ID: 1133156586

View in Genome Browser
Species Human (GRCh38)
Location 16:3880509-3880531
Sequence CGCCGCCGCCGCCGGGCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 5, 2: 31, 3: 131, 4: 676}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133156569_1133156586 14 Left 1133156569 16:3880472-3880494 CCACCCCCCGTTCCGCCGCCGCC 0: 1
1: 0
2: 13
3: 152
4: 1181
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156568_1133156586 15 Left 1133156568 16:3880471-3880493 CCCACCCCCCGTTCCGCCGCCGC 0: 1
1: 0
2: 1
3: 26
4: 327
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156566_1133156586 17 Left 1133156566 16:3880469-3880491 CCCCCACCCCCCGTTCCGCCGCC 0: 1
1: 0
2: 5
3: 78
4: 745
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156565_1133156586 18 Left 1133156565 16:3880468-3880490 CCCCCCACCCCCCGTTCCGCCGC 0: 1
1: 0
2: 2
3: 46
4: 619
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156573_1133156586 8 Left 1133156573 16:3880478-3880500 CCCGTTCCGCCGCCGCCGCCGCC 0: 1
1: 16
2: 293
3: 1845
4: 2996
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156575_1133156586 2 Left 1133156575 16:3880484-3880506 CCGCCGCCGCCGCCGCCGCTGCC 0: 63
1: 1208
2: 1776
3: 3026
4: 6001
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156571_1133156586 10 Left 1133156571 16:3880476-3880498 CCCCCGTTCCGCCGCCGCCGCCG 0: 1
1: 2
2: 37
3: 208
4: 986
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156578_1133156586 -7 Left 1133156578 16:3880493-3880515 CCGCCGCCGCTGCCGCCGCCGCC 0: 31
1: 1156
2: 1688
3: 2848
4: 5616
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156564_1133156586 19 Left 1133156564 16:3880467-3880489 CCCCCCCACCCCCCGTTCCGCCG 0: 1
1: 0
2: 7
3: 55
4: 640
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156576_1133156586 -1 Left 1133156576 16:3880487-3880509 CCGCCGCCGCCGCCGCTGCCGCC 0: 34
1: 1171
2: 1665
3: 2918
4: 5848
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156570_1133156586 11 Left 1133156570 16:3880475-3880497 CCCCCCGTTCCGCCGCCGCCGCC 0: 1
1: 6
2: 55
3: 364
4: 2444
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156574_1133156586 7 Left 1133156574 16:3880479-3880501 CCGTTCCGCCGCCGCCGCCGCCG 0: 1
1: 35
2: 242
3: 512
4: 1289
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156579_1133156586 -10 Left 1133156579 16:3880496-3880518 CCGCCGCTGCCGCCGCCGCCGCC 0: 53
1: 1174
2: 1692
3: 2810
4: 5585
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156567_1133156586 16 Left 1133156567 16:3880470-3880492 CCCCACCCCCCGTTCCGCCGCCG 0: 1
1: 0
2: 1
3: 27
4: 326
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156572_1133156586 9 Left 1133156572 16:3880477-3880499 CCCCGTTCCGCCGCCGCCGCCGC 0: 1
1: 1
2: 85
3: 408
4: 1225
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156563_1133156586 25 Left 1133156563 16:3880461-3880483 CCGCGGCCCCCCCACCCCCCGTT 0: 1
1: 0
2: 6
3: 93
4: 911
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156562_1133156586 28 Left 1133156562 16:3880458-3880480 CCGCCGCGGCCCCCCCACCCCCC 0: 2
1: 4
2: 36
3: 479
4: 4798
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676
1133156577_1133156586 -4 Left 1133156577 16:3880490-3880512 CCGCCGCCGCCGCTGCCGCCGCC 0: 31
1: 1157
2: 1667
3: 2841
4: 5581
Right 1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG 0: 1
1: 5
2: 31
3: 131
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133156586 Original CRISPR CGCCGCCGCCGCCGGGCTCC GGG Exonic
900082632 1:869946-869968 CACAGGCGCCGCCAGGCTCCCGG - Intergenic
900186749 1:1336470-1336492 CGGAGCAGCCGCCGGGCCCCGGG - Exonic
900187083 1:1337630-1337652 CGCCCAGGCCGCCAGGCTCCTGG + Intronic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900310325 1:2030311-2030333 GGCAGCTGCCGCCGGGCGCCAGG - Exonic
900342230 1:2194659-2194681 CCGCGCCCCCGCCCGGCTCCCGG + Intronic
900435537 1:2629019-2629041 CTCCGCCTCCGCCGGACTCCCGG - Intronic
900438823 1:2643443-2643465 AGCCGCCTCCTCTGGGCTCCGGG + Intronic
901526016 1:9823868-9823890 CGCCGCCGCCGCCGTGACGCTGG + Exonic
902585883 1:17438488-17438510 CGCCGCCGCCGCCTTCTTCCTGG + Exonic
902823184 1:18955963-18955985 CGTGCCCGCCGCCGGGCGCCGGG + Exonic
903072173 1:20731970-20731992 CCCCGCCCCTGCCCGGCTCCCGG + Intronic
903072201 1:20732055-20732077 CGCCGCCGCAGCCCCGCGCCTGG + Intronic
903184706 1:21622524-21622546 CAGCGCCGCCGCCGGGAGCCGGG - Intronic
903263415 1:22143109-22143131 CGCCGCCGCATCCCGGCTCTGGG - Intronic
903285823 1:22276050-22276072 TGCAGCCCCCACCGGGCTCCAGG + Intergenic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903777141 1:25800350-25800372 CGCCGCTGCCGCCGCCGTCCGGG + Exonic
903828623 1:26161887-26161909 CTTCGCCGCCGCCCGGCTCCGGG + Exonic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904719956 1:32500481-32500503 CGCCGCCGCCGCCCGCTACCAGG - Intronic
904744470 1:32702630-32702652 CCCCGCCGCGCCGGGGCTCCGGG + Exonic
904775134 1:32901554-32901576 CGCCGCCGCCGGTGGGCTGAGGG - Intergenic
905308632 1:37034928-37034950 CTCCGCAGACGGCGGGCTCCCGG - Intergenic
905399541 1:37691717-37691739 AGCCGCGGCCACCAGGCTCCAGG - Intronic
905449165 1:38046230-38046252 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
905626220 1:39491932-39491954 CGCCGCCGCCCCTGGGCCCGGGG - Exonic
905779087 1:40692035-40692057 TGTCGCCGCCGCCGCGCTCGTGG + Intronic
905862675 1:41361609-41361631 CGCCGCTGCCGCCGCTCCCCGGG - Intergenic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
906027223 1:42683230-42683252 CGCCGCCGCCGCCGCACACGTGG - Intronic
906197235 1:43936623-43936645 TGCGACCGCCCCCGGGCTCCCGG + Exonic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
907444572 1:54499530-54499552 GGCGGCGGCTGCCGGGCTCCGGG + Intergenic
908501194 1:64745165-64745187 CGCCGCCGCCGCCATCTTCCCGG - Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
910449524 1:87331554-87331576 CCCAGCCCCCGCCGGGCCCCGGG - Intronic
911527542 1:99004754-99004776 CGCCTCCGCCGCCGCGCCCCCGG - Exonic
911664732 1:100539689-100539711 CGCCGCCGCCGCCGCCTTCCCGG + Exonic
913518264 1:119623296-119623318 CGCCGCCGCCCCCGCGCCGCTGG + Exonic
914053733 1:144152767-144152789 CGCCGCCGCTGTCCGCCTCCCGG - Intergenic
914702992 1:150150510-150150532 CTCCCCCGCCCCCGGGCGCCGGG + Intronic
914713456 1:150235381-150235403 CGCCCACGCCGCCGGCCCCCAGG + Intronic
915629120 1:157138248-157138270 CGCCGTCCCCGCCAGGGTCCCGG + Intronic
915953612 1:160205863-160205885 CGCCTCCGCTGGCGGTCTCCCGG + Intronic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
916390051 1:164321454-164321476 CGCCGCCGCCGCCCTGCTCCTGG + Intergenic
916651769 1:166839898-166839920 CGCCACCGCCGCCGCGCCCCCGG - Intronic
917131010 1:171742087-171742109 CGCCCCCTCCGCCTGGCGCCAGG - Exonic
918015939 1:180632416-180632438 CGCCGCGGCCGGCCGCCTCCCGG + Intronic
919861176 1:201740265-201740287 CGCCGGAGCCTCCGAGCTCCTGG + Intronic
919892084 1:201982873-201982895 CGGCGGCGCCCTCGGGCTCCAGG - Exonic
920260518 1:204685190-204685212 AGCAGCCGCCTCAGGGCTCCTGG - Intronic
920805781 1:209232061-209232083 GGCCGGCGCCGCCGGGGTCTGGG + Intergenic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922250569 1:223845776-223845798 CGCCGCCGCCGCCTCGCAACAGG - Exonic
