG + Intronic
1186639031 X:11435145-11435167 GAGGCTGTCCTGTGCATTGTAGG - Intronic
1186651799 X:11569251-11569273 GGGGCTGTCCTGTGCATTGTGGG - Intronic
1186681308 X:11876974-11876996 GGGGCTGGCCTGTGCATTGTAGG - Intergenic
1186682962 X:11895186-11895208 GGGGCTGTTGTGTGCATTGCAGG + Intergenic
1186692563 X:11994181-11994203 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1186714555 X:12236980-12237002 GGGACTGTCCTGTGCATTGTAGG - Intronic
1186730677 X:12406156-12406178 GGAGCTGTCCTGTGCGTTATAGG - Intronic
1186771291 X:12820388-12820410 GGGGCTGTCCTACGCATTATGGG - Intronic
1186796157 X:13048284-13048306 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1186852807 X:13597101-13597123 GGGACTGTCCTGTGCACTGCAGG - Intronic
1186867370 X:13734218-13734240 GAGGCTGTCCTGTGCATTGTAGG - Intronic
1186873208 X:13792530-13792552 GGGGCTGTCCTGTGTATTCTAGG - Intronic
1186886819 X:13922223-13922245 GAGGCTGTCCTGTGCACTATAGG + Intronic
1186898832 X:14031983-14032005 GGGGTTGTCCTGTGCATTGTAGG + Intergenic
1186899513 X:14038539-14038561 GGGGCTGTCCTGTGCACTATGGG + Intergenic
1186958784 X:14712231-14712253 GGGGCTGTCTTGTGCATTGCAGG + Intronic
1186968712 X:14816583-14816605 GGCACTGTCCTGTGCATTGCAGG + Intergenic
1186979321 X:14941988-14942010 GGGGCTGTCCTGTGCCTTGTAGG - Intergenic
1187029717 X:15473308-15473330 GGGGCTGTTCCACGCATTGCAGG - Intronic
1187051473 X:15700754-15700776 GAGACTGTCCTGTGCATTGCAGG + Intronic
1187339992 X:18412412-18412434 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1187344090 X:18447182-18447204 GGGGCTGTCCTGTACATTGTAGG - Intronic
1187361498 X:18632024-18632046 GGGGCTGTCCTGTGCATGGCAGG - Intronic
1187452955 X:19414750-19414772 GGGGCTGTCCTGTGCATTGTGGG + Intronic
1187661535 X:21551715-21551737 GGTGCTGTCCTGAGCACTGCAGG - Intronic
1187861683 X:23689370-23689392 GGGACTGTCCTGTGCATTGTAGG - Intergenic
1187885597 X:23886028-23886050 GGGGCTGTCCTGTGCACTGCAGG + Intronic
1187933835 X:24317054-24317076 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1187942659 X:24397121-24397143 GGCTCTGTGCTGGGCATTACTGG + Intergenic
1188024338 X:25193192-25193214 TGGGCTGTCATGTGCATTATAGG + Intergenic
1188385043 X:29546084-29546106 GTGGCTGTCCTGCACATTGGAGG - Intronic
1188504799 X:30870807-30870829 GGGGCTGTCCTGTGCAGTGTAGG - Intronic
1188586438 X:31781745-31781767 GTGGCTGTCCTGTGCATTGTAGG + Intronic
1189256429 X:39643203-39643225 GGGGCTGTCCTGTGCCTTACAGG - Intergenic
1189505639 X:41611128-41611150 GGGGCTGTCCTGGGTATTGTAGG - Intronic
1189839245 X:45054974-45054996 AGGACTGTCCTGCGCATTGTAGG - Intronic
1189841170 X:45080023-45080045 GGGACTGTCCTGCACCTTGCAGG + Intronic
1190395282 X:49976025-49976047 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1190736982 X:53262233-53262255 GGGGCTGGCCTGCCCATGGCAGG + Intronic
1190865883 X:54384175-54384197 GGGGCTTCCCTGTGCATTATAGG + Intergenic
1192218815 X:69182904-69182926 AGGGCTGTCCTGTGCATTGCTGG + Intergenic
1192258777 X:69490292-69490314 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1192264240 X:69528084-69528106 GGGGCTGTCCTGTACACTGCAGG - Intronic
1193077490 X:77370693-77370715 GGGGCTCTCCTGTGCATTGTAGG + Intergenic
1193134866 X:77959480-77959502 GGGGCTTTCTTGTCCATTACAGG + Intronic
1193511833 X:82411495-82411517 GGGGCTGCCCTGCCAATCACAGG - Intergenic
1195106503 X:101607523-101607545 GGGACTGTCCTGTGCATTGTAGG - Intergenic
1195137646 X:101925840-101925862 GAGCCTGTCCTACGCATTATAGG + Intronic
1195222652 X:102761437-102761459 GGGGCTGTCCTAGGCATTGGGGG - Intergenic
1195380374 X:104264926-104264948 GGGGATGTCCTGTGCATTGTGGG - Intergenic
1195765959 X:108297425-108297447 GGGGCTGTCCTGTGCATTATAGG + Intronic
1195895984 X:109746735-109746757 GGATCTGTCCTGTGCATTATAGG + Intergenic
1195999069 X:110761670-110761692 GGGGCTGTCCTGCGCATTGTGGG - Intronic
1196055668 X:111352180-111352202 GGAGCTGTCCTGTGCATTGTAGG - Intronic
1197330769 X:125151812-125151834 GGGTCTGTCCTGTGCATTGTAGG - Intergenic
1197711633 X:129675595-129675617 GGGGCTGTCTTGTGTATTGCAGG - Intergenic
1200183680 X:154167801-154167823 GGGGCTGTCCTGTACATTCTAGG - Intergenic
1200189334 X:154204929-154204951 GGGGCTGTCCTGTACATTCTAGG - Intergenic
1200195089 X:154242738-154242760 GGGGCTGTCCTGTACATTCTAGG - Intergenic
1200200739 X:154279859-154279881 GGGGCTGTCCTGTACATTCTAGG - Intronic
1200360437 X:155599930-155599952 GGGACTGTCCTGAACATTTCAGG - Intronic
1200816260 Y:7536177-7536199 GGGGCTGCCCTGTGCATTGTAGG + Intergenic
1200839691 Y:7768383-7768405 GGGACTGTCCTGTGCATTGTAGG - Intergenic
1201241737 Y:11963875-11963897 GGGGCCATCGTGTGCATTACAGG + Intergenic
1201466776 Y:14290310-14290332 GAGGCTGTTCTGTGCATTGCAGG - Intergenic
1201550911 Y:15215500-15215522 GGGGCTGTGCTGTGCATTGTTGG - Intergenic