ID: 1133144528

View in Genome Browser
Species Human (GRCh38)
Location 16:3774633-3774655
Sequence CAGTTGCCACAAGCACCCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133144528_1133144531 -9 Left 1133144528 16:3774633-3774655 CCCATGGGTGCTTGTGGCAACTG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1133144531 16:3774647-3774669 TGGCAACTGGACGTTCCCCAAGG 0: 1
1: 0
2: 1
3: 1
4: 74
1133144528_1133144532 -3 Left 1133144528 16:3774633-3774655 CCCATGGGTGCTTGTGGCAACTG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1133144532 16:3774653-3774675 CTGGACGTTCCCCAAGGACATGG 0: 1
1: 0
2: 1
3: 27
4: 158
1133144528_1133144534 -1 Left 1133144528 16:3774633-3774655 CCCATGGGTGCTTGTGGCAACTG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1133144534 16:3774655-3774677 GGACGTTCCCCAAGGACATGGGG 0: 1
1: 0
2: 1
3: 6
4: 104
1133144528_1133144533 -2 Left 1133144528 16:3774633-3774655 CCCATGGGTGCTTGTGGCAACTG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1133144533 16:3774654-3774676 TGGACGTTCCCCAAGGACATGGG 0: 1
1: 0
2: 0
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133144528 Original CRISPR CAGTTGCCACAAGCACCCAT GGG (reversed) Exonic
900004060 1:32626-32648 CAGTTTTCATAAACACCCATCGG + Intergenic
900023788 1:203146-203168 CAGTTTTCATAAACACCCATCGG + Intergenic
901656428 1:10772326-10772348 CATTGGCCACATGCCCCCATTGG + Intronic
902027062 1:13391941-13391963 CAGGTGCCTCAAGAACCCCTTGG + Exonic
902270346 1:15299874-15299896 ATGTTGCCACAAGCACTCACAGG + Intronic
903022842 1:20406017-20406039 CAGTAAACACAAGCACCCACAGG + Intergenic
903753592 1:25645575-25645597 CAGTGACCACAAGCACACAGGGG + Intronic
904829691 1:33298847-33298869 CAGTTCCCACCAGCAGCCACTGG - Intronic
905463517 1:38136471-38136493 CAGGTGCCACAGGCACTCCTTGG + Intergenic
909566399 1:77057916-77057938 CTGTTGCCATTAGCACCGATGGG + Intronic
910640279 1:89453513-89453535 CAGTTGCCTCACTCACCCCTTGG - Intergenic
911257501 1:95648655-95648677 CAGTTCCCACAATCCCACATGGG - Intergenic
912850310 1:113118387-113118409 CAATTGCTACAAGCATCCCTAGG - Intronic
914456507 1:147841816-147841838 CAGGTGCCTCAAGAACCCCTTGG + Intergenic
915133632 1:153713969-153713991 CAGTGGCCAGAAGAACCAATTGG - Intergenic
915234069 1:154467570-154467592 GAGTTGCCTCAAGCAGCAATAGG - Exonic
921164597 1:212497600-212497622 CAGTTTCCACAAGCAGCCAATGG + Intergenic
1064279652 10:13940088-13940110 CAGTTTCCCCAAGTACTCATGGG - Intronic
1066058338 10:31701496-31701518 CAGTTGGCACATGAACCCATGGG - Intergenic
1069495672 10:68901333-68901355 CAGTGGCCACAACCACCTACGGG - Exonic
1069788711 10:71005877-71005899 CAGTGGCCAGAAGTGCCCATAGG - Intergenic
1075266123 10:121000784-121000806 CAGTTCCCACCAGCACCTCTAGG + Intergenic
1076768375 10:132650019-132650041 CAGTAGCCACCAGCACACACAGG - Intronic
1077655795 11:4017623-4017645 CAGTTACCACAAGCAAGCCTTGG - Intronic
1078083346 11:8219277-8219299 CAGGTGCCACAGGCAGCCAACGG - Intergenic
1078083614 11:8220766-8220788 CAGGTGCCACAGGCAGCCAGTGG + Intergenic
1079023332 11:16926003-16926025 CCGTTGCCGCAAGTGCCCATCGG + Intronic
1083710633 11:64546292-64546314 CAGGTGCCCCCAGCACCCACAGG - Intergenic
1085291636 11:75404574-75404596 CAGTTTACTCAAGCACCCCTGGG - Intronic
1085637841 11:78172052-78172074 CTGGTGACACAGGCACCCATGGG - Exonic
1090227190 11:125078816-125078838 CCATTGCCACAACCACCCATAGG - Intronic
1090422440 11:126584759-126584781 CAGATGCCACTACCACACATGGG + Intronic
1091012400 11:132015158-132015180 AAGTTGCCACAAACATACATTGG - Intronic