922416476 1:225427575-225427597 CCCCACCGCAGCCTGGCTCCCGG - Intronic
922513105 1:226186326-226186348 CACAGCCCACGCCGGGCTCCCGG + Intronic
922558193 1:226548927-226548949 CGCCGCCGCCGCCGCCGTCTCGG - Exonic
922950894 1:229558187-229558209 CCCCGCAGCGGCCGGACTCCCGG - Exonic
922951147 1:229559007-229559029 CGCAGGCGCAGCCGTGCTCCTGG - Intergenic
924415128 1:243850200-243850222 CGCCGGCCGCACCGGGCTCCAGG - Intronic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
1062874086 10:931482-931504 TGGCGCGGCCGCCGGGCCCCGGG - Exonic
1062890490 10:1056516-1056538 CGCCCCGGCTGCCGGGCTACGGG + Intronic
1062898100 10:1120364-1120386 CGCCGCCTCCGAGGGGCACCCGG + Intronic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064443167 10:15371233-15371255 CGCCGCCGCCGCGGCTCTTCGGG - Intergenic
1065214915 10:23439622-23439644 CGCCGCGGCCGCCGAGCACCGGG + Exonic
1066080759 10:31928682-31928704 CTGCGAGGCCGCCGGGCTCCCGG - Exonic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1067416355 10:46106240-46106262 CCCCGCCGCCTCCGCTCTCCTGG - Intergenic
1067416417 10:46106436-46106458 CGCCGCCGCCCTCTGGCTCTAGG - Intergenic
1067436931 10:46284901-46284923 CGCCGCCGCCCTCTGGCTCCTGG + Intergenic
1067560379 10:47300783-47300805 CGCGGCCGCCGACGGCCTGCAGG + Exonic
1068560851 10:58512979-58513001 CGCCGCCGCCACTGAGCCCCCGG - Intergenic
1069698356 10:70404351-70404373 CGCCGCCGCCGCCTGCCCGCCGG + Intergenic
1070257678 10:74825688-74825710 CGCCGCTGCCTCCGGCCACCCGG - Intronic
1070767966 10:79067340-79067362 CGCAGCCCCGGCCGGGCTGCGGG - Intergenic
1070792084 10:79195557-79195579 TGCCTCCGCCTCCGGGCTCCTGG - Intronic
1071695426 10:87864079-87864101 CGCCGCCGCCGCCGTGTTGGAGG - Exonic
1071997477 10:91162700-91162722 AGCCGCCGCCGCGCAGCTCCCGG - Intergenic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1072107899 10:92291331-92291353 CACCGCCGCCGCCAGGCTAGCGG + Exonic
1072562296 10:96587114-96587136 CGCCACCGCCGCCGGGCCGAGGG + Intronic
1072710652 10:97713851-97713873 CGCCGCCGCCACCGCGCCCAGGG + Exonic
1072731577 10:97850219-97850241 CGCCGCCGCCCACCTGCTCCCGG + Exonic
1072891540 10:99329495-99329517 GGCCGCCGCCGCCTGGCTGCTGG + Exonic
1072891752 10:99330295-99330317 CCTCGCTGCCGCCGGGCTTCGGG + Exonic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1073122646 10:101131871-101131893 CGCCGCCGCCGCCAGGACCGGGG - Exonic
1073531066 10:104232312-104232334 TTCCGCCGCCGCGGGGCTGCGGG + Exonic
1074121733 10:110498346-110498368 CGCCGCCGCCGCCCTCCTGCAGG - Exonic
1074169678 10:110919828-110919850 CGCCGCCGCCGCCGCTTTCCTGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074182578 10:111077294-111077316 CCCCGCCGCCGCCGCCGTCCCGG + Exonic
1075032079 10:119030212-119030234 CCCCGCCGAGGCCGGGCTGCTGG + Exonic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1075801826 10:125159331-125159353 GCCCGCCGCCGCCGGGAGCCCGG - Intronic
1075802813 10:125162868-125162890 CGCGGCCACCGCCAGGCTACCGG + Intergenic
1076554341 10:131311915-131311937 CTCCGCGGCCGCCCGGGTCCAGG - Intergenic
1076721980 10:132396862-132396884 CCCCGCCGCCCCCGGGCTCGTGG + Intergenic
1076830760 10:132993021-132993043 CCCCGCCCCCGGCGGACTCCAGG + Intergenic
1077042936 11:532558-532580 CCCCGCCCCTGCCGGTCTCCTGG - Exonic
1077048460 11:556157-556179 GGCCGTCGGGGCCGGGCTCCCGG + Intronic
1077080348 11:722169-722191 CGCCCCTGCCGCCCGGCCCCAGG - Intronic
1077100343 11:819693-819715 GGCGGCGGCCGCCGGGCCCCGGG - Exonic
1077249963 11:1556733-1556755 CGCTGCCGCCGCCTGGTCCCGGG + Exonic
1078594675 11:12675278-12675300 CGCCGCCGCCCCCCGGCGCCGGG + Intronic
1078631925 11:13010692-13010714 CGGGGCCACCGTCGGGCTCCAGG - Intergenic
1079451177 11:20601166-20601188 CGCCGCCGCCTCCGGGCTGTTGG - Exonic
1079459767 11:20669500-20669522 CGCCGCCGCCGCCGCGCCAGCGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080012436 11:27472368-27472390 CCCCGCCGCCCCCGGGCAGCCGG + Exonic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1081845493 11:46238022-46238044 CGCCGACGCCGCATGGCTGCCGG + Intergenic
1081925749 11:46826820-46826842 CGCCGCCGCCGCCGCCTGCCGGG - Intronic
1083171090 11:60924492-60924514 CGCCGCCGCCGCCCGCCCCGCGG - Exonic
1083246208 11:61429913-61429935 CGCCGCCGCCGCCATATTCCCGG - Intronic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083658710 11:64242225-64242247 CGCCCTCTCCCCCGGGCTCCGGG - Intronic
1083741439 11:64713594-64713616 CGGGGCCGCCGCCGAACTCCAGG + Exonic
1083904887 11:65662974-65662996 CCCCGCCGCCGCCCGGCGCAGGG + Exonic
1083945194 11:65919448-65919470 CGCCGCCGCCCGCAGCCTCCCGG - Exonic
1083945504 11:65920572-65920594 GGCCGCCGCTGCCTGGCTTCCGG - Exonic
1084014815 11:66371955-66371977 CCCCTCCGCCGCAGGGATCCGGG - Intronic
1084165584 11:67373422-67373444 CGGCCCCGGCGCGGGGCTCCCGG + Intronic
1084174293 11:67415609-67415631 CGCCGCCCCCGCTGGGCACTGGG + Intronic
1084935565 11:72584810-72584832 CAGCGCCGCCGGCGGACTCCCGG + Intronic
1084978109 11:72814338-72814360 CCCCGCCGCCGCCCGCCCCCTGG + Exonic
1085294817 11:75425456-75425478 CGCCACCGCCGCCGAGCTCACGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1089347039 11:117797203-117797225 CGCCGCCGCAGCCGAGCGCTGGG - Exonic
1089494126 11:118899921-118899943 CACCACCACCGCAGGGCTCCGGG - Exonic
1089543664 11:119206281-119206303 CGCCGCCGCCGCCGGCTATCCGG - Exonic
1089713779 11:120336666-120336688 CGCCGCCCTCACCAGGCTCCCGG - Intergenic
1089729467 11:120511534-120511556 CGCCCCCGCGCCTGGGCTCCCGG + Intergenic
1089814195 11:121157996-121158018 AGACGCCGCCGCCGGCCGCCAGG - Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090187356 11:124747097-124747119 CCTCCCCCCCGCCGGGCTCCTGG + Exonic
1090636882 11:128694913-128694935 CGCCGGCTCCGCGGGACTCCTGG + Intronic
1091259786 11:134224971-134224993 CGCCGCTGCCGCCGGGCAGTGGG - Exonic
1091381884 12:67134-67156 TGCCGCCGCCGCCAGGGCCCAGG + Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091616411 12:2053761-2053783 CCCCGGTCCCGCCGGGCTCCCGG - Intronic
1091732406 12:2890855-2890877 CGCCGCCGCGTCCCGCCTCCTGG - Intronic
1091973930 12:4810125-4810147 CCCCGCCCCCGCCGGCCTCCGGG - Exonic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1093464946 12:19439764-19439786 CGCCGCCGAACCCGGGCTGCCGG - Exonic
1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG + Intronic
1095476178 12:42589502-42589524 CGGCGCCGCTGCGGGGCTGCTGG + Exonic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096495423 12:52037071-52037093 GGCCGCCGCCGCCGGGATTCCGG + Intronic
1096675481 12:53223485-53223507 AGCCGCCGCCGCCAGGGCCCAGG - Intronic
1096738862 12:53677180-53677202 CGCCGCCCCCTCCCGGCTCCCGG + Intronic
1096749950 12:53752162-53752184 CGCCGCCGCCGCCGCCTTCCAGG + Intergenic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097046290 12:56189614-56189636 CGCCGCCGCGCCCGGCCTGCCGG - Intergenic
1097107671 12:56634956-56634978 CGCCGCCGCCGCCTGCGGCCCGG - Intronic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1097929626 12:65169829-65169851 CGCCGCCGCCGCTGGTCCCGCGG - Exonic
1097929694 12:65170046-65170068 CGCCGCCGCCGGCCTGGTCCCGG - Exonic
