ID: 1133162380

View in Genome Browser
Species Human (GRCh38)
Location 16:3920584-3920606
Sequence ATGGAGAAGCAGGCAGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133162380_1133162391 30 Left 1133162380 16:3920584-3920606 CCGTCCTCTGCCTGCTTCTCCAT No data
Right 1133162391 16:3920637-3920659 TCGAAGACACTGTGCTCCCTCGG No data
1133162380_1133162383 -8 Left 1133162380 16:3920584-3920606 CCGTCCTCTGCCTGCTTCTCCAT No data
Right 1133162383 16:3920599-3920621 TTCTCCATGTCCAGCCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133162380 Original CRISPR ATGGAGAAGCAGGCAGAGGA CGG (reversed) Intergenic
No off target data available for this crispr