ID: 1133168349

View in Genome Browser
Species Human (GRCh38)
Location 16:3964721-3964743
Sequence CACCCCAAGAGGGGTCTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133168349_1133168368 27 Left 1133168349 16:3964721-3964743 CCACTCAGACCCCTCTTGGGGTG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1133168368 16:3964771-3964793 CAAAACACAAAAGAGACATCTGG 0: 1
1: 0
2: 3
3: 50
4: 652
1133168349_1133168360 -10 Left 1133168349 16:3964721-3964743 CCACTCAGACCCCTCTTGGGGTG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1133168360 16:3964734-3964756 TCTTGGGGTGGGGAGGTTGGGGG 0: 1
1: 0
2: 11
3: 138
4: 1151
1133168349_1133168361 -7 Left 1133168349 16:3964721-3964743 CCACTCAGACCCCTCTTGGGGTG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1133168361 16:3964737-3964759 TGGGGTGGGGAGGTTGGGGGCGG 0: 2
1: 6
2: 81
3: 800
4: 6018
1133168349_1133168363 3 Left 1133168349 16:3964721-3964743 CCACTCAGACCCCTCTTGGGGTG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1133168363 16:3964747-3964769 AGGTTGGGGGCGGCCCCAGGTGG 0: 1
1: 1
2: 3
3: 34
4: 315
1133168349_1133168362 0 Left 1133168349 16:3964721-3964743 CCACTCAGACCCCTCTTGGGGTG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1133168362 16:3964744-3964766 GGGAGGTTGGGGGCGGCCCCAGG 0: 1
1: 0
2: 8
3: 57
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133168349 Original CRISPR CACCCCAAGAGGGGTCTGAG TGG (reversed) Exonic
900636211 1:3667027-3667049 CCCCACAAGAGGGGTGAGAGAGG + Intronic
900802679 1:4747144-4747166 GTCCCACAGAGGGGTCTGAGAGG + Intronic
901216692 1:7559173-7559195 CCCGCCAAGAGGGGCCCGAGTGG + Intronic
902571583 1:17350572-17350594 CCCCCCAAGAGTGGGCTGTGTGG - Intronic
902739468 1:18425311-18425333 GACCCCAAGAAGGGTGTGTGGGG - Intergenic
904334102 1:29785819-29785841 CTCCCCAGCAGGGGCCTGAGAGG - Intergenic
904865988 1:33579395-33579417 CACACGGAGAGGGGTCTGGGTGG - Intronic
905276831 1:36823953-36823975 CACCTCAAGAGAGGTGTGAGTGG + Intronic
906147663 1:43569522-43569544 TACCCCCAGAGGGGTCATAGGGG + Intronic
907259991 1:53210778-53210800 CACCCCAAGAGTGCTCAAAGTGG - Exonic
915002772 1:152608679-152608701 CACCACAAGAGTGTTCTGACTGG - Intergenic
915509318 1:156377946-156377968 GAGCACAAGAGGGGTCAGAGAGG - Intronic
916292808 1:163185217-163185239 CACACGCAGAGGGGTGTGAGTGG + Intronic
917178564 1:172266716-172266738 CACTCCAAGGGGGGTGTGGGTGG - Intronic
920325347 1:205159005-205159027 TACCACCACAGGGGTCTGAGTGG + Intronic
923568483 1:235094025-235094047 CACACCAAGAAGGCGCTGAGAGG + Intergenic
1063463439 10:6228747-6228769 CACCCCAAAAGAGCTCCGAGTGG + Intronic
1064031710 10:11887056-11887078 CCCCGCAGGAGGGGTCTGAGGGG + Intergenic
1067181215 10:43987275-43987297 CACACCCAGGAGGGTCTGAGTGG + Intergenic
1067693674 10:48520382-48520404 CAGCCCAGGAGGGGCCTAAGGGG + Intronic
1073494586 10:103879720-103879742 CAGCCCAAGAGGGGCCAGGGCGG + Intergenic
1076730705 10:132437510-132437532 CACACCAAGAGGTGATTGAGGGG - Intergenic
1077034224 11:487159-487181 GACCCCAAGTGTGGGCTGAGGGG - Intronic
1077178065 11:1199529-1199551 CACCCCTAGATGGGTTTGGGGGG + Intronic
1077407500 11:2389169-2389191 AACCCCAGGAGAGGTCTGAAGGG + Intronic
1080830602 11:35890255-35890277 CACCACGAGATGGGTCTGGGAGG + Intergenic
1082834193 11:57639866-57639888 CACACCAACAGGGGGCAGAGGGG - Intergenic
1084448860 11:69220796-69220818 CAGCCCACGAGGGCTCTGGGTGG - Intergenic
1086107202 11:83158229-83158251 CACCCCAAAATGGGGCTGACGGG - Intronic