1099413378 12:82358913-82358935 CGCCTCCGCCGCCACGCACCTGG - Intronic
1101897739 12:108768835-108768857 CGCCACTTCCCCCGGGCTCCGGG - Intergenic
1101935355 12:109052613-109052635 CGCCGCCGCCGCCGGACCGAGGG - Exonic
1102136866 12:110582941-110582963 CGCCGCCGCCGCCGGCCCTGGGG + Exonic
1102157483 12:110742739-110742761 CGCCGCCGCCGGCTCGCGCCCGG + Exonic
1102197192 12:111034068-111034090 CGGGGCCGCCGCCGGCCGCCCGG - Exonic
1102278219 12:111598905-111598927 GGCCGCTGCCGCCGGGCTTGCGG + Exonic
1102329127 12:112013969-112013991 GGTCGACGCCACCGGGCTCCCGG + Intronic
1102997451 12:117361214-117361236 GCCCGCGGCCGCCGCGCTCCGGG + Intronic
1103074158 12:117968909-117968931 TGCTGCCGCCGCCGGGCTCCGGG + Intronic
1103363744 12:120368574-120368596 CGCTGCCGCCGGCGGGTCCCGGG + Intronic
1103400723 12:120641164-120641186 CGCCGCTGCCGCCGGCCCGCGGG + Exonic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103595556 12:122022577-122022599 CCCCGCCGCCGCCGGCATCGCGG - Intronic
1103649618 12:122422579-122422601 GGCCGCCGCCTCCCGCCTCCCGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103764667 12:123271659-123271681 CGCCGCCGCCGCCGCCCTCGCGG - Exonic
1103800348 12:123533714-123533736 CGCCGCCGCCGCCGCCCACTCGG - Exonic
1104049451 12:125186165-125186187 CGCGACCCCCGGCGGGCTCCCGG + Intergenic
1104568087 12:129903231-129903253 CGCCGCGGCCGCCAGGGCCCGGG - Intronic
1104697037 12:130871793-130871815 CGACGCCCCGGGCGGGCTCCCGG - Intergenic
1104952091 12:132445702-132445724 CTCCGCCACCGGCGTGCTCCTGG + Intergenic
1105270901 13:18874969-18874991 CGCGGTGGCCGCCGGGCTCCCGG + Intergenic
1105472066 13:20703731-20703753 CGCCGCCGCCGCCCCGAGCCGGG - Intronic
1105578866 13:21675424-21675446 CGCCGCCGCGGCCTCGTTCCGGG - Intronic
1106208409 13:27620509-27620531 CGCCGCCGCCGCGGATTTCCTGG + Intergenic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1106565863 13:30883984-30884006 CACCGCAGCCTCCGGGCTCCTGG - Intergenic
1107086359 13:36431656-36431678 CGCCTGCCCCGCCCGGCTCCCGG - Intergenic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1108518256 13:51222507-51222529 CGCCGCCGCCGCCCGCCTTTGGG - Exonic
1108689266 13:52847296-52847318 CGCCGCCGCCGCTGCACTCGGGG - Exonic
1108727794 13:53201121-53201143 CGCCGCCGCCGCTGCCCTCGGGG + Intergenic
1110318180 13:74134257-74134279 CGCCGCTGCCGGCGAGCCCCGGG + Intergenic
1110705921 13:78602143-78602165 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
1110887260 13:80655168-80655190 TGCCGCCCCCGCCGGGCTGCGGG - Intergenic
1111951651 13:94713013-94713035 CTCCGCGGCCGGCGAGCTCCGGG - Intergenic
1112012157 13:95301460-95301482 TGCCGCCGGCGCCCGGCTCCCGG - Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112291023 13:98143749-98143771 CTCCGCCGACGTCGGGCTGCGGG + Intronic
1112318916 13:98389496-98389518 CGCCCACGGCTCCGGGCTCCAGG - Intronic
1113200740 13:107866173-107866195 CGCCGCCGCCGCCGTCTCCCGGG + Exonic
1113378127 13:109782937-109782959 CGCCACCGCCGCCGGCCCCGGGG - Exonic
1113541774 13:111115151-111115173 CGCCGCCGCCGCCCCGCGCACGG + Intronic
1113656819 13:112072777-112072799 CGCAGACGCCGCTCGGCTCCCGG - Intergenic
1113724501 13:112588100-112588122 CGCGGGCGCCGCCGGCCACCAGG + Exonic
1113800443 13:113083584-113083606 CAGCGCCGCCCCCAGGCTCCTGG - Intronic
1113981798 13:114282165-114282187 GGCCACCGCCGCCGAGCTCTGGG - Intronic
1114485099 14:23057447-23057469 CGCCCCCGTCGCCGGGTCCCGGG + Exonic
1115566593 14:34630062-34630084 CGCTGCCCCCACCGCGCTCCCGG + Intronic
1116018226 14:39431996-39432018 CGCCGCCGGCTGCCGGCTCCCGG + Exonic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1118186539 14:63543127-63543149 CGCCGCCGCCGCCGGGTCCGGGG - Exonic
1118339092 14:64879818-64879840 CGCCGCCACCCCCGGGCTCGGGG - Exonic
1118339115 14:64879881-64879903 CACAGCGGCCGCCGGGCGCCTGG + Exonic
1118748345 14:68789889-68789911 CGCCGCTGCCACCGGGCTGCTGG - Exonic
1118849476 14:69573079-69573101 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1119325760 14:73758994-73759016 CGGCGCTGCCGCCAGGCACCAGG + Intronic
1119382879 14:74239977-74239999 AGCCGACGGCGCGGGGCTCCCGG - Intronic
1119410242 14:74425933-74425955 CGCCTCCTCCGCGGGGCTCGGGG + Exonic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1121253052 14:92513797-92513819 CGCCGCTGCCGCCGCGCTCTGGG - Exonic
1122082277 14:99274257-99274279 CGCCGGCGGCGCTGGGCTGCAGG - Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122889047 14:104724216-104724238 CGCCGGCGGCGGCGGGCTCCTGG + Intronic
1124791398 15:32730836-32730858 CGCCCCAGCAGCCTGGCTCCAGG + Exonic
1124922273 15:34038797-34038819 CGCCCCAGCCTCCCGGCTCCCGG + Exonic
1125300902 15:38252689-38252711 CGCCGCCGCTGCCCGGAGCCTGG + Exonic
1125468261 15:39976592-39976614 GGACGCCGCCCCCGGACTCCGGG + Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1127144081 15:56007186-56007208 CGCCGCCGCCGCCCGGATCCTGG - Intergenic
1127877287 15:63122155-63122177 CCCCGGCGCCGCCCTGCTCCAGG + Exonic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1128309641 15:66622210-66622232 CCTCGCCGCCCCCGGGCTGCCGG + Intronic
1128322512 15:66703321-66703343 CGCCGCTGCCGCCTTCCTCCCGG - Exonic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1128877604 15:71215064-71215086 CGCCGCCGCCGTCGTCCTCGGGG - Exonic
1128982372 15:72197180-72197202 CGCGGCCTCCCCCGGGCGCCAGG - Intronic
1129116572 15:73368313-73368335 CGGCGCCGCGGACGGGCTCCAGG + Exonic
1129348280 15:74938166-74938188 CCCCGCCGCCGCCGGCCGCGCGG - Exonic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1129933729 15:79432339-79432361 CGCCTCCGCCGCCCGAGTCCAGG - Intergenic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1130115551 15:81001893-81001915 CGCCGCCGCCGCCGCCTTCTTGG - Exonic
1130224246 15:82045660-82045682 CGCCGCTGCCGTTGCGCTCCAGG + Exonic
1130564420 15:84981685-84981707 CGCCGCCGCCGCCGCCTCCCCGG - Intronic
1131160523 15:90102161-90102183 CCCCGCCGTCCCCGGGCTGCGGG + Intronic
1132251968 15:100341298-100341320 CGTCGCCGCCGTCGGGGCCCGGG + Exonic
1132491560 16:234687-234709 CGCTGCCTCCGCCGGGAACCTGG - Exonic
1132583259 16:694808-694830 CCCAGCCGCCTCCCGGCTCCGGG - Intronic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132847972 16:2009421-2009443 AGCCGGCGCCGCCGGGCCCACGG + Intronic
1133005989 16:2882340-2882362 TGCCACCGCCCCAGGGCTCCAGG - Intergenic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133212869 16:4272859-4272881 CGCCGCCGCCGCCAGCATCTGGG - Exonic
1133242822 16:4425841-4425863 CGCCTGCGCCGCCCGGCTCTAGG - Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1134290529 16:12900786-12900808 CGGCGCCGCCTCTGCGCTCCCGG - Intergenic
1135023799 16:18983992-18984014 CGCCGCCGCCGCCGCCTCCCCGG - Exonic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136365434 16:29807106-29807128 CGCCGTCGCTGCCGCGCCCCCGG + Exonic
1136409946 16:30070277-30070299 GGCCGCCTCCTCGGGGCTCCAGG + Exonic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136485936 16:30571670-30571692 AGCCGCCGCCTCCCCGCTCCCGG + Exonic
1136498835 16:30659691-30659713 CGTCGCCGCCGCCGCCCGCCAGG + Exonic
1136666764 16:31819474-31819496 GCCCGCCGCCGCCGGGCTCCTGG - Intergenic
1136779114 16:32885984-32886006 CGCCGCCGCCACCGGAGTCTCGG - Intergenic
