ID: 1133156765

View in Genome Browser
Species Human (GRCh38)
Location 16:3881090-3881112
Sequence CCGGGCCCGCCCGTCCCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133156754_1133156765 20 Left 1133156754 16:3881047-3881069 CCTGGCCGCGGGCTGGGCTCTCG No data
Right 1133156765 16:3881090-3881112 CCGGGCCCGCCCGTCCCGCTGGG No data
1133156757_1133156765 15 Left 1133156757 16:3881052-3881074 CCGCGGGCTGGGCTCTCGGGCGC No data
Right 1133156765 16:3881090-3881112 CCGGGCCCGCCCGTCCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133156765 Original CRISPR CCGGGCCCGCCCGTCCCGCT GGG Intergenic
No off target data available for this crispr