ID: 1133155690

View in Genome Browser
Species Human (GRCh38)
Location 16:3873957-3873979
Sequence GCCCCTGGGGAGGGAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 582}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133155682_1133155690 5 Left 1133155682 16:3873929-3873951 CCTGAGGGCCTACTATGTGTCAG 0: 1
1: 4
2: 14
3: 125
4: 378
Right 1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG 0: 1
1: 0
2: 5
3: 63
4: 582
1133155681_1133155690 17 Left 1133155681 16:3873917-3873939 CCTCAAATATTTCCTGAGGGCCT 0: 1
1: 4
2: 26
3: 101
4: 628
Right 1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG 0: 1
1: 0
2: 5
3: 63
4: 582
1133155680_1133155690 18 Left 1133155680 16:3873916-3873938 CCCTCAAATATTTCCTGAGGGCC 0: 1
1: 0
2: 4
3: 41
4: 319
Right 1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG 0: 1
1: 0
2: 5
3: 63
4: 582
1133155684_1133155690 -3 Left 1133155684 16:3873937-3873959 CCTACTATGTGTCAGGCACTGCC 0: 2
1: 13
2: 175
3: 838
4: 2834
Right 1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG 0: 1
1: 0
2: 5
3: 63
4: 582

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133155690 Original CRISPR GCCCCTGGGGAGGGAAGTGC TGG Intronic
900147027 1:1162871-1162893 GGGCCTCGGGAGGGAAGAGCCGG - Intergenic
900177868 1:1298700-1298722 GCCCCTGGGGTGGGCACTGAGGG - Intronic
900227281 1:1539298-1539320 GTCCCTGGGCAGGGGAATGCAGG - Intronic
900549284 1:3246072-3246094 GGCCCGGGGGAGGCAAGTGCTGG + Intronic
900605136 1:3520526-3520548 GTCTCTGGGGTGGGAAGAGCAGG - Intronic
900702756 1:4058392-4058414 GCCAGTGGGGAGGAAAGTTCTGG + Intergenic
900713109 1:4127532-4127554 GCTCCTGGAGGGAGAAGTGCTGG + Intergenic
901002546 1:6155764-6155786 GACCCTGGGGATGGGGGTGCAGG - Intronic
901020242 1:6251655-6251677 GCCCTTGGGGAGAAAAGAGCTGG + Intronic
901112600 1:6810337-6810359 GCCCCTGGGGCAGGAATTGAGGG - Intronic
901198428 1:7453315-7453337 GACAGTGGGGAGGGAGGTGCAGG - Intronic
901671465 1:10858491-10858513 GGCCCTAGGGAGGGCAGGGCAGG + Intergenic
901758985 1:11458689-11458711 GCCAGTGGGGAGGGGAGTGGGGG - Intergenic
901765371 1:11496663-11496685 GGGCCTGCGGAGGGAGGTGCTGG + Intronic
902111656 1:14084102-14084124 GCCCCTCTGGAGGGAGGTGATGG + Intergenic
902283028 1:15388294-15388316 GGGCCTGGGGAGGGAAGGGAAGG - Intronic
902394546 1:16125403-16125425 GCGGCTGGGGAGGGGAGTGGAGG + Intronic
902667015 1:17946627-17946649 GCCCTGGGGCAGGGAAGTGCTGG + Intergenic
902706405 1:18208267-18208289 TCCCCTGGGAAGGAATGTGCTGG + Intronic
903754653 1:25652449-25652471 GCCTGTGGGGTGGGAAGGGCTGG - Intronic
903935873 1:26894456-26894478 GCCCCGAGGGAGGGAAGCTCAGG + Intronic
904678424 1:32212609-32212631 GCCCCTGGGCAGGGAGGGGCTGG - Exonic
904679165 1:32216791-32216813 GCCCCTGGGCCATGAAGTGCTGG - Exonic
904754775 1:32762228-32762250 GCAACTGGGGAAGGAACTGCAGG + Intronic
904772325 1:32887027-32887049 GACCTTGAGGAGGGCAGTGCGGG + Intronic
905168721 1:36098188-36098210 CCCCCTGGAGAGGGGAGAGCAGG - Exonic
905211077 1:36374540-36374562 GGCCCTTGGGAGGGGAGAGCTGG - Intronic
905630080 1:39513735-39513757 GACCCAGGCGAGGGAGGTGCTGG + Intronic
905667679 1:39772455-39772477 GACCCAGGCGAGGGAGGTGCTGG - Intronic
905775125 1:40663461-40663483 GTCCCTGGGGAGGGGGGAGCAGG - Intronic
906152314 1:43594670-43594692 GCCCAGGGGGAGGGAAGTGGAGG + Intronic
906210809 1:44011347-44011369 GCCCCTGGGCAGGCGACTGCGGG + Intronic
907296932 1:53461338-53461360 GGCCCAGCGGAAGGAAGTGCGGG + Intronic
907410638 1:54281138-54281160 GCCCCTGGCCAGGGAGGTGGTGG - Intronic
908128054 1:61050229-61050251 GCCCCTGGAGAGGGGAGGGCAGG - Intronic
909352824 1:74673993-74674015 GGCCCTGGGGAAGGAAGGACTGG + Intergenic
911058126 1:93724716-93724738 GCCACAGGAGAGGGAGGTGCTGG + Intronic
911591519 1:99753272-99753294 GCACTTTGGGAGGGAAGGGCAGG + Intronic
912363316 1:109112866-109112888 GCCCCTGGGGAGGAAGCTCCGGG + Intronic
912555947 1:110516098-110516120 GCTGCTGGGAAGGGAAGAGCAGG - Intergenic
912708692 1:111934053-111934075 GGCCCTGGGGAAGGTGGTGCGGG + Intronic
912729294 1:112087807-112087829 GCCCCTGAGGAGGCAAGGGCCGG - Intergenic
912815308 1:112823933-112823955 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
914694256 1:150061634-150061656 GCCCCTGGGCAGGTCACTGCTGG - Intergenic
915207293 1:154279600-154279622 GCCACTGGGGAGGCTAGGGCAGG + Intergenic
915225879 1:154410967-154410989 GCCTCAGGTGAGAGAAGTGCTGG + Intronic
915325007 1:155077320-155077342 GCCCCTTGGGATGGGAGTGGGGG - Intergenic
915338983 1:155166172-155166194 GCCCTGGGGGTGGGAGGTGCGGG + Intergenic
915520517 1:156439752-156439774 GCTCCTGGGGAGGGAGGGGCAGG - Intergenic
916361073 1:163969573-163969595 GAGCCTGGGGAGGGTAGTGTGGG + Intergenic
917795276 1:178528715-178528737 GCCCCTGGGGAGAGACCTGCAGG + Intronic
918134257 1:181657453-181657475 GCCTCTGGGGAGTGAAATTCAGG + Intronic
918143792 1:181738691-181738713 AGCACTGGGGAGGGGAGTGCAGG - Intronic
918282915 1:183023395-183023417 GCCCCCGGGGAGGAAGGAGCAGG - Intergenic
919758230 1:201079307-201079329 GCCCCTGGAGAGAGTAGTGTTGG - Intronic
919805732 1:201380070-201380092 ACCCCAGGGGAGGGGGGTGCAGG + Intronic
920171939 1:204077394-204077416 GCCCCAAGGGAGGGAAATGGTGG + Intronic
922516650 1:226212940-226212962 GGGCCTGGGGAAGGAAGGGCTGG - Intergenic
922665657 1:227466399-227466421 GCCACGGTGGAGAGAAGTGCAGG + Intergenic
922994556 1:229945357-229945379 GCCCCTGGGGAGGGCATGGGTGG - Intergenic
923030957 1:230248757-230248779 GCCCCAGGGGAAGGCAATGCTGG - Intronic
923086865 1:230708894-230708916 GGGCCTGGGGAGGGCAGAGCTGG - Intronic
923102247 1:230826026-230826048 GGCCCTGGGGAGAGCAGAGCTGG + Intergenic
1063106408 10:2996447-2996469 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1063162196 10:3426627-3426649 GCCCCTGGGGACTGAAGTGCAGG - Intergenic
1063460526 10:6212492-6212514 GGCCCTGCCGAGGGAAGGGCCGG - Intronic
1064886993 10:20122626-20122648 GCTCCTGGGGAAGGAGGTTCTGG + Intronic