1136891503 16:33975534-33975556 CGCCGCCGCCACCGGAGTCTCGG + Intergenic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1137605789 16:49786142-49786164 CGCCCCCGCCTCCGGACTGCAGG + Intronic
1137617783 16:49857294-49857316 CGCCGCCGCCACCACGGTCCGGG - Intronic
1138507700 16:57486400-57486422 CGGCGGCGGCGCCGGGCTCCAGG + Exonic
1138595270 16:58026231-58026253 CGCCGCGGACCTCGGGCTCCCGG - Exonic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139402949 16:66696673-66696695 CGCAGCCGCAGCCGGGCGGCGGG - Exonic
1139615444 16:68085755-68085777 CGCCGCCGCCCCCGGGCTCGCGG + Exonic
1139806215 16:69566685-69566707 AGCCGCCGGCCCCGGCCTCCCGG + Intronic
1139958307 16:70703789-70703811 CGCCCCCTCTGCTGGGCTCCGGG - Intronic
1140478564 16:75250912-75250934 GGCCGCCGGCGCGGGGTTCCGGG - Intronic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141418894 16:83899090-83899112 CGCCGCCGCTGCCGCGCTTCCGG - Intergenic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141682690 16:85553629-85553651 CGCCGCAGCCACCGAGCTGCTGG + Intergenic
1141828987 16:86498991-86499013 CGCCGCCGCCGGCGCCTTCCTGG + Intergenic
1141989613 16:87602591-87602613 TGCCGCCGCCGCCCCGCGCCCGG + Intronic
1142120176 16:88383199-88383221 GGCCGCCGCCAACGAGCTCCCGG - Intergenic
1142430358 16:90022979-90023001 CGCCGCCGACCCCGGGCCCTGGG - Intronic
1142509534 17:385452-385474 CGACGCCTCCGCCCGACTCCGGG + Intronic
1142762421 17:2050232-2050254 GGCCGCCGCCGCCGCGCCCGGGG - Intergenic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1142978392 17:3658300-3658322 CCCCGCTCCCGCTGGGCTCCCGG - Intronic
1143519395 17:7437023-7437045 CGGTGCCGCCACCGGGCACCAGG - Exonic
1143519428 17:7437172-7437194 GGGCGCCGCCGCCCGGGTCCCGG - Exonic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1145970151 17:28951418-28951440 CGCCGCCGCCGTCTGCGTCCCGG + Exonic
1146229301 17:31094652-31094674 CCCCTCCCCCGCCGGCCTCCGGG - Intergenic
1146398590 17:32487092-32487114 CGGCCCCGCCGCCGCGGTCCCGG - Exonic
1146720442 17:35119848-35119870 CGCTGCCGCTTCCGGGTTCCAGG + Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147341131 17:39753928-39753950 CGCCGGGGCCGACGGGCGCCAGG + Intergenic
1147393447 17:40123167-40123189 CACCGCCACCGCCGGGACCCTGG + Intronic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147741644 17:42673802-42673824 CCCCTCCTCCGCGGGGCTCCCGG + Exonic
1148262241 17:46193556-46193578 CGCCGCCCCCGCGGGCCGCCAGG + Intronic
1148323638 17:46771484-46771506 CCCCGCCGCCCCCGCGTTCCCGG - Intronic
1148397733 17:47323819-47323841 CGCCACCGCCCAGGGGCTCCGGG - Intronic
1148440416 17:47709022-47709044 CGCCGCCCCCGCCGGGCGAGAGG + Exonic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148782705 17:50130473-50130495 CGCCGCGGCCGCCTGGACCCAGG - Intergenic
1148899736 17:50866592-50866614 AGCCGCACCCTCCGGGCTCCAGG + Intronic
1149296376 17:55265605-55265627 CGCTGCCGCGGCCCCGCTCCGGG + Intronic
1149614760 17:57988322-57988344 CGCCGCCGCCCCCAGTCGCCCGG + Intergenic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1150002665 17:61451663-61451685 TGCCGCCGCCGCCCCGCACCCGG + Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150128183 17:62652424-62652446 TGCCTCCGCCCCCGCGCTCCGGG + Intronic
1150423288 17:65056952-65056974 CGCAGCCGCGGCCGGGCGCGCGG + Intergenic
1150643450 17:66964575-66964597 CCCCGCCGCCGCCGCGCTCCGGG - Intergenic
1150675747 17:67245034-67245056 GGCCGCCGCGCCCGGGGTCCGGG + Intronic
1151567477 17:74907303-74907325 CACCAGCGCCGCCGGGCCCCCGG - Intergenic
1151979337 17:77499386-77499408 CCCCGCCCCCACCGGGCTGCAGG + Exonic
1152049144 17:77958956-77958978 CGCCGCCGCCGCCTAGGACCCGG + Intergenic
1152237896 17:79147998-79148020 CGCCGCTGCCGTGGGGCCCCGGG + Intronic
1152360800 17:79832280-79832302 GGCCACCGCCGCCGCGTTCCCGG + Intergenic
1152361246 17:79834136-79834158 CGCCGCCGACGCCGGTGTCTCGG + Exonic
1152617838 17:81346038-81346060 CCCCGCGGCCGCCGCCCTCCGGG + Intergenic
1152811069 17:82383073-82383095 CGCCGCCCCCGACCGGCCCCTGG - Intergenic
1153201972 18:2656025-2656047 GCCTGCCGCCGCCGGGCTCAGGG - Exonic
1153238923 18:3013379-3013401 CGCCCCCGCCGCCGAGCGCCAGG + Intergenic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1156088810 18:33440756-33440778 CGCCGCCGCCGCCGCCCCCGCGG - Intronic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1157529332 18:48408777-48408799 CGCAGGCGCCGCCGAGCCCCGGG + Intronic
1157753002 18:50194946-50194968 CGCCGCGGCCGGCTCGCTCCCGG + Exonic
1158434654 18:57427750-57427772 GGAGGCCGCGGCCGGGCTCCAGG - Intergenic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1160025416 18:75211741-75211763 CCCCGCGGGCTCCGGGCTCCGGG - Intronic
1160597688 18:79988479-79988501 CCCCGCCGCCCCCGGGCCCACGG + Exonic
1160690920 19:460486-460508 GGCCGCCGCGAACGGGCTCCCGG + Intronic
1160711317 19:552480-552502 CGTCCCCGCCCCCAGGCTCCTGG + Intergenic
1160719059 19:589741-589763 CGCCGCCTCCGCTCGGCGCCGGG - Intergenic
1160786706 19:903470-903492 CACCGCAGCCACCGGGCACCCGG + Intronic
1160788737 19:913172-913194 CGCCGCCGCCGCCGCCCGGCAGG + Exonic
1160791782 19:926663-926685 CACCGCGGCCCCCGGGCGCCGGG + Intronic
1160859059 19:1230075-1230097 CGCTGCCCGCGCCGCGCTCCGGG + Exonic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160909216 19:1467204-1467226 CGGCGCCCCCGCCGCGCTCGGGG - Exonic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161022125 19:2015506-2015528 CGCCCGCCCCGCCGGGCCCCGGG - Exonic
1161080595 19:2308160-2308182 CGCCGCCGCCGCCGCCTCCCGGG + Intronic
1161210250 19:3062102-3062124 CGCCCCCGACCCCCGGCTCCCGG - Intronic
1161215819 19:3094597-3094619 CGCCGCCGCCCCCCGGCCCCCGG - Exonic
1161293111 19:3506351-3506373 GGCCGCCGCTGACGGGATCCCGG - Intronic
1161443288 19:4304625-4304647 CCTCGCCGCCGCCGCGCCCCCGG - Exonic
1161471144 19:4457363-4457385 CGCCTCCCCCGCCGCGCCCCCGG + Intronic
1161531393 19:4792121-4792143 CGCCTCCGCAGCCGGCCACCTGG + Exonic
1161628768 19:5340886-5340908 CGCCGCCGCCGCCGGGTCGGGGG + Intergenic
1161664530 19:5567592-5567614 CGCCTCCCCCGCCGCTCTCCAGG + Intergenic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1161766831 19:6213002-6213024 GGCCCCCACCGCCGGGGTCCTGG - Exonic
1161963058 19:7533519-7533541 CGCCTGCGCCGCCGGGATGCTGG - Exonic
1162030916 19:7916920-7916942 CGCCGCCGCCGCCGCCATCGCGG + Exonic
1162199414 19:9009880-9009902 AGTCGCCGCCGCAGGGTTCCAGG - Intergenic
1162312141 19:9913907-9913929 CCCGCCCCCCGCCGGGCTCCGGG - Intronic
1162535847 19:11262487-11262509 CGCCGCCGCCTCCCGGTTCTGGG + Intergenic
1163252170 19:16132409-16132431 CGCCGCGGCCACCGGGCCCACGG + Exonic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1163715492 19:18870184-18870206 CCCAGCCGCCGCCCTGCTCCAGG - Exonic
1163782703 19:19258640-19258662 CCAGGCCGCCGCAGGGCTCCCGG + Exonic
1164658542 19:29942329-29942351 CGCCGCCGCCGCCCCGCAGCGGG - Exonic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1164977128 19:32581510-32581532 GGCCCCCGCCGCCAGCCTCCTGG - Intronic
1165056003 19:33176723-33176745 CGCCAGCGCGGCCGGGCTGCTGG - Intergenic
1165058651 19:33194482-33194504 CGCCGCTGCCCCCGCGCCCCGGG - Intronic
1165157082 19:33795569-33795591 CTGCGCCCCCGCCTGGCTCCAGG - Intergenic
