ID: 1133142495

View in Genome Browser
Species Human (GRCh38)
Location 16:3757622-3757644
Sequence GGGTGTACAGGCGCTTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133142495_1133142499 7 Left 1133142495 16:3757622-3757644 CCTCAGTAAGCGCCTGTACACCC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1133142499 16:3757652-3757674 ATCACCCATCACATCGCTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133142495 Original CRISPR GGGTGTACAGGCGCTTACTG AGG (reversed) Intronic
900300132 1:1973031-1973053 GGGTGTTCAGGGACTTCCTGTGG + Exonic
905028121 1:34865239-34865261 GAGGGTCCAGGCCCTTACTGTGG + Intergenic
921149074 1:212385627-212385649 GGTTGGCCAGGGGCTTACTGAGG - Intronic
921202491 1:212820965-212820987 GAGTGTACAGGCAATAACTGAGG + Intergenic
1064501302 10:15976556-15976578 GGGTGTACAGAACCATACTGGGG - Intergenic
1069917720 10:71797680-71797702 GGGGGTGCAGGCACTTACGGTGG + Intronic
1071950361 10:90696956-90696978 GGGTGTGGAGGCGCCTGCTGTGG + Intergenic
1073318672 10:102600423-102600445 GGGTGCACAGGCTCTTCCTTTGG + Intronic
1081464046 11:43300074-43300096 GGGACTACAGGTGCTTACTGGGG + Intergenic
1087542642 11:99540794-99540816 AGATGTACAGGTGCTCACTGAGG + Intronic
1089172898 11:116527704-116527726 GGGTGTAGAGGTCCTTCCTGGGG - Intergenic
1091207385 11:133831123-133831145 GGGTGTGCAGGCACAAACTGTGG + Intergenic
1100776419 12:97979597-97979619 GTGTGTGCAGGTGCTGACTGTGG - Intergenic
1106610573 13:31275632-31275654 GGGTCTCCAGGCTCATACTGGGG - Intronic
1126825741 15:52546171-52546193 GTGTGTGCAGGTGCTGACTGTGG + Intergenic
1133142495 16:3757622-3757644 GGGTGTACAGGCGCTTACTGAGG - Intronic
1139492308 16:67292864-67292886 GGGTGGATAGGCCCTTACTGAGG - Intronic
1140776081 16:78249972-78249994 GTGTGTTCAGCCGCTCACTGGGG - Intronic
1144019867 17:11231046-11231068 GGGTGTTGAGGGGCTTTCTGGGG + Intergenic
1154984537 18:21536453-21536475 GGGATTACAGGCGCACACTGCGG - Intronic
1156503842 18:37576848-37576870 GGGTGTCCAGACCCTAACTGAGG + Intergenic
1158379739 18:56916001-56916023 GGGTGTACTGGCGGTTTATGGGG + Intronic
1166366476 19:42280845-42280867 GGGTGTACAGGCGCTTGGGCTGG - Intronic
926106608 2:10156066-10156088 AGGTCTAGAGGGGCTTACTGGGG - Intronic
929093065 2:38239081-38239103 GGGTCTACAGGGCCTTGCTGGGG - Intergenic
929943865 2:46355826-46355848 GGCTGTACAGGTGGTTGCTGGGG + Intronic
934746081 2:96760758-96760780 GGGGGTACAGTCGCTTAAGGTGG - Intergenic
948679112 2:239620382-239620404 GAGTGGAAAGGGGCTTACTGAGG - Intergenic
1173819029 20:46008986-46009008 GGGTGGACTGGCGCTGTCTGGGG - Exonic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1178606748 21:34043814-34043836 GGGTGTGGAGGTGCTTTCTGCGG + Intergenic
1179069458 21:38058184-38058206 GGGTGGACAGCCCCTTCCTGAGG + Intronic
1181670728 22:24424459-24424481 GGGCGCAGAGGCGCTTCCTGAGG + Intronic
950448970 3:13055027-13055049 GGGTGGACAGGAGCCTTCTGTGG - Intronic
953909652 3:46885297-46885319 GGGTGCACAGGCGCTCACAAAGG - Intronic
957039626 3:75327361-75327383 GGGTAGACAGACCCTTACTGGGG + Intergenic
983379860 4:166979213-166979235 GTGTGTATAGGGGCTTACTCTGG - Intronic
983971074 4:173874972-173874994 GGGTGAAAAGGTGCTTAATGTGG + Intergenic
994172504 5:96672933-96672955 GGCTGTACATGCATTTACTGTGG + Intronic
1019274948 7:171411-171433 GGTTGTACAGGCCCTTGATGGGG - Intergenic
1020266257 7:6562180-6562202 AGGTGTACATTCACTTACTGAGG + Intergenic
1036593423 8:10190399-10190421 GGGTGTCCAGGCACTGACGGGGG - Intronic
1047203041 8:122782132-122782154 GGGTGTGCAGGCTCTTTTTGCGG + Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060175435 9:121494175-121494197 GGGTGTGCACGTGCTTCCTGGGG - Intergenic
1185457249 X:317326-317348 GGGTGCTCAGGGGATTACTGAGG + Intronic
1190875799 X:54459274-54459296 GGGTGTACAGTCCCTACCTGGGG + Intronic