1066108015 10:32172364-32172386 TCCCCTGGGGTGGGAGGTGTGGG - Intergenic
1067045274 10:42981874-42981896 TCCACTGGGCAGGGAAGGGCAGG + Intergenic
1067208469 10:44239348-44239370 TCCCCTGGGGTGGGGAGGGCAGG - Intergenic
1067249258 10:44573612-44573634 CACCTTGTGGAGGGAAGTGCGGG - Intergenic
1067431459 10:46248674-46248696 TCCCCTGGGGTCAGAAGTGCTGG - Intergenic
1067479320 10:46584977-46584999 CCCTGTGGGGAGGGAGGTGCGGG - Intronic
1067615419 10:47756824-47756846 CCCTGTGGGGAGGGAGGTGCGGG + Intergenic
1067814139 10:49459283-49459305 GCCTTTGGGGAAGGAAGTGGGGG - Intronic
1069568277 10:69478245-69478267 GGCCTTGGGAAGGGAGGTGCAGG + Intronic
1069726381 10:70582984-70583006 ACCCCTTGGGAGGGAAGCCCTGG + Intergenic
1069749243 10:70735099-70735121 GCCCCTGGGAAGGGAAAGCCTGG + Intronic
1069907368 10:71739733-71739755 GCCCCTGGACAGAGAAGAGCTGG + Intronic
1069913137 10:71771945-71771967 GCCACCAGGGAGGGCAGTGCAGG + Intronic
1070579713 10:77710409-77710431 GGCTGTGGGGAGGGAGGTGCGGG - Intergenic
1072625406 10:97108022-97108044 ACCCCGGGGCAGGGAAGAGCTGG - Intronic
1073065858 10:100758885-100758907 GCTCCTGGGGAAGGCAGTGGAGG + Intronic
1073212110 10:101812728-101812750 GCCACTGGGCAAAGAAGTGCTGG - Intronic
1074498136 10:113997692-113997714 GCACGTGGGGAGAGAAGTGAGGG - Intergenic
1074570333 10:114618579-114618601 GCCCCTGGGTAAAGATGTGCAGG + Intronic
1074981176 10:118621080-118621102 GCCCCAGAGGAAGGAAGTGAGGG - Intergenic
1075048641 10:119165732-119165754 GGGCCTGGGGCGGGAACTGCGGG - Intergenic
1075076827 10:119357522-119357544 GCTCCTGGGGAGTGGAGTGGGGG + Intronic
1075726373 10:124612902-124612924 GCCCCTGGGGAGCCCAGAGCAGG + Intronic
1075832128 10:125420184-125420206 GGTCATGGGCAGGGAAGTGCTGG + Intergenic
1076019937 10:127064598-127064620 GCCGCTGGGAAGGGGAGTGAAGG - Intronic
1076404006 10:130200664-130200686 GCCCCTGGGGAGCCCAGCGCTGG + Intergenic
1076541199 10:131216021-131216043 GCCACAGGGAAGGGAAGGGCAGG + Intronic
1076549925 10:131271711-131271733 GCCCATGTGGAGGGAAGGCCTGG + Intronic
1076685246 10:132195725-132195747 GCCCCCGGGCAGGGAGGTGAGGG - Intronic
1076692993 10:132233231-132233253 GCCTCTGGGGAGGGCACTGGAGG + Intronic
1076797553 10:132805610-132805632 GCCTCGTGGGAGGGAAGCGCCGG + Intergenic
1076806617 10:132862206-132862228 GCCTCTGAGGAGGGAAGAGGGGG + Intronic
1077252673 11:1567500-1567522 GCTCCTGGGCAGGGAGGAGCTGG - Intronic
1077455353 11:2675062-2675084 GCCCCTGGAGAGGCTAGTGTGGG + Intronic
1078929310 11:15901187-15901209 GCCTCTGTGGAGTGAAGGGCAGG + Intergenic
1079108290 11:17588298-17588320 TCCCGTGGGGAGGCAGGTGCTGG + Intronic
1081736890 11:45410573-45410595 GCCCCTGGCCAGGGAGGTGCAGG - Intergenic
1083023759 11:59532565-59532587 GTCCGTGGGGAGGGCAGTGAAGG - Intergenic
1083279691 11:61619299-61619321 GGCCTTGGGGAGGGAGGAGCTGG - Intergenic
1083327431 11:61879888-61879910 GCCCCCTGGGAGGGGAGGGCAGG + Intronic
1083333295 11:61909056-61909078 GACCCTGGAGAGGGAAGGGAGGG + Intronic
1083417505 11:62535187-62535209 TCCCCTGAGCAGGGAAGAGCAGG + Exonic
1083438103 11:62656905-62656927 GGCCCTGAGAAGGGAAGTGTTGG - Intronic
1083846103 11:65334352-65334374 GCCCCTGCGGAGTGCACTGCGGG + Intronic
1083859284 11:65411404-65411426 GCCCCTCAGGAGGACAGTGCCGG - Exonic
1084289377 11:68151979-68152001 ACACCTGTGCAGGGAAGTGCTGG + Intergenic
1084325377 11:68397064-68397086 GCCCCGGGGGTTGGAAGTTCTGG + Intronic
1084423449 11:69071845-69071867 TCCCCAGGGGAGGGAAGGGTCGG + Intronic
1084481072 11:69420588-69420610 GCCCGTGGGGACGGGAGTCCTGG - Intergenic
1084791995 11:71480928-71480950 GCCCCTGGGGTGGGGACTCCTGG + Intronic
1084859777 11:72010851-72010873 CCACCTGGGGAGGGAAGAGGAGG + Exonic
1085283368 11:75345031-75345053 GCACCTGGAGAGGGATCTGCTGG - Intronic
1085427384 11:76416517-76416539 TCCCCTGGAGAGTGAATTGCTGG + Intergenic
1085463688 11:76710234-76710256 GCCTCTGAGGAGGGAAGGACTGG - Intergenic
1085638057 11:78173298-78173320 CACCCTGGGGAGGGAGGAGCAGG + Exonic
1088797648 11:113277348-113277370 GCTCCTGGGGATGGAAATGGAGG + Exonic
1088869080 11:113875905-113875927 GCCCGTGGGGAGGGTGGAGCCGG - Intergenic
1089356820 11:117859267-117859289 TCCCCTGAGGAGGGAGGTCCGGG + Intronic
1089395756 11:118135670-118135692 GACCCTGGGGAGGGGAGGGCTGG + Exonic
1089452646 11:118608414-118608436 CCCCCGGGATAGGGAAGTGCGGG + Intronic
1089579292 11:119471399-119471421 GCGGACGGGGAGGGAAGTGCAGG - Intergenic
1089696076 11:120217064-120217086 AACCCTGGGGAGGGAGGTGGAGG + Intronic
1090074944 11:123574496-123574518 GGCCCTGGGGAAGGAAGGGAAGG + Intronic
1090076058 11:123580672-123580694 ACTCATTGGGAGGGAAGTGCTGG - Intronic
1090272925 11:125400468-125400490 GCCCCTGGGGGTGGAAGGGAGGG + Intronic
1090425815 11:126606495-126606517 GCCATGGGGGAGGGAAGTCCGGG + Intronic
1090669570 11:128936994-128937016 GCTTCTGGGGAGAGAAGTGTGGG + Intronic
1090844043 11:130516380-130516402 TGCTCTGTGGAGGGAAGTGCTGG + Intergenic
1091223915 11:133946532-133946554 GAGACTGGGGAGGGAAGAGCTGG - Intronic
1091290669 11:134437799-134437821 GCCTCTGGAGTGGGAGGTGCAGG - Intergenic
1091680943 12:2526066-2526088 GCAGCTGGGGAGAGAAGGGCTGG + Intronic
1091792777 12:3281134-3281156 GGCCCTGGGGAGGAAGGGGCGGG + Intronic
1092860629 12:12716901-12716923 GCCGCTGGGGAGGGCCGAGCTGG + Intronic
1094023773 12:25941477-25941499 GGGCCTGGGGAGGGAAGAGAAGG + Intergenic
1094070728 12:26410268-26410290 GCGGCAGGGGAGAGAAGTGCTGG + Intronic
1095401079 12:41814989-41815011 GACCCTGGGGAGGAGAATGCAGG - Intergenic
1096007661 12:48185293-48185315 GCCCCTGGGCTGGGAGGAGCTGG + Exonic
1096251064 12:50032959-50032981 GCCCCTGGGGAGGTGAGGGCCGG - Intronic
1096781518 12:53994858-53994880 CCGCCTGGGGAGGGAAGCCCCGG - Intronic
1096848187 12:54419203-54419225 GCCCCAGGACAGGGAAGAGCGGG - Exonic
1096862649 12:54541018-54541040 GACTCTGGGGACAGAAGTGCTGG - Intronic
1096983456 12:55742435-55742457 GCCCCTGAGGAGGCAGGTGCAGG - Intergenic
1097185244 12:57193157-57193179 ACCGCTGGGGAGGGAGGTGGAGG - Exonic