1165229252 19:34376480-34376502 AGCCTCCGCCTCCAGGCTCCAGG - Intronic
1165349792 19:35269313-35269335 CGCCGCCGAGGCCGGGGGCCGGG - Intronic
1165533237 19:36421554-36421576 AGCCGCGGCCCGCGGGCTCCAGG - Intergenic
1165621438 19:37251883-37251905 CCCAGCGTCCGCCGGGCTCCCGG - Intergenic
1166091575 19:40512787-40512809 CGCCGCCGCCCGCAGCCTCCAGG - Exonic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166883007 19:45940360-45940382 CGCCGCCGCCGCCAACCTCCTGG - Exonic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167331921 19:48861414-48861436 CGCCGCCCTCGGGGGGCTCCCGG + Exonic
1167557171 19:50203686-50203708 CGCCGCCCCCGGAGGGCTGCCGG - Intronic
1167557473 19:50205306-50205328 CGCCGCCGCCGCCGCCCACCTGG + Intronic
1167578333 19:50328320-50328342 CGGCGCCGCCGCCCGCGTCCTGG + Exonic
1167924129 19:52809877-52809899 CGCCGCCCCGGCCTGGATCCCGG - Intronic
925133779 2:1512534-1512556 CTCCGCCCCTGCTGGGCTCCTGG + Intronic
926095596 2:10079572-10079594 CACCGCCGGCGCCCCGCTCCAGG + Intronic
927053405 2:19350548-19350570 ATCCGCGGCCGCCGCGCTCCGGG + Intergenic
927215827 2:20667356-20667378 CGCCGCCGCCGCCGCCCCCTGGG - Exonic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
927714078 2:25341525-25341547 CCCCGCCCCCGCCCGGCTCCGGG - Intronic
927714370 2:25342332-25342354 CCCCGCCTCGGCCGCGCTCCCGG + Intronic
927938079 2:27086516-27086538 CGCCGCCTCCGCCCGGCTCGGGG + Intergenic
927966898 2:27275886-27275908 CCCCGCCCCCGCCAGGCTCTAGG + Intronic
928013095 2:27629070-27629092 CGCAGCTGCCGCTGAGCTCCAGG + Exonic
929452703 2:42047868-42047890 CGCCGCCCCCTCCGGCCGCCCGG - Intergenic
929604693 2:43226639-43226661 CCCCGCCGCAGCCGCACTCCCGG - Intergenic
929936393 2:46297258-46297280 CCCCGCCCGCGCCGAGCTCCGGG - Intronic
930641713 2:53860007-53860029 CGCCCCCTCCGCCGGACACCCGG + Intergenic
930641734 2:53860063-53860085 CGCCTCCGTCGCCTGCCTCCTGG + Intergenic
930872757 2:56184638-56184660 CGCAGCCGCCGCCGCGCCTCCGG - Exonic
931052412 2:58428837-58428859 CGCCACCGCCTCCGGGACCCAGG + Intergenic
931516206 2:63051873-63051895 CCCCGCCGCTGCCGGGAACCCGG - Intronic
931602531 2:64019028-64019050 GGCCGCCGCCGCCCGGCGCCCGG + Exonic
932042987 2:68319544-68319566 CGCCGTCGCCGCCGTCCGCCCGG + Exonic
932699762 2:73984804-73984826 CGCCGGCCCGGCCGGGCCCCGGG - Intergenic
932779061 2:74548923-74548945 CGCCGCCGTCCCCGGGCCCCCGG + Intronic
932827928 2:74958675-74958697 CGCCGCCGCCGCCGCCATCCCGG - Exonic
933847421 2:86337266-86337288 CGCCGGCGCCGGCTGCCTCCTGG + Intronic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934079060 2:88452307-88452329 CGCAGCCGCCGCCGCGTACCTGG - Exonic
934079202 2:88452755-88452777 CGCGGCCACCGCCCCGCTCCGGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934846371 2:97663709-97663731 CGTCGCCCCCGCCGGGCCGCTGG - Intronic
935196637 2:100820230-100820252 CGCCGCGGCTGCGGGTCTCCGGG - Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
936122652 2:109760337-109760359 CGCCGCCGCCGCCGCTCTTAGGG - Intergenic
937045132 2:118847102-118847124 CGCCGCCGCCGCCGCGCCGAGGG + Exonic
938099971 2:128492076-128492098 TGCCCCAGCCGCAGGGCTCCTGG - Intergenic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
940638864 2:156328091-156328113 GGCCGCAGCCGCGGGGCACCAGG + Intronic
940640760 2:156342379-156342401 TGCCGCAGCCGCCGGGGGCCGGG - Intergenic
941111688 2:161423882-161423904 CGCCGCGGCCGCCGCGCGCATGG + Exonic
941384957 2:164841441-164841463 CGCCTCCTCCGCCGTGCTCTGGG - Intronic
941951350 2:171160336-171160358 GGCCGCCGCCGCCGAGCCCGGGG + Exonic
942027209 2:171922343-171922365 CGCTTCCGCCGCCGGGCTCCTGG + Intronic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942453544 2:176123019-176123041 CGCCGCCGCTGCCGGGGGCTGGG - Exonic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
945404023 2:209423841-209423863 TGCCGCAGCCGCCGGCCGCCAGG - Intergenic
945404045 2:209423925-209423947 CGCGGCCGCCCACGGGCTCGCGG + Intergenic
945431682 2:209772099-209772121 CGCGGCCGCCGTCCTGCTCCTGG - Exonic
946019899 2:216633760-216633782 AGCAGCCGCAGCCCGGCTCCCGG - Exonic
946295772 2:218782324-218782346 CGTTGCCGCCGCCGGACACCAGG - Exonic
946322083 2:218960144-218960166 CGCCGCCGTCGGGGGGATCCCGG - Exonic
946422083 2:219570861-219570883 CGCTGCCATCGCCGGGGTCCGGG - Exonic
946767346 2:223052899-223052921 CGCTGCCGCCGCCGGCCGCACGG - Exonic
946921468 2:224585301-224585323 CGCCGCCGCCGCCGCCATCGCGG - Exonic
946966580 2:225042779-225042801 GGCGGCCGCCGAGGGGCTCCGGG + Intergenic
947418570 2:229921954-229921976 AGCCGCCGCCGCCGCGCCGCTGG - Exonic
947518806 2:230828674-230828696 GGGCGCCGCCGCCTGGCTCCCGG - Intergenic
947860514 2:233354511-233354533 CGCCGCCGCCGCCATGCTGCCGG - Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948825483 2:240571754-240571776 CACCGCAGCCCCCGGCCTCCAGG + Intronic
948832005 2:240602769-240602791 CGCCACTCCCGCCAGGCTCCTGG + Intronic
948910263 2:240999131-240999153 CGCCGCCGCCGCCAGCCACTTGG + Intronic
1168757241 20:325965-325987 GGCCGCCGCCCCCGGGACCCGGG + Exonic
1169065561 20:2692797-2692819 CGCCGCCGCCGCCGCTCCCGGGG - Intergenic
1169171827 20:3471349-3471371 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1169214723 20:3786501-3786523 CGGCGGCGGCGCCGGGCCCCGGG - Exonic
1169664532 20:8019545-8019567 CGCCGCCACAGCCGCGATCCAGG + Exonic
1169849636 20:10035179-10035201 GGGCGCCTCCGCCGGGCTCCGGG + Exonic
1170756838 20:19212571-19212593 CGCCGCCGCCTCCCGGCGCTCGG - Intergenic
1170890256 20:20369524-20369546 CGCCGTCGCCGGCCGCCTCCTGG - Exonic
1171123603 20:22584521-22584543 ACCCGCCGCCGCCGCGCTCACGG + Intronic
1171346724 20:24470857-24470879 CGCTGGCGCCGCGGCGCTCCTGG + Intronic
1171499834 20:25585180-25585202 CGCCGCCGCCGTCGGGAAACCGG + Intronic
1172144004 20:32743584-32743606 ACGCGCGGCCGCCGGGCTCCGGG + Exonic
1172277228 20:33686286-33686308 CGCCGCCGCCGCCTGTCACCCGG - Exonic
1172474528 20:35226884-35226906 CGCCGCCGCCGCCGCCCGCGCGG - Exonic
1172587269 20:36093477-36093499 CGCCGCCGCCGCTGGGAGCTGGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173514747 20:43657478-43657500 AGCCGTCGCAGCCCGGCTCCAGG + Intergenic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1173729188 20:45316881-45316903 CACCGACGCCGACGCGCTCCTGG + Exonic
1173913534 20:46689099-46689121 GGCCGCCCACGCCGGGATCCCGG + Intronic
1175975614 20:62709018-62709040 CGCCCCGGGCTCCGGGCTCCGGG - Exonic
1176180420 20:63747142-63747164 CGCCTCCGCCGCCATGGTCCAGG + Exonic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1176283318 20:64327699-64327721 TGCCGCCGCCGCCAGGGCCCAGG - Intergenic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176856663 21:13980183-13980205 CGCGGTGGCCGCCCGGCTCCCGG + Intergenic
1176867923 21:14064009-14064031 CGCGGTGGCCGCCGGGCTCCCGG - Intergenic
1178334712 21:31732443-31732465 CGCCGCCCCCGCCGGGTGCAGGG - Intergenic
1178950346 21:36980676-36980698 CCCCGCTCCCGCCAGGCTCCGGG + Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179511999 21:41879343-41879365 CGCCGCCGCCCCCCGGCTTCCGG - Exonic
1179561595 21:42219239-42219261 CGCCGCCGCCGCCGCCCCCGGGG + Exonic