1091377485 12:34678-34700 CAGTTTTCATAAACACCCATCGG + Intergenic
1091890566 12:4050598-4050620 CAGTAGCCACATGCAGCCAGTGG - Intergenic
1092584155 12:9879052-9879074 CAGTTGCCACAATAAGCCAGAGG + Intergenic
1095982973 12:47983227-47983249 CAGATGACACAATCCCCCATGGG - Intronic
1098386024 12:69919696-69919718 CAATTGCCAGACACACCCATTGG + Intronic
1103976223 12:124704659-124704681 CAGTGGCAGGAAGCACCCATGGG - Intergenic
1105488835 13:20866532-20866554 CAGTTGCCACCAGCACAGAAGGG - Intronic
1113947910 13:114054999-114055021 CTGTGGGCACACGCACCCATGGG - Intronic
1117845948 14:59912168-59912190 TAGTTGCCACAAACAGCCATTGG - Intergenic
1122814073 14:104303737-104303759 CAGTTGCCACCAGCTCCACTTGG - Intergenic
1126358794 15:47823961-47823983 CAGTTGACACCAGGACACATGGG + Intergenic
1130384156 15:83396668-83396690 CAGCTGCAGCCAGCACCCATGGG + Intergenic
1131501318 15:92969582-92969604 CAGTTGCAAAGAGCACCCCTAGG - Intronic
1132449443 15:101958315-101958337 CAGTTTTCATAAACACCCATCGG - Intergenic
1133144528 16:3774633-3774655 CAGTTGCCACAAGCACCCATGGG - Exonic
1134031375 16:10995238-10995260 CAGTTGCCACAGCCATCAATGGG - Intronic
1141443037 16:84041757-84041779 CAGATGCCACCAGCGCCCACGGG + Intronic
1141746587 16:85930406-85930428 CAGGTGCCACCAGCACCCCATGG + Intergenic
1144387688 17:14764865-14764887 GAGTTGCCCCAAGCAACCAATGG - Intergenic
1146093412 17:29905343-29905365 CAGTTGCCACCATCAGTCATGGG - Intronic
1151032375 17:70756110-70756132 CAGTTGAAAAATGCACCCATAGG + Intergenic
1152356390 17:79809725-79809747 CAGTGGCCACGAGGACCCACTGG - Intergenic
1152475709 17:80516753-80516775 CAGCTGTCACCAGCACGCATGGG - Intergenic
1203171033 17_GL000205v2_random:148070-148092 CAGCTGCCACTAACAACCATGGG - Intergenic
1157157011 18:45278378-45278400 CAGATGCCAATAGCACCCACCGG + Intronic
1157335126 18:46732397-46732419 CAGTTGCACCCAGCACACATTGG + Intronic
1159262201 18:66028787-66028809 CAGTAGCAACAAGCACACCTAGG + Intergenic
1159262239 18:66029441-66029463 CAGTAGCAACAAGCACACCTTGG + Intergenic
1160635812 19:74235-74257 CAGTTTTCATAAACACCCATCGG + Intergenic
1161150244 19:2703752-2703774 CATTTTCCACAAGCTCCCTTGGG + Intergenic
1167438184 19:49491906-49491928 CAGGTGCCACAGGCAGCCCTGGG + Exonic
927405224 2:22758685-22758707 GTGTTGCCTCAAGCACACATAGG - Intergenic
931946376 2:67313126-67313148 CATTGGCCACAAGCACTCATTGG - Intergenic
936565664 2:113580815-113580837 CAGTTTTCATAAACACCCATCGG - Intergenic
940332275 2:152488255-152488277 CACTTGCTACAACCACCCACAGG - Intronic
943464794 2:188216438-188216460 TTGTTGCCACAAACACCTATAGG - Intergenic
945474149 2:210262103-210262125 CATTTTCCACAGGCATCCATTGG - Intergenic
947118313 2:226795021-226795043 CAGTTTCCAGAAGCAGCCAGAGG - Exonic
1168789957 20:569252-569274 CAGATGCCACCCGCAGCCATTGG + Intergenic
1169419612 20:5449308-5449330 CAGATGTCAGAAGGACCCATGGG - Intergenic
1170094358 20:12629468-12629490 CAGCTGCCACAAACCCCCCTTGG - Intergenic
1175719870 20:61279510-61279532 CATTTCCCACAGTCACCCATGGG + Intronic
1175813768 20:61873058-61873080 CAGTTTCCCCATGCACACATTGG - Intronic
1179559496 21:42205195-42205217 CAGATCCCACAAGCATCCAAAGG - Intronic
1179657159 21:42852549-42852571 CAGGTGCGACAGGCACCCACTGG + Intronic
1179995038 21:44970364-44970386 CAGTTGCCCCCAGCTCCCTTTGG + Intronic
1180056428 21:45361444-45361466 CAGATGCCTCCAGCAGCCATGGG + Intergenic
1181727703 22:24822967-24822989 CAGTTGTGAGAAACACCCATAGG + Intronic
1182062199 22:27406322-27406344 CAGTTTCCACAACAACCCAAAGG + Intergenic