1097793976 12:63843683-63843705 GCCTCGGCGGAGGGAGGTGCCGG + Intergenic
1098443147 12:70538749-70538771 ATCCCTCTGGAGGGAAGTGCAGG + Intronic
1101806966 12:108072545-108072567 CCCCATGGGGAGGGAGGAGCAGG - Intergenic
1101875352 12:108593588-108593610 GCCCCAGGGTGGGGAAGTCCTGG + Intronic
1102254134 12:111406293-111406315 GCCCCGGAGGAGGGGAGCGCGGG - Intronic
1102428237 12:112861434-112861456 GCCCTTGGTGAGGGAAAGGCAGG + Intronic
1102738598 12:115185844-115185866 GCCCCTGGTGAGGGATGCCCAGG + Intergenic
1102908681 12:116696446-116696468 TCATCTGGGGAGGGAGGTGCTGG + Intergenic
1102952893 12:117041991-117042013 GCTCCTGGGGACGGAAGCACAGG + Exonic
1103527639 12:121578733-121578755 GCACGTGGGGAGGGAGCTGCCGG - Intronic
1104005860 12:124891887-124891909 GCCTCTGGGGAGGGCAGTCAAGG + Intergenic
1104035357 12:125093588-125093610 ACCTCTGGAGTGGGAAGTGCTGG + Intronic
1104580487 12:130007825-130007847 GCCCTTGGTGCGGGCAGTGCTGG - Intergenic
1104745125 12:131205652-131205674 GCTCCTGGGGATGGAAGGGCCGG + Intergenic
1104766007 12:131330724-131330746 GCATCTGGGGAGGGAACTGGAGG + Intergenic
1104789269 12:131471747-131471769 GCTCCTGGGGATGGAGGGGCCGG - Intergenic
1104822840 12:131687999-131688021 GCCCCTGGAGAGGGACCGGCTGG + Intergenic
1105020474 12:132813378-132813400 GCCCCTGGAGAAGGAGGAGCAGG - Exonic
1105772843 13:23629497-23629519 GCCCTTGGGGAGGGGAGTGCTGG - Intronic
1106064375 13:26330449-26330471 GCACTTGGGGAGGGAAAGGCGGG - Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106549640 13:30760243-30760265 GAACCTGGGGTGGGAAGTGGAGG + Intronic
1108373550 13:49793078-49793100 GCCTCTGGGCGGGGAAGAGCGGG + Intergenic
1108595440 13:51944889-51944911 GGCCCTGGTCATGGAAGTGCAGG - Intronic
1110604428 13:77415306-77415328 GACCCTGGGGAGGGCTGTGAGGG + Intergenic
1112386708 13:98946562-98946584 GTCTCTGGGGAGGGAATTGAGGG - Intronic
1113379400 13:109787679-109787701 GCCCCTGTGGAAGGAAGGGGGGG - Intergenic
1113485357 13:110648914-110648936 GCCCCTGGGAAGGGATCCGCAGG + Intronic
1113711332 13:112467274-112467296 GCTCCTGGGGGAGGAGGTGCGGG - Intergenic
1114536222 14:23424687-23424709 GCCCCTGTGCAGGGAGGTGCAGG + Intronic
1115240601 14:31248810-31248832 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1116703291 14:48265841-48265863 GCTCCTGGGGGGGGAGGTTCTGG + Intergenic
1118782213 14:69016149-69016171 GCCCATGGTGATGGGAGTGCAGG + Intergenic
1119022434 14:71126571-71126593 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
1119474283 14:74918275-74918297 GGTCCTGGGGAGGAAAATGCAGG - Intronic
1119573382 14:75695908-75695930 GACCCTGGGGAGGGAGGGGAGGG - Intronic
1121409725 14:93741364-93741386 ACCCCATGGGAGGGAAGTTCAGG - Intronic
1122118352 14:99538635-99538657 GCTCATGGAGAGGGAAGTGCTGG - Intronic
1122145812 14:99688306-99688328 CGCCCTGGGGAAGGAAGTACGGG - Intronic
1122211911 14:100178874-100178896 GCCCCTGGAGAGTGGGGTGCAGG + Intergenic
1122263783 14:100537542-100537564 GCCCCTTGGAAGGGAAGGGAAGG - Exonic
1122718514 14:103709114-103709136 TGCCCTGGGGAGGGGAGCGCTGG + Intronic
1122798584 14:104218531-104218553 GCCTGTGGGGAGGGGAGTGCAGG + Intergenic
1122857625 14:104567436-104567458 GCCCCTGGGGTAGGAAGGGCCGG + Intronic
1123001113 14:105294613-105294635 GACGATGGGGAGGGAAGAGCAGG + Intronic
1123022923 14:105410688-105410710 CCCCCTGGTGAGGGAGGTGGAGG + Intronic
1124001802 15:25766482-25766504 GGGCCTGGGGAGGGAGATGCTGG - Intronic
1124006671 15:25800396-25800418 TCCCCTGGGGAGGCAGGAGCAGG - Intronic
1124168833 15:27353955-27353977 GCCCCAGGGGCTGGAGGTGCAGG - Intronic
1124598624 15:31112562-31112584 GCCCCTTGGGAGGAAGGAGCTGG - Intronic
1124659847 15:31538251-31538273 CCCGCTGGGGAGAGAAGAGCAGG + Intronic
1125777832 15:42234026-42234048 GCCCTTGGGGAGGCCAATGCAGG - Intronic
1126691977 15:51294725-51294747 GCCCCCCGGGAGGGAGGTGAGGG + Intronic
1127044997 15:55016477-55016499 GCCCTTGAGGAGGGGAGAGCTGG - Intergenic
1127662238 15:61110870-61110892 ATCCATGGGGAGAGAAGTGCAGG - Intronic
1128114044 15:65094430-65094452 GCCCCAGGGGATGGAAGGGATGG - Intronic
1128311559 15:66634249-66634271 GGCCATGGGGAGGGAATTGTGGG - Intronic
1128772749 15:70294651-70294673 GGCCCTGGGGCGGGAAGGGTTGG + Intergenic
1129540354 15:76342876-76342898 ACCGCTGGGGAAGGAAGCGCCGG - Intergenic
1129659238 15:77543680-77543702 CTCCCTGGGCATGGAAGTGCTGG - Intergenic
1130407015 15:83611449-83611471 CCACTTGGGGAGGGCAGTGCTGG + Intronic
1131117507 15:89804059-89804081 AGCCCTGGGGAGGGTAGTTCTGG - Intronic
1131385198 15:92000316-92000338 TCCTCTGGGAAGGGAAGTGGGGG + Intronic
1132669538 16:1096946-1096968 GCCCCTGTTGTGGGAGGTGCTGG + Intergenic
1132682377 16:1148380-1148402 GGACCTGGGGAGGGAAGCTCCGG - Intergenic
1132724830 16:1334096-1334118 TCCCCCGGGGAGGGAGGCGCGGG - Intronic
1132743826 16:1428645-1428667 GGGCCTGCGGAGGGAAGGGCGGG - Intergenic
1132744304 16:1430373-1430395 ACCCCTGGGGTGGGAAATGGGGG - Intergenic
1132845187 16:1997979-1998001 GTGCCAGGGGAGGGAAGGGCTGG - Exonic
1133036375 16:3036333-3036355 GCCCCTGGGGACGGGAGCCCTGG + Intronic
1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG + Intronic
1133303148 16:4795333-4795355 GGCCCTGGGGAGGGCGGGGCTGG + Intronic
1133843160 16:9428627-9428649 GCCCCTGGGGTGGAAACTTCGGG + Intergenic
1134291928 16:12908537-12908559 GCCCCTGGAGAGTGGAGTGTCGG + Intronic
1134628337 16:15738941-15738963 GCCCTGGGGCAGGGAAGAGCTGG - Intronic
1134666632 16:16023685-16023707 GCTCTGAGGGAGGGAAGTGCTGG + Intronic
1135588897 16:23691365-23691387 GCCCCTGGTGAGGGCACTGGAGG - Exonic
1136344382 16:29665443-29665465 GCGCCTGGGCAGGGCAGGGCTGG + Exonic
1136612947 16:31378199-31378221 GCCCCCGGGGAGGTATGTGGGGG + Intronic
1137369854 16:47895157-47895179 GGCAGTGGGGAGGGAAGTACAGG + Intergenic
1137476221 16:48811695-48811717 GAACCTGGGGAGCGAAGGGCGGG - Intergenic
1137560344 16:49498279-49498301 GCCACTGGTGATGGCAGTGCTGG + Intronic
1137704203 16:50522856-50522878 GCTCCTGGGGAGAGGGGTGCTGG - Intergenic