1179631270 21:42680105-42680127 CTCCGCTGCCCCCGGGCTCAGGG + Intronic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181007532 22:20021106-20021128 CGCCACCGCCGCCGACTTCCGGG - Exonic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1181541987 22:23578526-23578548 CGCCTCCATGGCCGGGCTCCTGG + Intronic
1181669659 22:24420267-24420289 CCCCGCCGCCGCCGGGCCTGAGG + Intronic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182586357 22:31346196-31346218 CGCCGCCGCCACCGCCCTCCAGG - Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183517112 22:38272977-38272999 CGCCGCCGCCGGCGCGTCCCGGG + Exonic
1183524957 22:38317366-38317388 CGCCGCCGCCTCCCTCCTCCCGG + Exonic
1183708419 22:39488861-39488883 CCCGCCCGCCGCCGTGCTCCTGG - Exonic
1183712646 22:39514535-39514557 CTCTGCCGCCCCCTGGCTCCAGG + Exonic
1184273897 22:43399626-43399648 CGCTGCCACCTCCAGGCTCCAGG - Intergenic
1184557426 22:45240899-45240921 CGCCGCCGCCCGCGCGCCCCCGG + Intergenic
1184620320 22:45671873-45671895 CGCCGCCGCCGGAGAGCTCTAGG - Exonic
1184759590 22:46537104-46537126 GGCCGCCGCCGCCGCCCTGCCGG - Exonic
1184766949 22:46577127-46577149 CGCCGCCGCCTCCGCGCTCGTGG + Intronic
1184766972 22:46577181-46577203 CCCCGGCGCCGCTGGGCTCCCGG + Intronic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
1185345067 22:50307432-50307454 CGCAGCCGCCGCAGGTCCCCGGG + Intronic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
950487689 3:13282715-13282737 CGCGGCGGCCGCCGAGCTCCGGG + Intergenic
951217767 3:20040603-20040625 CGCCGCTGCCGCCGGGGGCTCGG + Exonic
951543657 3:23806176-23806198 CGCCGGGGCCGCCGGGCCGCAGG + Intronic
951881403 3:27484199-27484221 TGCCGCCGCCGCCGAGCCCCCGG + Intronic
952241225 3:31532941-31532963 CGCCGCCGCCGCCTGGTGCGAGG - Exonic
953697038 3:45167742-45167764 CACCGGCGCTGCAGGGCTCCCGG - Intergenic
954200734 3:49021831-49021853 CGCAGCCGCGGCCTGGCCCCCGG - Exonic
954265934 3:49470359-49470381 CGCCGCCACCGCCGCTCCCCGGG - Exonic
954420197 3:50414833-50414855 GGCCGGCGGCGCAGGGCTCCGGG + Intronic
954468874 3:50674960-50674982 CAGCTCCGCCGCCCGGCTCCCGG - Intergenic
955387595 3:58492000-58492022 CGCCGCCCGCGCCGGGCAGCTGG + Intergenic
955387686 3:58492285-58492307 CCCCGCCGCCGCCCCGTTCCAGG - Intronic
955656612 3:61251198-61251220 CGCCGGCCCCACTGGGCTCCGGG + Intronic
955687504 3:61561870-61561892 CGCCGCCGCCCGCCGGCTCTCGG + Intronic
955769247 3:62372550-62372572 CGCCTCCGCCGCCGCCCGCCCGG + Exonic
956406429 3:68932703-68932725 CGCCCCCACTGCCGGCCTCCAGG + Intergenic
956978972 3:74614603-74614625 CGCCGCCGCCGCCAAGCGCCAGG + Intergenic
958791637 3:98657659-98657681 TGCCGCGGCCGCCTGGCTGCCGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960465977 3:117997124-117997146 CCTCCCTGCCGCCGGGCTCCGGG - Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961545296 3:127629139-127629161 CGCCGCCGCCGCCGCCCGCGCGG + Intergenic
961638547 3:128350149-128350171 CGGCGCTGCCTCCTGGCTCCTGG + Intronic
961827509 3:129606698-129606720 TCCCGCCGCCTCCGGGCTCCCGG - Exonic
962583541 3:136819226-136819248 CGCCGCCGCCGACCGGCTCCCGG - Exonic
962588085 3:136862231-136862253 CGCCGCCGCCGCGTAGCTCTTGG - Exonic
963133246 3:141877030-141877052 CGCCGCCGCCGCCCGGGTTAGGG - Intronic
964570789 3:158105835-158105857 CGCCGCCTCCGCCGGCCGCCCGG + Exonic
965590622 3:170357583-170357605 CGCCGCCGTCTCCGGCCGCCCGG - Intergenic
966362832 3:179148533-179148555 CGCCGCCGCCGCCGCCCGCGGGG + Exonic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
966982603 3:185152527-185152549 CTCTGCGGCCGCGGGGCTCCGGG - Intronic
967273451 3:187750152-187750174 CGCTGCCGTTGCCGGGCTGCTGG + Intergenic
967880327 3:194297184-194297206 CGCCGCCGCCGCCAGCTTGCTGG + Intergenic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968514415 4:1010271-1010293 CGCAGCCGCCGCTGTGCACCCGG - Intronic
968514767 4:1011473-1011495 CCCCCGCCCCGCCGGGCTCCCGG - Intronic
968518009 4:1022945-1022967 CGCCTGCTCCGCTGGGCTCCTGG + Intronic
968596882 4:1490311-1490333 CGACGCCGCCTCCCGCCTCCCGG + Intergenic
968965146 4:3765922-3765944 CGCCGCCGCCGCCCTGCGCTGGG - Intergenic
969360232 4:6658688-6658710 CGCCGCCCACGCGGGGCGCCGGG - Intergenic
969413372 4:7043527-7043549 CGCCGCAGCCGCCGCGCCCCCGG - Exonic
969585122 4:8087211-8087233 CCCCGCCGCTGCCAGGCACCTGG - Intronic
969715870 4:8867842-8867864 CGCAGCCGCCGCTGGGCCCCCGG - Exonic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970824046 4:20252458-20252480 TGGCGACGCCGCCCGGCTCCTGG - Intergenic
971757558 4:30721971-30721993 TGCCGCCGCCTCCGGGCTCCTGG - Exonic
972265346 4:37454019-37454041 CGCCGCCGCCGTCTGGCCCCAGG + Intronic
975118571 4:70705181-70705203 CGCCGCAGCAGCAGCGCTCCTGG + Intronic
975166712 4:71186583-71186605 CGCCGCCTCCGCCGGGGGCTTGG - Intergenic
975778959 4:77819604-77819626 CGCCGCCGCCGCCCGGACCCCGG - Intronic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
978072607 4:104491487-104491509 CGCCGCCACCGCCATGCTCTGGG - Exonic
978384700 4:108167954-108167976 CGCGGCGGCCGCCGGGATTCGGG - Exonic
978503499 4:109433668-109433690 CGCCGCGGGCGCGGGGATCCTGG - Intergenic
979205552 4:118033577-118033599 AGCCGCCGCCTCCCAGCTCCCGG - Intergenic
979785610 4:124712578-124712600 CGCCTCCTCCGCCGGGCCCGGGG + Exonic
979785647 4:124712702-124712724 CGCCGCCGCCGCCGCCGTCAGGG + Exonic
980053802 4:128061564-128061586 GGCCACGGCCGCCGGGCTCTCGG + Intronic
980541441 4:134201532-134201554 CGCCGCCGCCGAGGCGCTGCCGG + Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981782376 4:148443714-148443736 AGCTGCCGCCGCCGGGCTGCGGG - Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983061511 4:163166490-163166512 CGCCGTCGCGGCCGGGACCCCGG - Exonic
983077498 4:163343916-163343938 TGCCGCCACCGCCGGGGTGCAGG + Intronic
983920182 4:173335368-173335390 AGCCGCCGGCTCCGAGCTCCCGG - Intergenic
984462989 4:180059155-180059177 CGCCGCCGCGGCCGGGCGCAGGG - Intergenic
984715019 4:182917348-182917370 CCCCGCCGCCGCCGTGCTCAGGG + Exonic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
984973588 4:185210431-185210453 CGCGGCGGGCTCCGGGCTCCGGG + Intronic
985532666 5:443184-443206 TGCCTCCGCCTCCGGGGTCCCGG - Exonic
985781672 5:1875092-1875114 CGCCGGCCCTGCCGGCCTCCCGG + Intergenic
986858799 5:11903701-11903723 CGCCGCCGCCGCCTGCCGGCCGG + Intronic
987132348 5:14871572-14871594 AGCCGCCGCCGCCGCGCCCGAGG - Exonic
987303350 5:16616771-16616793 CGCGGCCGCCGCCCGGCCCGCGG + Exonic
988577840 5:32444249-32444271 CGCCGCCGCCGCCCCGCTGTGGG + Exonic
990545247 5:56815636-56815658 CTCCGCCGCCGCCTGCCTCAGGG - Exonic
990955023 5:61332320-61332342 CGCCGCCGCCGCCGCCCGGCCGG - Exonic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991587355 5:68215086-68215108 CACCGCCGCCTCCGGGAGCCAGG - Intergenic
992042290 5:72848139-72848161 CGCCGCGGCCGCCGAGCGCAAGG - Intronic
992105747 5:73448075-73448097 CGCCGCCGGGGCCGGGCCCGGGG + Exonic
992769700 5:80035497-80035519 CGCCGTCGCCCCCGGCCTCGCGG + Exonic
992796111 5:80256154-80256176 CTGCTCCGCCGCCGGGCGCCCGG - Intergenic
994043492 5:95284236-95284258 TGCCGGCGCCGCCGGGCTCCAGG + Exonic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
996308561 5:122077860-122077882 CGCCGGCGGCTCCGGGCGCCTGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997975422 5:138439131-138439153 CGCCGCCGCCGCTCGGCCTCAGG + Exonic