1183512940 22:38246415-38246437 CAGTTTCCACAAGCTCCCCAGGG + Intronic
1184120559 22:42447069-42447091 CAGTGGCCACAGGCATCCCTTGG - Intergenic
1184132316 22:42524244-42524266 CAGTGGCCACAGGCATCCCTTGG - Intergenic
950747661 3:15103260-15103282 CATTTGCCACAGGCCCCAATGGG - Intergenic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
959026855 3:101249133-101249155 CAATTGCCACTACCATCCATTGG - Intronic
962283280 3:134067640-134067662 CAGTAACCACAAGCATCCATGGG + Intronic
968966496 4:3771547-3771569 CAGTTTCCACAACCACATATGGG - Intergenic
971514996 4:27474589-27474611 CAGCTGCCACCTGCACACATTGG + Intergenic
971785858 4:31101831-31101853 CAGATGCAACAAGCACACAAGGG - Intronic
974953957 4:68616190-68616212 CAGAGGCCACGAGCACCCTTTGG + Intronic
981675470 4:147338417-147338439 GAGTTGCCACCAGGACCCACTGG - Intergenic
985899652 5:2778713-2778735 CAGTTTCCACCCGCACCCACTGG + Intergenic
985901983 5:2803748-2803770 CAGTTGCCACAAACTCCCATTGG - Intergenic
985926772 5:3025301-3025323 CACTTTCAACAAGCACCCAGGGG + Intergenic
986541427 5:8848540-8848562 CAGCTGCCCCAACCACCCATGGG + Intergenic
988433270 5:31144608-31144630 CAGCTGCCACCAGCACCGCTTGG - Intergenic
989689951 5:44130308-44130330 CAGTTGCCACAATAATCAATTGG - Intergenic
993358790 5:86947286-86947308 CAGCTTCCACAAGAAGCCATGGG - Intergenic
994171763 5:96665463-96665485 CAGTAGCCACAAGCAGCTAGGGG + Intronic
997776533 5:136612870-136612892 AAGATGCCACAAGCACACGTTGG + Intergenic
998147933 5:139740758-139740780 GAGGGGCCACAAGAACCCATGGG + Intergenic
998594489 5:143514580-143514602 CATTGGCCACATGCATCCATTGG - Intergenic
1001210417 5:169805801-169805823 CAGATGCCACAATCCCCCACGGG - Intronic
1002860881 6:1078423-1078445 CAGTTGTCACAAGCAACAAAGGG - Intergenic
1006757323 6:36427789-36427811 CAGTAGCCACATGCAGCCAGTGG + Intronic
1007722930 6:43896182-43896204 CAGCTGCCTCAAGCTCCCAGGGG + Intergenic
1009811303 6:68670536-68670558 AAGTTGCCAAAAACATCCATTGG - Intronic
1012524774 6:100164285-100164307 CAGTTTCCACAGGGACCCACAGG + Intergenic
1014776586 6:125518045-125518067 CAGTAGCCAGAAGTACCTATGGG - Intergenic
1022039496 7:26566748-26566770 AAATGGCCACAAGGACCCATGGG + Intergenic
1022965875 7:35470836-35470858 CAGCTACAACAAGCACCCAATGG + Intergenic
1023842040 7:44103543-44103565 CAGCTGCCACATGGACCCAGAGG - Intergenic
1024491062 7:49986342-49986364 CAATGGCCGCAGGCACCCATGGG + Intronic
1024974078 7:55097181-55097203 CAGTTTTCACAAGCACCCCCAGG + Intronic
1029517569 7:101035675-101035697 CTGTTGACACCAGCACCCCTGGG + Exonic
1030790691 7:113724456-113724478 CTGGTGCCACAAGCACACAATGG + Intergenic
1030931489 7:115528428-115528450 TCGTTGCAAAAAGCACCCATGGG - Intergenic
1038444636 8:27594870-27594892 TTGTTGCCACCAGCACCCAGAGG - Intergenic
1039421111 8:37441716-37441738 TAGTTACCACAAGCAATCATAGG + Intergenic
1041022423 8:53651410-53651432 CAGTAGCCACATGCAGCCAGAGG + Intergenic
1047619555 8:126592222-126592244 CAGTAGCAAGAAGCTCCCATGGG - Intergenic
1050187104 9:2986119-2986141 CAGTAGCCACAAGTAGCTATTGG - Intergenic
1050440066 9:5651981-5652003 CAGGTGCCAAGAGCACACATTGG - Intronic
1050491092 9:6188575-6188597 CAGTAGCCACAGGCAGCCACAGG + Intergenic
1055221137 9:73933476-73933498 AAGTTGCCAAAAACACCCAATGG + Intergenic
1057210409 9:93198226-93198248 CAGGTGCCTCAGGCACCCAAAGG - Intronic
1186478896 X:9880597-9880619 CGGTTACCACTAACACCCATTGG + Intronic
1193791622 X:85821702-85821724 CAGCTCCCACAAGAACCCAAAGG - Intergenic
1199942891 X:152641822-152641844 CAGTTGCACCAAGCACCAATGGG + Intronic