1137816209 16:51400328-51400350 GCCCCTGGGAACAGAAGTCCTGG + Intergenic
1138131506 16:54483933-54483955 CCCCCTGGAGAGGGGAGAGCAGG + Intergenic
1138320617 16:56108093-56108115 GACCCTGCTGAGGCAAGTGCAGG - Intergenic
1138434541 16:56989725-56989747 GGCCCTGGAGCGGGAGGTGCGGG + Intronic
1138482741 16:57314621-57314643 GCCTCTGGGGAGGGAGGTAAAGG + Intergenic
1138545313 16:57715726-57715748 GCCCTGGGGGAGGGCAGTGTCGG - Intronic
1139230600 16:65278716-65278738 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1139655376 16:68384089-68384111 GCACCTAGGCAGGGAAGGGCAGG + Intronic
1139943720 16:70624248-70624270 GCTCCTGGGGAAGGAGGTTCTGG + Intronic
1139952744 16:70680052-70680074 GCCCCTGGCGAGGCAAGCGCGGG + Exonic
1140281015 16:73555486-73555508 CCCACTGGGGAGGGAAGCGGAGG - Intergenic
1140475607 16:75238062-75238084 GCACCTGGGGAGGGGAGGGCTGG - Intronic
1141377588 16:83546225-83546247 GCCTCTGAGAAGGGAAGAGCTGG - Intronic
1141564421 16:84891758-84891780 GCCCCTGGGGAGGGCAGGGATGG + Intronic
1142353643 16:89591074-89591096 AGGCCTGGGGAGGGGAGTGCAGG + Intronic
1142425537 16:90000460-90000482 GCTCCTGGAGAAGGAAGTACTGG + Intergenic
1142643858 17:1299860-1299882 GGCCCGGGGAAGGGAAGAGCAGG + Exonic
1143183263 17:4997139-4997161 GCCCCGCTGGAGGGAAGCGCCGG + Intronic
1143500636 17:7336670-7336692 GCCCCTGGGGATGCAGGTGGAGG - Exonic
1143532152 17:7511786-7511808 GGCACAGGGGAGGGAAGTGGAGG - Intronic
1143640205 17:8191759-8191781 GCACCTGGGGATAGTAGTGCTGG - Intergenic
1143742891 17:8966681-8966703 GCCCCTGGGGAAGGGAGTGAGGG + Intergenic
1144124067 17:12184328-12184350 GCCTCTGGGGAGGGAAGTGGGGG - Intergenic
1144574156 17:16418441-16418463 GCCCCCGGGCAGGGAAGTAGGGG - Intronic
1145971677 17:28959957-28959979 GGCTCTGGGGAGGGAAGTAGGGG - Intronic
1146475200 17:33157127-33157149 GACACTGAGGAGGGGAGTGCTGG - Intronic
1146517191 17:33498498-33498520 GCCCTGGGTGAGGGAAGAGCAGG + Intronic
1146652101 17:34613374-34613396 GCAGCGGGGGAGGGGAGTGCGGG - Intronic
1146656860 17:34639606-34639628 GGCTCAGGGGAGGGAAGGGCAGG + Intergenic
1147044381 17:37742686-37742708 GGCTTTGGGGAGGGAAGAGCGGG + Intronic
1147266211 17:39236538-39236560 GACCTTGGGGAGGGCAGAGCAGG - Intergenic
1147421574 17:40324472-40324494 GCCCCTGGGGATGGAGGAGTTGG + Intronic
1147562793 17:41519419-41519441 GGCCCTGGGGATGGGAATGCAGG + Exonic
1147692234 17:42323396-42323418 ACCCCTAGGAAGGGAAGGGCTGG - Intronic
1147725537 17:42564257-42564279 GCCCCAGAGGAGAGAAGTGGGGG + Intronic
1148157482 17:45432200-45432222 GGCCCTGGTGAGGGAAGAGGTGG - Intronic
1148775150 17:50091063-50091085 GACCCTGGGGAGGGACGAGCAGG + Intergenic
1150657140 17:67046650-67046672 TCCCCTGGGCAGGGCAGGGCAGG + Intronic
1151174710 17:72277757-72277779 GCCACTGGGAAGGGAATTGAAGG + Intergenic
1151450122 17:74193683-74193705 GCTCCTGGGGAGGGCAGAGGAGG - Intergenic
1151797021 17:76353415-76353437 GCACCTGGGGCGGGAGGCGCGGG - Intronic
1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG + Intronic
1152223620 17:79082560-79082582 GCCCCTGGCGTGGGATGCGCAGG + Intronic
1152551304 17:81031797-81031819 GCCGCTGGGGAGAGGAGGGCTGG - Intergenic
1152649857 17:81487894-81487916 GGGCCTGGGGAGGGATGCGCCGG - Intergenic
1152696517 17:81800322-81800344 GCCCCTGGGTAGTGATGTGGAGG + Intergenic
1152755224 17:82084415-82084437 GCCCCTCGGGAGGGAAGGGCAGG - Intronic
1152935856 17:83136318-83136340 GCCCGAGAGGAGGGAAGAGCCGG + Intergenic
1153409861 18:4781626-4781648 GCCCCTGGGGAAAGAAGTCCAGG + Intergenic
1154198254 18:12281672-12281694 GCCCCTGGGGCATGAAGTGGGGG - Intergenic
1155218387 18:23662789-23662811 GCCCCGGGAGAGTGAAGGGCCGG - Exonic
1155303171 18:24452058-24452080 CTCCCTGGGAAGGGAAGTCCAGG - Exonic
1157579597 18:48765625-48765647 CCCCATGGAGTGGGAAGTGCAGG + Intronic
1157605307 18:48922745-48922767 ACCCCTGGGGATGGGGGTGCCGG - Intronic
1158005506 18:52667712-52667734 TCCCCTGGAGGGGGAAGAGCTGG + Intronic
1158124683 18:54088003-54088025 GCTACTGGGGGTGGAAGTGCAGG + Intergenic
1159130859 18:64278764-64278786 GTCCCTGTGGTGGGACGTGCAGG + Intergenic
1159948006 18:74457867-74457889 GCCCGTGGGAAGGGGAGGGCTGG - Intronic
1160023900 18:75203961-75203983 GCCCGTGGGGGTGGAAGTGACGG + Intronic
1160225023 18:77005769-77005791 GCTGCTGGGGAGGGCAGTGCTGG - Intronic
1160241204 18:77124497-77124519 GCAGCTGGGGAAGGAGGTGCAGG - Intronic
1160329224 18:77977206-77977228 GCCCCGGGGGAGGCCAGTGGTGG - Intergenic
1160710088 19:547445-547467 ACCCCTGGGGTGGGCAGGGCAGG - Intronic
1160718369 19:586687-586709 GACCCTGGGGAGGGAATGGCAGG + Intergenic
1160772976 19:841302-841324 GCTCCTCAGGAGGGAAGGGCTGG - Intronic
1160798105 19:954957-954979 GCCCCTGGGGAGGGAGTTTCCGG + Intronic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1161138978 19:2636967-2636989 GCAGGTGGGGACGGAAGTGCAGG - Intronic
1161139431 19:2638736-2638758 TCCCCTGGGGAGGGGAGGGGAGG + Intronic
1161221522 19:3120248-3120270 GTCCCTGGGCAGGGGAGTGGCGG + Intronic
1161238983 19:3211370-3211392 GCCACTGGGGATGGAATGGCGGG + Intergenic
1161370961 19:3910738-3910760 AGCCCTGGGGAGGGAGGAGCTGG - Intronic
1161576396 19:5056850-5056872 GACCCTGGGGCGGGGAGTCCTGG + Intronic
1162029853 19:7912607-7912629 GACCCCGGGGTGGGAAGGGCGGG - Exonic
1162386229 19:10362020-10362042 GCCCCTGGGGATGTGGGTGCTGG - Intronic
1163109100 19:15147615-15147637 GCACCTGGGGTGGGAAGAGAAGG - Intergenic
1164555546 19:29248275-29248297 GTCCCTGGGGAAAGAAGAGCAGG + Intergenic
1164834996 19:31350507-31350529 GCCCCTGGCGGGGGATGGGCAGG - Intergenic
1165110013 19:33496855-33496877 GGCCCTGGTTAGGAAAGTGCAGG - Intronic
1165150586 19:33758016-33758038 GACCCTCGGCAGGGAAGAGCCGG + Intronic
1165157159 19:33795869-33795891 GCCGCGGGGGAGGGACGCGCTGG - Intergenic
1165229671 19:34379038-34379060 GCCTCTGGGCTGGGAAGAGCAGG + Intronic
1165423345 19:35732916-35732938 GGTCCTGGGGATGGAGGTGCTGG + Exonic
1165705935 19:37976219-37976241 GCCCCAGGGGAGGGTTGTCCTGG + Intronic