999733468 5:154493595-154493617 CTCCTCCGCAGCCGGGTTCCCGG + Intergenic
1000014718 5:157266549-157266571 TGTCGCCGCTGCCGGGCTCGCGG - Intronic
1000220521 5:159209541-159209563 CGCGGCCGCCGCAGAGCGCCGGG - Intronic
1001065117 5:168529693-168529715 CGTCGCCGCCGCCGCGCCCCCGG - Exonic
1001556562 5:172641238-172641260 CGCCGCCGCCGCCTCCCTCCCGG + Intergenic
1001639130 5:173232893-173232915 CGCCGCCGCCGCCTGCCCGCAGG - Exonic
1001826736 5:174751388-174751410 GGCCGCCGCCTCCGTGCGCCTGG - Intergenic
1002176605 5:177404453-177404475 CCCCTCCGCCCCAGGGCTCCGGG - Intronic
1002424523 5:179167342-179167364 CGCGGCCGCACCCGGGCTCCCGG + Intronic
1002456016 5:179345649-179345671 CGCCGCCGTCGCCGCGGTGCCGG + Intergenic
1002784921 6:393158-393180 CGCCTCGGCCGCCGCCCTCCAGG - Exonic
1002816541 6:686245-686267 AGCCGCCGCGCCCGGCCTCCTGG + Intronic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1002927302 6:1611774-1611796 CGCCGCCGCCGCCGTGACTCAGG - Exonic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1004208640 6:13615484-13615506 CGGCGCGGCCGCCGAGCCCCTGG + Exonic
1005040306 6:21595029-21595051 CGCCGCCGCCGCCGCCCCCATGG - Exonic
1005040345 6:21595191-21595213 CGCCGCCGCCGCCGCCTGCCAGG - Exonic
1005895204 6:30172013-30172035 CGCCGCCGTCGCCCAGCTGCAGG - Exonic
1005915172 6:30345155-30345177 CGCCATCACCGCCGCGCTCCAGG - Exonic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1006634414 6:35452133-35452155 CCCCGCCCCCGCCCCGCTCCAGG + Intergenic
1006919105 6:37615819-37615841 CGCCCCCTCCTCCAGGCTCCTGG + Intergenic
1006932835 6:37697818-37697840 CGCGGCGGCCGCTCGGCTCCGGG + Exonic
1007584261 6:42979055-42979077 CGCCGCCGGCCACGGGCCCCCGG + Exonic
1007630306 6:43269747-43269769 AGCCGCCGCCGCCGGGGTGAGGG - Intronic
1010141912 6:72622219-72622241 GGGCGGCGCCGCCGGGCTCTGGG + Exonic
1010198459 6:73263030-73263052 CGCCGCCGCCGCCCTACTCAGGG - Exonic
1011099765 6:83708623-83708645 CGGCGCCTCCGCAGAGCTCCCGG - Intronic
1011516983 6:88166037-88166059 CGGCGCCGGCGCCGGGCTGCTGG + Exonic
1011517133 6:88166593-88166615 CTCCTCCGCCGCCGCGCTCCCGG + Intergenic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013272687 6:108558636-108558658 CCCAGCCGCCTCCGGGCTCCGGG - Intergenic
1013667959 6:112367119-112367141 CGCCTCTGCCGCCGGCCACCTGG - Intergenic
1014798064 6:125748429-125748451 CCCAGCCGCCGCCAGTCTCCCGG + Intronic
1015994930 6:138987900-138987922 CGCAGCCGCAGCCGCGCGCCGGG - Exonic
1016010765 6:139135539-139135561 CGCCGCCGCCGCCCCGCAACCGG - Exonic
1017164022 6:151391105-151391127 ACTCGCCGCCGCCTGGCTCCGGG + Intronic
1017446351 6:154510342-154510364 CCCCGCCGCCGCCGGGATCCCGG + Exonic
1017470573 6:154733862-154733884 CTCTTCCGCCGCCGGGCTCGGGG + Exonic
1017672410 6:156779287-156779309 CGCCGCCGCCGCCTGGGACTGGG - Exonic
1017696602 6:157021747-157021769 GGCCGCCGCCTCCCGCCTCCAGG - Intronic
1017725822 6:157275193-157275215 CGCCGCCCGCGCCCGGCCCCGGG - Intergenic
1018679664 6:166253462-166253484 GGTGGCGGCCGCCGGGCTCCAGG - Intergenic
1019151303 6:170007764-170007786 CTGCGCCGCCCCCGGGCTCACGG - Intergenic
1019298399 7:290827-290849 CGCCGCCCCCGACGGGCCCCGGG + Intergenic
1019373579 7:676768-676790 CGCCGCCCTCCCCGGCCTCCAGG - Intronic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019536129 7:1530785-1530807 CGCCGCCGCCGCCTGGCGCTCGG - Exonic
1019547579 7:1585893-1585915 CGCCGCCACCCCAGGGCTGCCGG - Intergenic
1019562585 7:1665936-1665958 CGCCGGCTCCGCTGGGCTCCGGG + Intergenic
1019562634 7:1666080-1666102 CGCCGCCGCCGCCGCGCTCGGGG + Intergenic
1020109356 7:5439580-5439602 CCCCGCCCCCGCCTGGCTGCCGG + Intronic
1020238462 7:6374458-6374480 CGCCGCCGCTCCCAGGTTCCGGG - Intergenic
1020278240 7:6637334-6637356 CGCCGCCGTCGCGCAGCTCCCGG + Exonic
1021231099 7:18086896-18086918 CGCCGCCGCCGCCGCGCGGGGGG - Intergenic
1022106157 7:27199456-27199478 CGCCGCCGCCGCCGCCTTCGCGG - Exonic
1022113067 7:27243201-27243223 GGCCTCCCCCGCCGCGCTCCCGG - Exonic
1022428003 7:30285717-30285739 GGCCGCCGCCGCCGTCCTCAGGG - Exonic
1022698065 7:32728897-32728919 CGCCGCCGCCGCCATCCTCAGGG - Intergenic
1023418042 7:39950434-39950456 CGCAGCAGCCTCCGGGCCCCAGG - Exonic
1023865372 7:44235826-44235848 CTCCCCCACCGCCTGGCTCCAGG + Intronic
1023972288 7:45000231-45000253 GCCCGCCGCCCCCGCGCTCCCGG - Intronic
1024579920 7:50793242-50793264 CGCCGCCTCCGCGTGGCTGCGGG + Intronic
1024579946 7:50793331-50793353 CGCCGGCGGCGCGGGGCGCCCGG - Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025941376 7:66078155-66078177 CGCCTCCCCCAGCGGGCTCCTGG - Intronic
1026765066 7:73155107-73155129 CGCGCCCGGCGCCGAGCTCCCGG + Intergenic
1027041539 7:74964862-74964884 CGCGCCCGGCGCCGAGCTCCCGG + Exonic
1027082103 7:75237507-75237529 CGCGCCCGGCGCCGAGCTCCCGG - Intergenic
1028762259 7:94509687-94509709 CGCAGCCGCCGCCGCCCGCCGGG + Intronic
1029390753 7:100272328-100272350 TGCTGCCGCCGCCGGGCGGCCGG + Intergenic
1029614836 7:101649752-101649774 AGCCACATCCGCCGGGCTCCGGG - Intergenic
1029640334 7:101816184-101816206 CCCCGCCGCCGCGGGCCCCCCGG - Intronic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1030138704 7:106284573-106284595 CGCCGCCGCCGCGCGCCCCCAGG + Intronic
1030358453 7:108569585-108569607 CGTCGCCGGCCCCGGTCTCCAGG - Exonic
1030727198 7:112939762-112939784 CGCCGCCGCCGCCGCCCCTCAGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031532001 7:122886666-122886688 CGCCTCTGCCGGCGGGCTCTGGG - Intronic
1031629852 7:124033039-124033061 CGCCGCCGCTGCCGGGTGCGCGG + Intergenic
1031899187 7:127391919-127391941 GGCGGGCACCGCCGGGCTCCGGG + Intronic
1032391277 7:131556701-131556723 CGCCGCCGCTGGCGGGCTCCTGG - Intronic
1032506200 7:132436412-132436434 GGCTTCCGCCGCCTGGCTCCAGG - Intronic
1033299634 7:140175724-140175746 TTCAGCCGCCGCCGCGCTCCGGG - Intronic
1033477213 7:141702262-141702284 CGCCTCCGCGGCGGGGCCCCGGG - Intergenic
1034174619 7:149090810-149090832 GGCAGCCGCGGCCGGGCGCCGGG - Intergenic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034522669 7:151632440-151632462 CGCTGCCGCCCTCGAGCTCCCGG - Intronic
1034578927 7:152025927-152025949 CGCCGCCGCCGCAGCTCTCGAGG - Intronic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1034977671 7:155457775-155457797 CGCGGCCGCCGCCCCGCTGCGGG - Intergenic
1035153301 7:156892852-156892874 CGTCCCCGCCCCCGGGCCCCCGG - Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035431976 7:158829373-158829395 CCCCGCCGGCGCCCGCCTCCGGG + Exonic
1035569289 8:661319-661341 CCCAGCTGCCGCCAGGCTCCAGG - Intronic
1035629798 8:1098617-1098639 CGCCACCCACGCCAGGCTCCCGG + Intergenic
1035629811 8:1098654-1098676 CGCCACCCACGCCAGGCTCCCGG + Intergenic
1035629825 8:1098691-1098713 CGCCACCCACGCCAGGCTCCCGG + Intergenic
1035629839 8:1098728-1098750 CGCCACCCACGCCAGGCTCCCGG + Intergenic
1035629853 8:1098765-1098787 CGCCACCCACGCCAGGCTCCCGG + Intergenic
1035752097 8:2003058-2003080 CGCCGACCCCGCCGGCCTACGGG - Exonic
1036210135 8:6834810-6834832 CGCCGCGGCTGGCGGGCTCTGGG + Intronic
1036733238 8:11284570-11284592 CGCCGCTGCCGTTGGGCTCCGGG - Exonic
1036789502 8:11708672-11708694 CGCCGCCGCTGCCGCGGCCCGGG + Exonic
1037305143 8:17496999-17497021 CACCGCCTCCTCCGCGCTCCCGG - Intergenic
