ID: 1133146447

View in Genome Browser
Species Human (GRCh38)
Location 16:3790673-3790695
Sequence CTCGTTGTGGTTCTTCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133146442_1133146447 7 Left 1133146442 16:3790643-3790665 CCTGGCCAGGAAACTGGCTTTTA 0: 1
1: 0
2: 4
3: 54
4: 511
Right 1133146447 16:3790673-3790695 CTCGTTGTGGTTCTTCTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1133146444_1133146447 2 Left 1133146444 16:3790648-3790670 CCAGGAAACTGGCTTTTAAAGGA 0: 1
1: 0
2: 1
3: 24
4: 239
Right 1133146447 16:3790673-3790695 CTCGTTGTGGTTCTTCTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1133146440_1133146447 15 Left 1133146440 16:3790635-3790657 CCATTGCGCCTGGCCAGGAAACT 0: 1
1: 4
2: 29
3: 296
4: 1785
Right 1133146447 16:3790673-3790695 CTCGTTGTGGTTCTTCTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133146447 Original CRISPR CTCGTTGTGGTTCTTCTGTA GGG Intronic
905065963 1:35183145-35183167 CTCCTTGTGCTACTTCTGTTGGG - Exonic
907359235 1:53901476-53901498 CCAGTTGTGGTGCTCCTGTAAGG - Intronic
910422476 1:87081153-87081175 TTCTTTGTGGTTTTTCTGTCTGG - Intronic
911163792 1:94708163-94708185 CTTGTTTTGTTTCTTCTTTAGGG - Intergenic
913424964 1:118718237-118718259 CTAGTTTAGGTTCTTCTGGAAGG + Intergenic
915774898 1:158472308-158472330 GTCATTGTGCCTCTTCTGTATGG - Intergenic
921107334 1:211995785-211995807 TCCCTTGTGCTTCTTCTGTAAGG - Intronic
921533474 1:216314163-216314185 CTCTATTTGCTTCTTCTGTAAGG + Intronic
923777716 1:236995098-236995120 CTTGTTGTTGTTGTTCTGTTTGG - Intergenic
1073029275 10:100512112-100512134 CTCTTTGGGGGCCTTCTGTAAGG - Intronic
1080117651 11:28638839-28638861 CTCCTTGTGCTTCTTCGGTGAGG - Intergenic
1080705270 11:34685843-34685865 ATCGTTGTGGTTGTTCAGAAAGG - Intergenic
1082906739 11:58315912-58315934 CTCGTTATGGTTTATCTGTAAGG + Intergenic
1087020739 11:93600397-93600419 CTAGTTGTCATTCTACTGTAAGG - Intergenic
1089299043 11:117487369-117487391 CACGTTATGGTTCTACTGAATGG + Intronic
1098325073 12:69293252-69293274 TTCCTTGTCGATCTTCTGTATGG - Intergenic
1099209461 12:79766336-79766358 CTTGTTCAGTTTCTTCTGTAGGG + Intergenic
1103276821 12:119718721-119718743 CTCGATGCGGGTCTTCTGAAGGG + Exonic
1108078670 13:46709773-46709795 CTCCTTGTTTTCCTTCTGTAGGG + Intronic
1108846503 13:54684651-54684673 TTTGTTGTGATTTTTCTGTATGG - Intergenic
1121172590 14:91867530-91867552 CTAGTTGTGGTTCTTCAGTCAGG - Intronic
1130853369 15:87819735-87819757 CTCCTTGTATTTTTTCTGTATGG - Intergenic
1133146447 16:3790673-3790695 CTCGTTGTGGTTCTTCTGTAGGG + Intronic
1144327729 17:14197793-14197815 CTCTTTGTGGTTGTTCTGTCAGG + Intronic
1147036337 17:37684265-37684287 AACGTTTTTGTTCTTCTGTATGG - Intergenic
1203161611 17_GL000205v2_random:57289-57311 CTCGTGGTGGCTCTGCTGGATGG - Intergenic
1156318486 18:35994489-35994511 TTGGTTGTGGTTCTGCTGTGAGG + Intronic
1156658823 18:39321013-39321035 CTCATTGTGGTTCATCTATAAGG + Intergenic
1158207245 18:55006997-55007019 CTCTTTGTGTTTCTGCTGTTAGG + Intergenic
1159970420 18:74645428-74645450 CTCGTCTTGATTCTTGTGTATGG + Intronic
1168320993 19:55509341-55509363 CTCGTTGTGGAATTGCTGTATGG - Intronic
928414251 2:31078650-31078672 CTGATTCTGGTACTTCTGTAGGG - Intronic
929734646 2:44534328-44534350 CTCGTTGTTGATTTTCTGTTTGG - Intronic
932568506 2:72924417-72924439 CACGTAGTGGTTCTTCTCGAAGG - Exonic
932692798 2:73927484-73927506 TTCGTTGTTGTTTTGCTGTAAGG - Intronic
941577352 2:167249755-167249777 ATCTTCCTGGTTCTTCTGTATGG - Exonic