1165908050 19:39205598-39205620 GCTCCTGGGGTGGGAGTTGCAGG - Intergenic
1166136469 19:40780168-40780190 GCCGGTGGGGAGGGCAGGGCTGG + Intronic
1166295837 19:41888859-41888881 ACCCCTGGTGAGGGCAGGGCTGG + Exonic
1166695195 19:44847924-44847946 CCCCCTGGGGAGGGAGGGGCTGG + Intronic
1166758849 19:45212247-45212269 GCTCCTGGGCAGGGTAGTGGAGG - Intronic
1166812790 19:45524162-45524184 GCCCTTGGGGAGGTAAAGGCGGG + Intronic
1167299702 19:48671631-48671653 GGCCCTGGGGAGGGGAGGGAAGG + Intronic
1167622953 19:50568896-50568918 GCCCAGGGGCAGGGAAGTGAGGG + Intergenic
1167646756 19:50710194-50710216 GCACGTGGGGAGAGAAGTGCCGG + Intronic
1167671731 19:50857392-50857414 GACCCTGGGGAGCGAAGTGGAGG + Intronic
1167712308 19:51119937-51119959 GCCCCTGGGGAGAGAAGGAGAGG - Intergenic
1168149148 19:54435706-54435728 GGTCCTGGGGAGGGAAGAGGAGG + Intronic
1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG + Exonic
1168354549 19:55693045-55693067 GCCACTGGGCAGGGGAGGGCAGG - Intronic
925068824 2:950776-950798 GCCCCGGGCGAGGGAGGGGCCGG - Intergenic
925348690 2:3187406-3187428 GGCCTTGGGGAGGGGTGTGCTGG - Intergenic
925348717 2:3187465-3187487 GACCGTGGGGAGGGGCGTGCTGG - Intergenic
925352645 2:3212393-3212415 GCTCCTGGTGTGGGAAGAGCTGG - Intronic
925352952 2:3215053-3215075 GTTCCTGGGGCGGGAAGTCCAGG - Intronic
926311524 2:11679242-11679264 GCACCTTGGGAGGGGAGTGGTGG + Intronic
926464092 2:13167454-13167476 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
927093174 2:19727935-19727957 GCCCCTGGGGAAGGGTGGGCAGG - Intergenic
927638880 2:24834469-24834491 ACCCCTGGTGAGGGAGGGGCCGG - Exonic
928083987 2:28334321-28334343 GGGCCTGGGGAGGTAAGTGGAGG + Intronic
928173986 2:29021969-29021991 GCTCCTGGGGAGGGAGGCCCAGG + Intronic
928231134 2:29499893-29499915 ACCACTGGGGAGGGAAGAACAGG - Intronic
928931137 2:36625573-36625595 GCCCCTGGGTAGGGGACTACAGG + Intronic
929499563 2:42478683-42478705 GCCGCTGTGGAAGGCAGTGCAGG - Intronic
929594234 2:43166100-43166122 GTCCCTGGAGAGGGAAGGACAGG + Intergenic
929887745 2:45893699-45893721 GCCCATGAGGTGGGAAGAGCGGG - Intronic
929960449 2:46492386-46492408 GCGCTTGGTGAGGGAAGTGTGGG - Intronic
930685755 2:54306497-54306519 GCCACTGGGGAGAAAGGTGCAGG - Intergenic
931236941 2:60419858-60419880 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
931358285 2:61555976-61555998 TCAACTGGGGAGGGAAGGGCTGG - Intergenic
932239182 2:70143658-70143680 ACTCATGGGGAGGGCAGTGCTGG - Intergenic
932599468 2:73113403-73113425 GCCCCTGCGGGGGAAAATGCCGG + Intronic
933163731 2:79053634-79053656 GCTCCTGGGGAGGGAGGTTCTGG - Intergenic
933886245 2:86720909-86720931 GCCTCAGGGGAGGCAAGGGCCGG - Intronic
933923935 2:87075797-87075819 GCCTCAGGGGAGGCAAGGGCCGG + Intergenic
933975594 2:87506900-87506922 GCTCCTGAGGAGGGGAGAGCAGG - Intergenic
933977157 2:87520755-87520777 GCCTTTGGAGAGGGGAGTGCAGG + Intergenic
934723930 2:96602763-96602785 GGTCCTGGGGAGGGATTTGCTGG + Exonic
936048343 2:109203682-109203704 GGCCCAGGGGGTGGAAGTGCAGG - Intronic
936316660 2:111430050-111430072 GCCTTTGGAGAGGGGAGTGCAGG - Intergenic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
937316288 2:120933873-120933895 GCCCCAGGGCAGGGCAGGGCAGG - Intronic
937362789 2:121240638-121240660 GCCCCTGGGAAGAGAGGTCCTGG - Intronic
937973724 2:127568394-127568416 GCCCTGGGGGAGGAAAGGGCAGG - Intronic
937975882 2:127581872-127581894 GCACCTGGGGAGGCAGGTGGGGG - Exonic
938051383 2:128175743-128175765 GCTCCTGGGAAGGGGAGGGCTGG - Intronic
938339003 2:130523068-130523090 GCGCCGGGGGAGGGATGCGCGGG + Intronic
938350835 2:130597682-130597704 GCGCCGGGGGAGGGATGCGCGGG - Intronic
938411094 2:131065237-131065259 GCCCATGGGGAGTGAAATGTGGG + Intronic
939026544 2:137020609-137020631 AGCTCTGGGGAGGGATGTGCAGG - Intronic
941591421 2:167424967-167424989 GCAGCTGGGGAAAGAAGTGCAGG - Intergenic
942446534 2:176082136-176082158 GCCCCCGGGGAGGCCAGAGCAGG + Intronic
946415185 2:219536664-219536686 GCGGCTGGGGAGGAAGGTGCCGG + Intronic
947111136 2:226721004-226721026 GCCCCTGGGAAGGGAGCTTCTGG + Intergenic
947316274 2:228862643-228862665 GCCCCTGGGGAGAAATGTGTGGG + Intronic
948112637 2:235469062-235469084 GTCACTGGGAAGGGAAGTGGAGG + Intergenic
948711727 2:239829298-239829320 GACCCTGGGAAGGGAAATGGAGG + Intergenic
948780876 2:240320836-240320858 GCCCCTGGGGGTGGCAGTGCTGG - Intergenic
948845505 2:240681118-240681140 GCCTCTGGGCACGGAAGAGCAGG + Intronic
948848348 2:240693612-240693634 GCCTCTGGGCACGGAAGAGCAGG - Intronic
948890697 2:240905694-240905716 GCCCCTGGGGTGGGAAGCCGTGG + Intergenic
1169124316 20:3116132-3116154 GCCGCTGGGGAGGGAATGGGGGG - Intronic
1169125306 20:3122987-3123009 GTATCTGGGGAGAGAAGTGCAGG + Intronic
1170612878 20:17928863-17928885 GCCCCTGGGGAGGGTGGCTCGGG - Intergenic
1171298503 20:24039493-24039515 GCCCCTGGTGAGGGCCCTGCAGG + Intergenic
1171961310 20:31496964-31496986 GGCCAGGGGGAGGGAACTGCTGG + Intergenic
1172064019 20:32207087-32207109 GCCACTGAGGAGGGAACTACAGG + Intronic
1172121343 20:32600776-32600798 GGCCCTGGGGAGTGGAGTCCTGG + Intronic
1172135036 20:32681150-32681172 GCTCCTGGGGTGGGCAGTGTTGG - Intergenic
1172501689 20:35432396-35432418 GCCCCCTGGGTGGGAAGTGGAGG + Intergenic
1172563105 20:35906646-35906668 GCTGCTGGGAAGGGAAGTGAAGG + Intronic
1172750211 20:37245473-37245495 GCCCCTGAGGAAGGCAGGGCAGG - Intergenic
1172781348 20:37438541-37438563 GCCGGTGGGGCGGGAAGGGCAGG + Intergenic
1173454591 20:43192035-43192057 GCACCTGGGCAGGTAAGTCCTGG - Intergenic
1173581385 20:44149189-44149211 GCCACTGGGGTGGGAAGGGAGGG - Intronic
1173644789 20:44626596-44626618 GCCCCTGGGAAGGGAAGAAAGGG + Exonic
1173747163 20:45446624-45446646 AGCCCTGAGGAGGGAAGTGTGGG - Intergenic
1173823677 20:46034047-46034069 GAGCCTGGGAAGGGAAGCGCAGG - Intronic
1173860857 20:46282746-46282768 CCCCCGGGGGAGGGAAGGGTGGG + Intronic
1174168570 20:48602026-48602048 GCACCAGGGGAGGGAGGTGAAGG + Intergenic