1038017599 8:23528815-23528837 CGCGGCGGCCGCCGGCCTCTTGG + Exonic
1038466893 8:27772614-27772636 CGCGGCGGCCGCCTGGCCCCCGG + Exonic
1038963587 8:32548343-32548365 AGCCGCCGCCGCTCAGCTCCTGG - Intronic
1039608466 8:38901359-38901381 CGCCGGGTCCGCCGCGCTCCAGG - Exonic
1039921502 8:41896905-41896927 CGCCGCGCCGGCCGGGCCCCCGG - Intergenic
1040850834 8:51899086-51899108 CTCCGGAGCCGCCGGGGTCCGGG + Exonic
1041355307 8:56993650-56993672 CGCCGCAGCCGCCGCGCTCCGGG + Exonic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1042591523 8:70402857-70402879 CGCCGCCGGGGCCCGGCCCCCGG + Intronic
1042785098 8:72537388-72537410 CGCCGCCGCCGCTGCGCCTCGGG + Exonic
1042837892 8:73093450-73093472 GGCCTCCCCCGCCGGGCTCCTGG - Intronic
1043053357 8:75407973-75407995 CTCCGCCGCCGCCCGGGGCCCGG + Intronic
1043388241 8:79768277-79768299 CGTCGCCGTCGCCGGCCGCCCGG - Intergenic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045674067 8:104588986-104589008 CGCCGCCGCCGCCGAGCCACCGG + Exonic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1046103901 8:109644685-109644707 CGCCGCCGCTGCCGCCGTCCAGG + Exonic
1047393682 8:124474895-124474917 AGCCGCCGCCGCCGCCCTCTCGG + Exonic
1047998403 8:130357961-130357983 CGCCGCTGCCGCCGCGCAGCTGG - Intronic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049090588 8:140511221-140511243 CCCCGCCCCCGCCAGGCTCTCGG + Intergenic
1049109416 8:140634396-140634418 CGCAGGCCCCGCCGGGCTCTGGG - Intronic
1049109750 8:140635509-140635531 TGGCGCCGCCGAGGGGCTCCGGG + Exonic
1049396371 8:142402997-142403019 CGCGGCCCCCGCCGGGCTCCGGG + Intronic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049409055 8:142464363-142464385 CTCCGCGGCCGCCGTGTTCCCGG + Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049643784 8:143727204-143727226 CCGCGCCGCCGCCGGGATCACGG + Exonic
1049668387 8:143858949-143858971 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049668803 8:143860548-143860570 CACCGCCGCCGCCCGCCGCCAGG - Exonic
1049669218 8:143862150-143862172 CACCGCCGCCGCCCGCCGCCAGG - Exonic
1049669633 8:143863752-143863774 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049670043 8:143865345-143865367 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049694487 8:143976753-143976775 CGCCGCCTCCGCCGCTCTCCCGG - Intergenic
1049762195 8:144336647-144336669 CGCCGCCGCCCCCGGGGGCATGG - Intergenic
1049788394 8:144462216-144462238 AGCCCCCGCCGCGGGGCCCCAGG - Intronic
1049988128 9:970876-970898 CGCCGCCGCCCCGGGGCCCTTGG + Intergenic
1051483131 9:17579795-17579817 CCCCGCCGCCCGCAGGCTCCAGG + Intronic
1052888841 9:33677024-33677046 CGCCGCCGCCGCCGTGTTGGAGG + Intergenic
1053070207 9:35096573-35096595 CGCCGCCGCCGCCGCACTTCCGG - Intronic
1053815034 9:41898818-41898840 CGCCGCCCCCGCCGCGCAGCGGG + Exonic
1054368734 9:64369316-64369338 CGCGGTTGCTGCCGGGCTCCCGG - Intergenic
1054527984 9:66153191-66153213 CGCGGTTGCTGCCGGGCTCCCGG + Intergenic
1054615562 9:67288623-67288645 CGCCGCCCCCGCCGCGCAGCGGG - Intergenic
1054676362 9:67859068-67859090 CGCGGTTGCTGCCGGGCTCCCGG - Intergenic
1054798675 9:69325549-69325571 CGCCGCTGCCGCCGCGGCCCCGG + Intronic
1055611890 9:78031962-78031984 CGCCGCCGCCTCCTCCCTCCCGG - Intergenic
1055757567 9:79572458-79572480 CGCCGCGGCCGCCGCTCACCCGG - Intronic
1056243261 9:84669844-84669866 CGCCGGCGGCGCCTGGGTCCAGG - Exonic
1056475219 9:86946500-86946522 GGCCGCCGCCGCCGCTTTCCCGG - Exonic
1057259764 9:93576983-93577005 CGCCGCCGCCGCCGCATTCCGGG + Intronic
1057312090 9:93949022-93949044 GGCTGCGGCCCCCGGGCTCCGGG + Intergenic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057600068 9:96450173-96450195 CTCCGCCGCCACCGCCCTCCGGG - Intergenic
1057623267 9:96655224-96655246 CGGCGCCGCCGCCCTGGTCCCGG - Exonic
1058053229 9:100427079-100427101 AGCTGCGGCCGCCGGCCTCCAGG - Intergenic
1058053289 9:100427260-100427282 CGCCGCCGCCGCCCGGCGTTCGG + Intronic
1058843661 9:108934452-108934474 CGCCGCCACCCCCGCCCTCCGGG - Exonic
1059414796 9:114155976-114155998 CGCCGCCGCCGCTGTGCCTCGGG - Exonic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1060355690 9:122905146-122905168 CCGCGCCGTCGCGGGGCTCCCGG - Intronic
1060672888 9:125485774-125485796 GGCCGCAGCTGTCGGGCTCCAGG - Intronic
1060811706 9:126614158-126614180 AGCCGCCGCCGCCGGGTTCCGGG + Intergenic
1060916963 9:127397517-127397539 CGCCGCCGCCTCCTGGTTCGGGG + Exonic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1060979946 9:127786066-127786088 TCCCGCCGCCGCCGCACTCCAGG - Exonic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1061208511 9:129177630-129177652 CGCCGCCGCCGCGCAGCCCCTGG + Exonic
1061283642 9:129610582-129610604 CGCCTCCGCCTCCGCGCTGCTGG - Intronic
1061347945 9:130042464-130042486 CGCCCCGGCCGCCCCGCTCCCGG + Intronic
1061415385 9:130444700-130444722 CGCCCCCGCCGGCGCGCCCCTGG + Intergenic
1061540738 9:131276925-131276947 CGCCGCGGCCGCCGAGGACCTGG + Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061802763 9:133121185-133121207 CGCCGCCCCCGCCGCGCGCCGGG - Intronic
1061975830 9:134067724-134067746 CGCCACCGCCGCCGCGACCCCGG + Intronic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1062162375 9:135087535-135087557 CCCCGCCGCCCCCTGGCTGCTGG - Intronic
1062230604 9:135479809-135479831 CGCTGCCGCCGCCCCGCGCCCGG - Exonic
1062306022 9:135907484-135907506 CGCCGCCGCCGCCGCTCACCCGG - Intergenic
1062567550 9:137170000-137170022 CTCCGCGGACGACGGGCTCCAGG - Exonic
1062584173 9:137241573-137241595 CGCCCTGGCCGCCGGGTTCCTGG - Intronic
1062626044 9:137441849-137441871 GGCCGCCGCCGTCGGGGTCCGGG + Intergenic
1062696969 9:137880501-137880523 CCCCGCCCCGGCCTGGCTCCTGG - Intronic
1203769178 EBV:40346-40368 CCCCACCCCCGCCGGGCCCCTGG - Intergenic
1203788379 EBV:140767-140789 CCCGGCCGCCCCCGAGCTCCAGG - Intergenic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186496424 X:10015484-10015506 CGCGGCCGCCCCCGCGCCCCGGG + Intergenic
1187163852 X:16786949-16786971 CACCGCCGTCACCGTGCTCCCGG + Intronic
1187363695 X:18649979-18650001 CGCCGCCGCCGCCCCGCTCAGGG + Intronic
1187518158 X:19990960-19990982 CGCCGCCGCCGCCGGCCCCTCGG + Intergenic
1187698169 X:21941123-21941145 CGGCGCGGCCGGCGGGCACCCGG - Intronic
1187915727 X:24150365-24150387 CGCCGCCGCGCCGGGCCTCCGGG - Intronic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1189324667 X:40105336-40105358 CGCCGCCGCCGCCGCAGTCACGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1189335387 X:40168039-40168061 CGCCGCCGCCAGCAAGCTCCTGG - Intronic
1190245709 X:48688927-48688949 CGCCACCGCCGCCCAGCTCCGGG + Exonic
1190308599 X:49101213-49101235 CGCCTCCGCCCCTGCGCTCCGGG - Intergenic
1192329740 X:70165684-70165706 CCCCGCTTCCGCCGGGCTCAGGG + Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196819570 X:119692460-119692482 CGGCGCCGCCGCCGCCCGCCCGG + Intronic
1199793819 X:151177424-151177446 CGCCGCGGCCCTGGGGCTCCAGG + Intronic
1199793951 X:151177868-151177890 CGCCGCCGGCCCCCGGCCCCCGG - Intronic
1200003697 X:153074358-153074380 CCCCGCCTCCGCCTGTCTCCAGG - Exonic
1200100746 X:153688279-153688301 CGCCGCCGCCGCCGCCCGGCCGG + Exonic
1200100758 X:153688306-153688328 CGCCGCCGCCCGCGCGCCCCCGG + Exonic