ID: 1133156769

View in Genome Browser
Species Human (GRCh38)
Location 16:3881096-3881118
Sequence CGCCGCCCCAGCGGGACGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133156769_1133156778 24 Left 1133156769 16:3881096-3881118 CCGCCCGTCCCGCTGGGGCGGCG No data
Right 1133156778 16:3881143-3881165 CCCCTTCCCCAGACCCTCCTAGG No data
1133156769_1133156781 27 Left 1133156769 16:3881096-3881118 CCGCCCGTCCCGCTGGGGCGGCG No data
Right 1133156781 16:3881146-3881168 CTTCCCCAGACCCTCCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133156769 Original CRISPR CGCCGCCCCAGCGGGACGGG CGG (reversed) Intergenic