1174294916 20:49539149-49539171 GCCTCTGTAGAGGGAAGTGGTGG + Intronic
1174305363 20:49610990-49611012 GCCTCTGGGGAGGGTGGAGCTGG + Intergenic
1175394482 20:58649570-58649592 GGCCCTGGGGAGGGAAATTCGGG - Intergenic
1175699844 20:61129013-61129035 GCTCATGTGTAGGGAAGTGCAGG - Intergenic
1175790893 20:61739218-61739240 TCCCATGGGGAGGGAGTTGCGGG + Intronic
1175824858 20:61931307-61931329 GATCGTGGAGAGGGAAGTGCAGG - Intronic
1175903123 20:62367633-62367655 GCCCCTGGGCTGGGAGGAGCTGG - Intergenic
1175929945 20:62489132-62489154 GTCCCTGGAGATGGACGTGCTGG + Intergenic
1175980131 20:62734556-62734578 ACCCCTGGGGAGCGAGGAGCAGG + Intronic
1176000814 20:62830498-62830520 GGCCCTGGGGAAGGAGGTCCTGG - Exonic
1176109281 20:63404214-63404236 GCCCCATGGGAGGAAAGAGCAGG + Intergenic
1176117419 20:63439165-63439187 GCCCCAGGGCAGGGCAGGGCAGG - Intronic
1176212287 20:63930790-63930812 GCCCCTGGAGAGGGAGGCGCAGG - Intronic
1178404863 21:32315855-32315877 GGCCCAGGGGAGGGAGGGGCTGG - Intronic
1178503565 21:33145370-33145392 GCCCCTGGGGAGGGGAGAAGAGG - Intergenic
1178576572 21:33797746-33797768 GACCCTGGGGAAAGAAGAGCTGG - Intronic
1178707994 21:34890027-34890049 GCCCTGGGGGAGGGAGGAGCGGG - Intronic
1179033245 21:37738236-37738258 GCCACAGGGCAGGGAAGTACAGG - Intronic
1179134803 21:38670011-38670033 GCCTCTGGGGAGTGAGGAGCTGG - Intergenic
1179247264 21:39644840-39644862 GACCCTGGGGAGGCCAGTGCTGG - Intronic
1180149988 21:45942497-45942519 TCCCCAGGGGAAGGAAGTGCCGG - Intergenic
1180161182 21:45999354-45999376 GCCCTGGGGGTGGGAGGTGCCGG + Intronic
1180198687 21:46212244-46212266 AGCCCTGGGGCGGGCAGTGCTGG + Intronic
1181062219 22:20286966-20286988 GAAGCAGGGGAGGGAAGTGCTGG + Intergenic
1181082991 22:20426279-20426301 GCCTCTGGCAAGGGAAGAGCAGG + Exonic
1181427941 22:22856175-22856197 GGTCCTGGGGAGGGGAGAGCTGG + Intronic
1182281335 22:29219313-29219335 GCCCATGGGGAGGGGAGGGGAGG - Intronic
1182961144 22:34476393-34476415 GTCCCTGTGGCTGGAAGTGCAGG + Intergenic
1183737453 22:39651679-39651701 GCCCCTGGCAAGGACAGTGCCGG - Intronic
1183951276 22:41354462-41354484 GGCCCTGGGCAGGGCAATGCTGG + Intronic
1184207508 22:43014688-43014710 CCTGCTGGAGAGGGAAGTGCAGG - Intronic
1184253510 22:43274406-43274428 GTCCCTGTGGAGGGCAGGGCAGG - Intronic
1184459041 22:44626857-44626879 TCACCTGAGGAGGGAAGAGCTGG - Intergenic
1184540315 22:45118787-45118809 GCCCCTAGGAATGGAATTGCTGG - Intergenic
1184545492 22:45164427-45164449 GACCCTGGGGAGGGAGGTGCGGG + Intronic
1184660272 22:45962439-45962461 GCCCCTGGAGGGGGAGGAGCTGG - Intronic
1184679419 22:46062079-46062101 GGCCCCGGGGCGGGAGGTGCGGG - Intronic
1185223138 22:49639252-49639274 GCTCCTGGGGAGGGAGGGGCAGG + Intronic
1185417898 22:50720165-50720187 TCCCCTGCGGACGGAAGGGCCGG - Intergenic
949190396 3:1243275-1243297 GCTCCTGGGGAAGGAGGTTCTGG + Intronic
950397977 3:12748828-12748850 GTCCCTGGGGTGGGAAGGGTGGG - Intronic
950449807 3:13059201-13059223 GCCCCTGGGGTGGGGCCTGCTGG - Intronic
950676288 3:14556170-14556192 GGGCCTGGGGAGTGCAGTGCCGG + Intergenic
953190737 3:40685094-40685116 GCCCCTGGGGAGTGGAATGAGGG - Intergenic
953247365 3:41206809-41206831 TCCCCTGTGTAGGAAAGTGCTGG + Intronic
953319927 3:41962371-41962393 GAGACTGGGGCGGGAAGTGCTGG + Exonic
953725466 3:45394111-45394133 GCCCATGGGGAGGGGAGGGAGGG + Intronic
954553883 3:51503504-51503526 GCCCCAGGGAAGGGAATTGCTGG - Intergenic
954590500 3:51778052-51778074 GCCCCTGGGGAAGCCAGAGCAGG - Intergenic
954611541 3:51947063-51947085 GCCCAAGGGCTGGGAAGTGCAGG + Intronic
954877183 3:53809876-53809898 GCCCCTGGCGAGCGCAGCGCCGG + Intronic
956725359 3:72152428-72152450 GCCTCTCTGCAGGGAAGTGCAGG - Intergenic
957137748 3:76310792-76310814 GCCACTTGGGTGGGTAGTGCTGG - Intronic
957295234 3:78326049-78326071 GCTCCTGGGGGAGGAAGTTCTGG - Intergenic
958955861 3:100465575-100465597 GCCCGTGGGGAAGGAATTGAGGG + Intergenic
959078844 3:101779290-101779312 GCCCCCGGAGAGCGAAGGGCGGG + Intronic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
962263684 3:133930779-133930801 GGCCCATGGGAGGGAAGTGGGGG - Intergenic
962739213 3:138350447-138350469 GCCTCTGGGGAGGGAGGTGTTGG + Intronic
962838118 3:139206508-139206530 GCCTCTGGGGAGGTTAGTGATGG + Intronic
964497670 3:157310904-157310926 GGCCCAGAGGAGGGAAGTACCGG + Intronic
964630142 3:158801687-158801709 GACGCTGGGGAGGGCAGTGCTGG + Intronic
965242061 3:166214210-166214232 GCTCATGAGGAGGGAGGTGCAGG + Intergenic
965942190 3:174198760-174198782 ACCCCAGGGGAGAGAAGTGTGGG - Intronic
967234041 3:187367572-187367594 GCCCAAGGGCAGAGAAGTGCGGG - Intergenic
967658108 3:192074549-192074571 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
968462785 4:733574-733596 GCCCCCAGGGAGGACAGTGCAGG - Intronic
968489515 4:882498-882520 CCACATGGGGAGGGAAGGGCGGG + Intronic
968553426 4:1235881-1235903 GCACCTGGGGCCGGCAGTGCGGG + Intronic
968660133 4:1795418-1795440 GCCCCGGGGGAGGGGTGGGCGGG - Intronic
968712147 4:2126931-2126953 GCGCATGGGGAGGGGAGTGCAGG + Intronic
968876210 4:3269203-3269225 GGCCCTGAGGAGGGGAGGGCAGG + Intronic
969216021 4:5723122-5723144 GCACCTGGGGATGGAGGAGCCGG - Intronic
969527763 4:7712714-7712736 GACCCTGGGGTGGGAAGAGGAGG - Exonic
972030454 4:34450746-34450768 ACTTCTGGGGAGGGAAGTGAGGG + Intergenic
974924721 4:68282840-68282862 CCCACTGGGGAGGTAAGTGAAGG + Intergenic
976534825 4:86199580-86199602 GCCACTGGGAAGGGGCGTGCAGG + Intronic
982157127 4:152534911-152534933 GCCCCGGGAGAGGGAATTGAGGG - Intronic
982752581 4:159179747-159179769 GCTCCTGGGCAGGGCAGAGCTGG + Intronic
984959262 4:185078629-185078651 GTCCCTTGGGAGGCAAGTGAGGG + Intergenic
985194518 4:187414247-187414269 GCCCCTGGGGAGGAACATGAGGG - Intergenic
985389872 4:189482931-189482953 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
985527913 5:416367-416389 GCCACTGAGCAGGGGAGTGCTGG + Intronic
985539010 5:479215-479237 GCCCCTGGGGAGGTCAGGGCAGG + Intronic