942499251 2:176570939-176570961 TTCAGTGTGGTTTTTCTGTAAGG + Intergenic
942737503 2:179132322-179132344 CTCTTCGTGTTTCTGCTGTAGGG + Exonic
944631158 2:201626076-201626098 CTCGTGGTGGCTCTTCTGGTTGG - Exonic
1169612948 20:7403709-7403731 CTTGTTGTGGCTGATCTGTATGG + Intergenic
1172088701 20:32411138-32411160 TTAGTTGTGGTTTTTCAGTAAGG + Intronic
1176091144 20:63319179-63319201 CTCCTTGGGGTTCTGCTGGATGG + Exonic
949538209 3:5012034-5012056 CTGGTTCTGGTTCTGCTGTCAGG + Intergenic
949857635 3:8476640-8476662 ATCCCTGTGGTTCTTCTGGAAGG - Intergenic
952360624 3:32626642-32626664 CTGGGTGAGGTTCTTTTGTACGG + Intergenic
953163813 3:40446263-40446285 CTCCTTGCTGTTCTTCAGTATGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956611573 3:71129066-71129088 CTCGTTTTGTTTTTTCTGGATGG - Intronic
959993781 3:112658448-112658470 CTTTTTGTGGTTATTCTGAATGG + Intergenic
960015303 3:112880993-112881015 CTCTTTGTGGCTATTCTGAATGG + Intergenic
961586467 3:127931587-127931609 CTCGTTGTGGCTCCACTTTAGGG - Intronic
969698871 4:8754716-8754738 CTCGCTGTGATTCTTGAGTAAGG - Intergenic
970174320 4:13323200-13323222 GTTGTTTTGGTTCTTCTTTATGG + Intergenic
970668608 4:18368042-18368064 CTGGTGGTGTTTGTTCTGTACGG - Intergenic
972441414 4:39097229-39097251 TTCGTTGGCATTCTTCTGTAAGG - Intronic
976449484 4:85171264-85171286 CTAATTGTGTTTCTTCTGAAGGG + Intergenic
981485996 4:145286768-145286790 CTCATTGTGGTTCTTCCCTTTGG - Intergenic
986525289 5:8667198-8667220 CTAGTTGTGGTTCTAATGGAAGG - Intergenic
991042820 5:62193420-62193442 CTAGTTGAGGTTCCTCTGTGGGG - Intergenic
995102423 5:108329176-108329198 CTACTTGTGTTTCTCCTGTAGGG - Intronic
995901088 5:117067028-117067050 CACGTTGTGATTCTTCTCAAGGG - Intergenic
1000024223 5:157344939-157344961 ATCCTTGTTTTTCTTCTGTAAGG + Intronic
1001343073 5:170864949-170864971 TTTATTGTGGATCTTCTGTATGG + Intronic
1005367333 6:25091913-25091935 CTCGTTGTGGTCTTTCTTTTGGG + Intergenic
1008621385 6:53274788-53274810 TTCTTTCTGGTCCTTCTGTATGG - Intronic
1011010470 6:82697504-82697526 TTTGTTTTGTTTCTTCTGTAGGG - Intergenic
1014556470 6:122846799-122846821 TTCTTTGTGTTTCTTCTGTTTGG + Intergenic
1019775929 7:2912217-2912239 CGCGTTGGGGTTCTTCTCTCGGG + Exonic
1021032173 7:15750968-15750990 CTCTTTTTGCTTCTTCTCTAGGG + Intergenic
1022130100 7:27397153-27397175 ATCGTTGTGGGTCTGGTGTAGGG - Intergenic
1031084970 7:117293493-117293515 TTCGTTGTGGTTATTTTGTTTGG - Intronic
1035969324 8:4229443-4229465 GTGATTGTGGGTCTTCTGTAAGG - Intronic
1037591218 8:20313540-20313562 CTCTTTGAGGTTCTCCTGGAGGG + Intergenic
1038344227 8:26717523-26717545 CTCCTTATGGTTCTTATGTTTGG + Intergenic
1041179982 8:55237014-55237036 CTGGTTGTGCTTCTTCTTCAAGG + Intronic
1042574755 8:70205625-70205647 CTCCTTCTGGGTCTTCTGTTTGG - Intronic
1043292308 8:78618139-78618161 TTCTTTGGGGTTCTTCTGCATGG + Intergenic
1046612042 8:116436758-116436780 CTCTTTGTGTTTCTTTTGTTTGG - Intergenic
1048566420 8:135602900-135602922 CTTGTTATGGTTCCTCTGTATGG - Intronic
1058360512 9:104141453-104141475 ATGGTTGAGGTTCTTCTTTAAGG - Intergenic
1060727475 9:126016051-126016073 GTGGTTGTGGTTCTCCTGTCCGG + Intergenic
1188736258 X:33720096-33720118 CTCCTTGTAATTCTTCTGAAGGG + Intergenic
1193003721 X:76591695-76591717 CTCGTTGTGCTTCCTGGGTAAGG + Intergenic
1196284617 X:113864402-113864424 ATCGTTTTGGTTCTTCTTTGTGG + Intergenic
1199076801 X:143534642-143534664 CTGGCTGTGGTCCTTCTGGAGGG - Intergenic