ID: 1133164889

View in Genome Browser
Species Human (GRCh38)
Location 16:3939294-3939316
Sequence CAGAGCAGGGAGACCCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133164889_1133164897 18 Left 1133164889 16:3939294-3939316 CCAGCCGGGGTCTCCCTGCTCTG No data
Right 1133164897 16:3939335-3939357 CCCCTGCGTGGCGCAGTTACAGG No data
1133164889_1133164900 26 Left 1133164889 16:3939294-3939316 CCAGCCGGGGTCTCCCTGCTCTG No data
Right 1133164900 16:3939343-3939365 TGGCGCAGTTACAGGATCCTTGG No data
1133164889_1133164895 6 Left 1133164889 16:3939294-3939316 CCAGCCGGGGTCTCCCTGCTCTG No data
Right 1133164895 16:3939323-3939345 GCAGATCATCGACCCCTGCGTGG No data
1133164889_1133164902 30 Left 1133164889 16:3939294-3939316 CCAGCCGGGGTCTCCCTGCTCTG No data
Right 1133164902 16:3939347-3939369 GCAGTTACAGGATCCTTGGGCGG No data
1133164889_1133164901 27 Left 1133164889 16:3939294-3939316 CCAGCCGGGGTCTCCCTGCTCTG No data
Right 1133164901 16:3939344-3939366 GGCGCAGTTACAGGATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133164889 Original CRISPR CAGAGCAGGGAGACCCCGGC TGG (reversed) Intergenic
No off target data available for this crispr