ID: 1133164594

View in Genome Browser
Species Human (GRCh38)
Location 16:3937676-3937698
Sequence CAGGCTCTGGAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133164588_1133164594 1 Left 1133164588 16:3937652-3937674 CCTTATGGTCAATAGGCAGCAAG No data
Right 1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG No data
1133164585_1133164594 8 Left 1133164585 16:3937645-3937667 CCGCCTTCCTTATGGTCAATAGG No data
Right 1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG No data
1133164582_1133164594 21 Left 1133164582 16:3937632-3937654 CCACAGGCTCCAACCGCCTTCCT No data
Right 1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG No data
1133164587_1133164594 5 Left 1133164587 16:3937648-3937670 CCTTCCTTATGGTCAATAGGCAG No data
Right 1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG No data
1133164584_1133164594 12 Left 1133164584 16:3937641-3937663 CCAACCGCCTTCCTTATGGTCAA No data
Right 1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133164594 Original CRISPR CAGGCTCTGGAGATGGAGCT GGG Intergenic
No off target data available for this crispr