985621945 5:960396-960418 ACCCCAGGGGCAGGAAGTGCTGG - Intergenic
985729723 5:1540384-1540406 GGCCCTGGGGTGGGCAGGGCAGG + Intergenic
986608469 5:9545654-9545676 GCACCTGGCTAGGGAAGTGGAGG + Exonic
986624033 5:9706788-9706810 GCTGCTGGGGAGGGAGCTGCAGG + Intronic
986905772 5:12492044-12492066 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
990560705 5:56980454-56980476 GAACCGGGGAAGGGAAGTGCTGG - Intergenic
992443794 5:76817118-76817140 TCCCCTGGGGAGGGACCTTCAGG + Intergenic
996496318 5:124161322-124161344 GCCCTGGGGGAGGGGAGTGGTGG + Intergenic
996571400 5:124935983-124936005 GCCTCTGGGGAGGGAAGGGGGGG - Intergenic
997527197 5:134561019-134561041 GCCCCTGGAGAGCCAAGTGGGGG - Intronic
998155155 5:139781993-139782015 GCCCCTGGGCAGGTAAATCCAGG - Intergenic
998319618 5:141216436-141216458 GGCACTGGGGAGGGAAGTTGGGG - Exonic
998823407 5:146077183-146077205 GCCCCTTGTGAGGGGAGGGCAGG - Intronic
999135583 5:149316470-149316492 GCCTCTGGGAAGGAAAGTGATGG - Intronic
999699043 5:154211240-154211262 GGGGCTGGGGAGGGAAGAGCAGG + Intronic
1001415559 5:171542844-171542866 GCCCCTGGCCTGGGAAGGGCTGG + Intergenic
1001774984 5:174321772-174321794 GCCCCTGGAGAAGGAGGTGAGGG + Intergenic
1002105769 5:176878832-176878854 GGACTTGGGGAGGGGAGTGCAGG + Intronic
1002310787 5:178312586-178312608 GTCCTTGGGGAGGGAGGTGCCGG - Intronic
1002533701 5:179864581-179864603 GATCCTGGGGAGGGGGGTGCTGG + Intronic
1003645662 6:7911053-7911075 GCCCCTGGGGAAAGGGGTGCGGG - Intronic
1004271085 6:14196139-14196161 TCCCCTGGGGTGGGAAGGGTGGG - Intergenic
1004702536 6:18092628-18092650 CCCCCTGGGAAGTGAAGTACAGG + Intergenic
1005111611 6:22288205-22288227 GTCCCTGGGCTGGGAGGTGCCGG + Intronic
1005997572 6:30940722-30940744 GCCCCAGTGGAGGGAAGTGAGGG - Intergenic
1006028580 6:31162798-31162820 CCTCCTGGGGAGGGAAGGGAAGG - Exonic
1007382971 6:41502635-41502657 GCCTCTGGGAAGGGAAGGGAAGG + Intergenic
1007405494 6:41633812-41633834 TCCCCTGGGGAGGGACGTGGTGG + Intergenic
1007581515 6:42962986-42963008 ACCCCTGGGGAGGGGAGAGATGG + Intronic
1007716701 6:43860317-43860339 GCCCCTTGTGAGGGACGAGCTGG - Intergenic
1008038399 6:46771670-46771692 GCCACTGAGCTGGGAAGTGCTGG - Intergenic
1008513364 6:52297592-52297614 GCCCCTGGAGGAGGAAGTGCTGG - Intergenic
1009030934 6:58057208-58057230 TGCCCTGGGGAGGGATGTGGAGG + Intergenic
1009206788 6:60811669-60811691 TGCCCTGGGGAGGGATGTGGAGG + Intergenic
1009343605 6:62588194-62588216 GCCCCTGGGGAAGGTGGTTCTGG - Intergenic
1009524558 6:64728085-64728107 CCCCTTGAGGAGGGGAGTGCAGG + Intronic
1011335629 6:86256560-86256582 GCACCTGGGGAGCGGAGTGCTGG + Intergenic
1013576013 6:111483723-111483745 GCCTCGCGGGAGGGAAGGGCGGG + Intergenic
1014240043 6:119007409-119007431 GCACTTGGGGAGGGAATTGTGGG - Intronic
1015974200 6:138773073-138773095 GCCTCTGGAGAAGGAATTGCAGG - Intronic
1016518803 6:144925414-144925436 GCCCCTGGGGGAGGAGGTTCTGG - Intergenic
1016705860 6:147106959-147106981 GACCCTAGGGAGAGAAGAGCCGG - Intergenic
1016896986 6:149063116-149063138 GTCCCTGGGGAGGGAGTGGCAGG - Intronic
1016981083 6:149854786-149854808 GCCCCTGTGGAGGAAAGTGATGG - Intronic
1017319651 6:153074974-153074996 GCATCCGGGGAGGGCAGTGCAGG - Intronic
1017375891 6:153767509-153767531 GCCCCTGCAGAGAGAATTGCCGG + Intergenic
1017684794 6:156901459-156901481 GCGCCTGGGGTGGGAGGTGCGGG - Exonic
1018084499 6:160290039-160290061 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1018160887 6:161041323-161041345 GCCCCTGGGGGCTGGAGTGCAGG + Intronic
1018970607 6:168526108-168526130 GGCCCAGGGGCGGGAAGGGCAGG - Intronic
1019062374 6:169265682-169265704 GCACTTGAGGAAGGAAGTGCAGG + Intergenic
1019174012 6:170150605-170150627 GCACCTGGGGCGGGCACTGCTGG + Intergenic
1019214792 6:170436128-170436150 GGCCCTTGGGAGGTGAGTGCTGG - Intergenic
1019396697 7:823812-823834 CGCCCTGGGGAGGGAGGAGCAGG + Intronic
1019485154 7:1285907-1285929 GGATCTGGGGAGGGAGGTGCAGG - Intergenic
1019715967 7:2539533-2539555 GGCACTGGGGAGGTGAGTGCTGG - Exonic
1019728632 7:2617355-2617377 GGGCCTGGGAAGGGAAGGGCTGG - Intergenic
1020033771 7:4951431-4951453 GCCATTGGGGGGTGAAGTGCAGG - Intronic
1020794212 7:12661809-12661831 GCTCCTGGGGAAGGAGGTCCTGG - Intergenic
1021622757 7:22564479-22564501 GCCCCTTTGGAGGGAACTACAGG + Intronic
1022306789 7:29154161-29154183 GCCCCTGGGGAGGAGGGTGGTGG + Intronic
1022471814 7:30686276-30686298 GCCCTTGGGGAGGCATGGGCTGG - Intronic
1022967084 7:35483793-35483815 GCCCCAAGGCAGGGAAGTTCTGG + Intergenic
1023798843 7:43815459-43815481 TCCCCTGGGGAGGGACCGGCAGG - Intergenic
1023875500 7:44284222-44284244 CCCCCTGGGGAGGAAAATGGGGG + Exonic
1023938415 7:44755566-44755588 GGCCTTGGGGAGGGACATGCAGG - Intronic
1024607175 7:51031539-51031561 GTCCGTGGGGAGGGTTGTGCAGG + Intronic
1025017291 7:55449558-55449580 GCGCCTGGGGAGGGAAGGCTGGG - Intronic
1025270530 7:57508713-57508735 GCTTCTGGGGAGGGAAGCGAGGG - Intergenic
1027219106 7:76202543-76202565 GCCCCTAGGGAGGCAGGAGCTGG + Intronic
1027858289 7:83541105-83541127 GAGTCTGGGGAGGGAAGTTCTGG + Intronic
1027931860 7:84546880-84546902 GCAGGTGGGCAGGGAAGTGCTGG - Intergenic
1029271871 7:99381857-99381879 GCCCCTGGGCAGGGCAGTGACGG + Intronic
1029457327 7:100677854-100677876 GCCCCTGAGGCAGGAAGTGTGGG - Intronic
1030032869 7:105385628-105385650 GGCCCTGGGGAGGAATGGGCTGG - Intronic
1030111325 7:106029598-106029620 CCCCCTGGGAAGTGAAGTGAAGG + Intronic
1030523655 7:110628471-110628493 GCCCATGTGAAGGGAAGAGCTGG - Intergenic
1032011565 7:128351175-128351197 GCCCCAGGGGAGGGGAGCTCCGG + Exonic
1032474454 7:132202705-132202727 TCTCCTGGGCAGGGCAGTGCTGG + Exonic
1032540731 7:132700715-132700737 TCCCTTGGGGAGGGAATTGGGGG - Intronic
1032555935 7:132835084-132835106 GCCACTGGGGAGGGAGGCTCAGG - Intronic
1033138488 7:138804166-138804188 GCCCATGGGGAGTGATGAGCCGG - Exonic
1033550718 7:142445230-142445252 AACCCTGGGGAGGGGAGGGCAGG + Intergenic
1034576412 7:152002695-152002717 TCCCCTGGGGAGGCAAGAACAGG - Exonic
1034858502 7:154576687-154576709 GCCCCTGTGGATGGATGCGCGGG + Intronic
1035034420 7:155885743-155885765 AGCCCTGGGAAGGGAAGGGCAGG - Intergenic
1035230755 7:157464133-157464155 GCCAGTGGGGAGGGAAGGGAGGG - Intergenic
1035741286 8:1930238-1930260 GGCCGTGGGGAGGGTGGTGCAGG - Intronic
1036197526 8:6733350-6733372 ACCCCTGGTGAGGGGAGGGCAGG - Intronic
1036210947 8:6841053-6841075 GCCCGTGGGGTGGGCAGGGCAGG + Intergenic
1036287056 8:7452219-7452241 AGCCCTGGGGAAGGTAGTGCAGG - Intronic
1036334425 8:7859303-7859325 AGCCCTGGGGAAGGTAGTGCAGG + Intronic
1036648397 8:10626090-10626112 GCCCCTGTGGAGGAAGGGGCAGG + Intronic
1037756948 8:21716533-21716555 GCCCCTGGGAAATGAAGTCCTGG + Intronic
1037882766 8:22580922-22580944 GCAACTGGGGAGGCAAGAGCCGG - Intronic
1038128722 8:24704223-24704245 GCCCCTGGGAAAAGAAGTCCTGG - Intergenic
1038450604 8:27636793-27636815 GCTGCCAGGGAGGGAAGTGCTGG - Intronic
1038452075 8:27646256-27646278 ACCCATGGGAAGGGAAGTGGCGG - Intronic
1038458068 8:27691509-27691531 GCCCCTGTGGAGCCAAGGGCAGG + Intergenic
1038477298 8:27877183-27877205 GGGCCTGGGCAGGGAAGGGCTGG - Intronic
1038484099 8:27921493-27921515 GTCCTTGGGGAGGGGCGTGCAGG + Intronic
1038663775 8:29519921-29519943 GCCAGTGGGGAGGGAGGTGAGGG - Intergenic
1038862303 8:31401211-31401233 GGAGTTGGGGAGGGAAGTGCTGG + Intergenic
1038927710 8:32158699-32158721 GTCCCTGGGGAGGGAAGCAGAGG - Intronic
1039424221 8:37472561-37472583 GCCACTGGGGGGAGAAGTGGAGG - Intergenic
1039430272 8:37520199-37520221 TCCCCTGGAGTGGGGAGTGCAGG - Intergenic
1039794401 8:40899994-40900016 GCCCCAGGGGAGGCCAGGGCAGG - Intergenic
1040533191 8:48282603-48282625 GCCTCTGGGGAGCCCAGTGCAGG - Intergenic
1040581151 8:48699655-48699677 CCCCCAGGTGAGGGAGGTGCAGG - Intergenic
1041319991 8:56603098-56603120 GCCTCTGGGGAGGTAAGAGTGGG - Intergenic
1044124541 8:88441008-88441030 TCCTCTGGGGAGGGAAGAGTGGG + Intergenic
1044822051 8:96161212-96161234 GCCCCGGAGGAGGGAAGCGGCGG + Intergenic
1047214221 8:122863724-122863746 GCTCCTGGGGAGGGATTGGCAGG - Intronic
1048443488 8:134476933-134476955 CCCCCTGGGGTGGGCAGTGTGGG - Intergenic
1049081377 8:140445816-140445838 GCCCCTGGGCAGTGAGGTGGTGG + Intronic
1049259139 8:141629476-141629498 GGGCCTGTGGAGGGAATTGCCGG + Intergenic
1049361672 8:142214986-142215008 GCCCCTGAGGTGGGAAGCGCTGG - Intronic
1049410680 8:142472534-142472556 GCCCCTGGGGTCCGCAGTGCAGG - Intronic
1049442691 8:142616511-142616533 GCCCCTGGTCATTGAAGTGCTGG - Intergenic
1049488527 8:142878916-142878938 GCCCCTGTGGTGGGCAGTGAGGG - Intronic
1049493422 8:142916936-142916958 GCCCCTGTGGTGGGCAGTGAGGG - Intronic
1049528597 8:143142359-143142381 CCTCCTGGGGAGGGAAGGACAGG - Intergenic
1049542523 8:143215031-143215053 GTCCCTGGGCAGGGACTTGCAGG - Intergenic
1051866342 9:21687440-21687462 GCTCCTGATGAGGAAAGTGCTGG + Intergenic
1051889056 9:21924724-21924746 GGCCCTGGGTAGGGAAGGGAAGG - Intronic
1053463061 9:38285422-38285444 GGCCCTGGGGCAGGACGTGCTGG - Intergenic
1054761967 9:69012330-69012352 GCCCCTGGGGAGGGGGGAGGGGG + Intergenic
1056262509 9:84862900-84862922 GGCCCTGGGGTGGGGAGGGCAGG + Intronic
1056588312 9:87944018-87944040 GCGCCAGGGGAGGGAAGGGCTGG - Intergenic
1056682211 9:88729618-88729640 CGCACTGGGGAGGGAAGTGCAGG + Intergenic
1056708022 9:88968125-88968147 AGCGCTGGGGAGGGAAGAGCTGG - Intergenic
1056775018 9:89505581-89505603 GCCCCTGCCCAGGGAAGTGCAGG + Intergenic
1057878922 9:98778524-98778546 GCCCCAGGAGAGGGGAGGGCAGG - Intronic
1057892496 9:98880046-98880068 GCCCCTGGAGAGGGGAATGTGGG + Intergenic
1058413732 9:104763855-104763877 GCCCCTGGAGAAGGAAGGGGAGG - Intergenic
1059314252 9:113410551-113410573 GGACCTGGGGAGGGGCGTGCGGG - Intronic
1059316571 9:113430691-113430713 GCCACTGGGCAGGGAATTCCAGG - Intergenic
1059574619 9:115475602-115475624 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
1060784945 9:126443869-126443891 GGCGATGGGGAGGGAAGGGCCGG - Intronic
1061208088 9:129175947-129175969 GCCCCGGGGGAGGGAGGGGCCGG - Exonic
1061371644 9:130200850-130200872 GGCCGTGGGGAGGGGAGGGCTGG + Intronic
1061481908 9:130901633-130901655 GCCCCTGGGGAGGGTGGGGCCGG + Intergenic
1061709852 9:132480158-132480180 GCTCCTGGGGAGGGCGGTCCAGG - Intronic
1061799612 9:133106745-133106767 ACTCCTGGGGCGGGAAGAGCAGG + Exonic
1061822655 9:133237065-133237087 ACCCCTGGAGCGGGAAGTGCTGG + Intergenic
1062191389 9:135249615-135249637 GGCCCTGGGGAGAGAAGAGAAGG + Intergenic
1062231791 9:135485999-135486021 GCCCCTGTAGAGGGCAGTGACGG + Exonic
1062236651 9:135513483-135513505 GCCTCTGGAGAGGGGAGTGCTGG - Intergenic
1062332713 9:136051576-136051598 GTCCCACGGGAGGAAAGTGCGGG + Intronic
1062365063 9:136204532-136204554 GCCCTTGGGGAGGGTGGTTCAGG + Intronic
1062376998 9:136266346-136266368 TCCTCTGGGGAGGGAGGTGGGGG + Intergenic
1062444283 9:136587221-136587243 GCCCGTGGGGAGGGGGGTGCGGG - Intergenic
1062482660 9:136759589-136759611 GCCCTGGGGGAGGGCAATGCGGG - Intergenic
1062503218 9:136860071-136860093 GCCCCTGGGGATGGGTGGGCAGG + Intronic
1062600695 9:137317501-137317523 GCCCCTGGGGATGGAGGACCTGG - Intronic
1186112114 X:6269498-6269520 GCCCCTTGGGAGGGAAATTTGGG - Intergenic
1187182424 X:16955604-16955626 GGCCATGTGGAGGGAACTGCAGG - Intronic
1190164576 X:48062485-48062507 GCCCTTGGGGAGGCAGGGGCAGG + Intronic
1193908449 X:87271684-87271706 GAAGCTGGGAAGGGAAGTGCAGG + Intergenic
1195343410 X:103926267-103926289 GCTCCAGGGGAGGGGAGTGGTGG + Intronic
1195908679 X:109868681-109868703 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1196006581 X:110843553-110843575 CCCTGTGGGCAGGGAAGTGCTGG + Intergenic
1196219538 X:113096136-113096158 GAGCCTGGGGAGGGTAGTGGGGG + Intergenic
1196572497 X:117281403-117281425 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
1197725120 X:129771103-129771125 GTCCCAGGGGAGGGAAGAGCTGG - Intergenic
1201483991 Y:14472302-14472324 GCCCCTTGGGAGGGAAATCTGGG + Intergenic