1087752669 11:102023189-102023211 CACGCCAAGATGGCTCTGAGAGG - Intergenic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1089701279 11:120245616-120245638 GACCCCAAGAGGAGACTTAGGGG + Intronic
1091192203 11:133705467-133705489 CACCCCAAGAGGTGGCTGTGGGG - Intergenic
1092744775 12:11662884-11662906 GACCTCAAGTGGGGTCTGTGTGG + Intronic
1094378511 12:29817475-29817497 AGTCCCAAGAGGGGTTTGAGAGG + Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG + Intronic
1096183535 12:49564378-49564400 GGCCCCAGGAGGGGTCTGGGAGG - Intronic
1098311900 12:69156993-69157015 GACCCCAGAAGGGGTCTGAGGGG - Intergenic
1103679523 12:122682105-122682127 CACGCCTGGAGGCGTCTGAGAGG - Intergenic
1104838577 12:131808813-131808835 CACCCCGAGAGGGTTCTGTCTGG - Intergenic
1104930759 12:132338291-132338313 CACCCAGAGAGGCGTCTGTGTGG - Intergenic
1109627455 13:64994037-64994059 CTCCCTAAGAGAGCTCTGAGTGG - Intergenic
1124880766 15:33640440-33640462 CACCCCAGGAATGGTCTGAGCGG + Intronic
1125524205 15:40365030-40365052 CACCCCAAGGCAGGTCAGAGGGG + Intronic
1127814154 15:62591905-62591927 GACCCCCAGAGGGTGCTGAGTGG + Intronic
1128604654 15:69027817-69027839 CACCCCAAGTGGGGTGAGACAGG + Intronic
1129675658 15:77631561-77631583 CACCCCGAAAAGGGTGTGAGGGG + Intronic
1131456327 15:92585233-92585255 CAGCCCCAGAGCGGCCTGAGTGG - Intergenic
1131459163 15:92606421-92606443 CCCCCAAAGAGGTGTCTGAGGGG + Intergenic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1137621052 16:49876777-49876799 CGCCCCGGGAGGCGTCTGAGAGG + Intergenic
1138217919 16:55221682-55221704 AGCCCCAAGAGGGGTTTCAGAGG - Intergenic
1138502743 16:57458155-57458177 CTCTCCAAGAGGTGTATGAGGGG - Intronic
1139318293 16:66092110-66092132 GACCCCCAGAGTGGGCTGAGGGG - Intergenic
1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG + Intronic
1141923744 16:87153549-87153571 CATCCCCAGTGGGGTCTGGGGGG - Intronic
1142344394 16:89544845-89544867 CACACCAAGAAGTGTCTTAGAGG - Intronic
1203115559 16_KI270728v1_random:1486449-1486471 CTCCCCAAGAGTCCTCTGAGTGG + Intergenic
1142579503 17:932661-932683 CACCGGAAGAGGCTTCTGAGAGG + Intronic
1146187091 17:30731330-30731352 CACCGTAAGAGCGGTCAGAGAGG - Intergenic
1146332126 17:31936690-31936712 CACCGTAAGAGTGGTCAGAGAGG - Intergenic
1146567907 17:33929127-33929149 CATCCAATGGGGGGTCTGAGGGG - Intronic
1146791010 17:35750483-35750505 CCCCCTAGGAGGGGTCTGGGCGG + Intronic
1146902043 17:36594943-36594965 AAACCCAACAGGGGTCTGACTGG - Intronic
1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG + Intronic
1149791678 17:59483156-59483178 CAAACAAAGAGGGGACTGAGAGG - Intergenic
1150142088 17:62738814-62738836 AAACCCAGGAGGGGCCTGAGAGG - Intronic
1150859580 17:68787403-68787425 CACCCAAAGAGGGGTCTTCAAGG + Intergenic
1151277816 17:73049226-73049248 CACTCCAAGAGGGTCCAGAGAGG + Intronic
1152277020 17:79363818-79363840 CAGCCCCAGAGAGTTCTGAGTGG - Intronic
1152804098 17:82346890-82346912 CTCCCCAGGAGGGCTCCGAGGGG + Intergenic
1155493363 18:26420830-26420852 CACGCCACGAGGGGGCTGAGCGG - Intergenic
1160680251 19:408931-408953 CACCCCAAGCGGAGTCGGGGAGG - Intronic
1164424608 19:28130141-28130163 CACCTCAAGAGGGGTCATAAAGG + Intergenic
1164541801 19:29127018-29127040 AACCCCAAGGGAGGTCTGTGAGG + Intergenic
1165391716 19:35542867-35542889 TACCCCAAGAGGGGTAAGGGTGG + Intronic
1165728135 19:38126396-38126418 CAGCCCAAGAGGGCTTTGAATGG + Intronic
1165806369 19:38583545-38583567 AGCCACAAGAAGGGTCTGAGTGG - Intronic
1165882536 19:39053864-39053886 CACCCCGGGAGGGTTCTGGGCGG - Intergenic
1166342176 19:42144769-42144791 CACCCCAAGGCGGGTCAGAGAGG + Intronic
1166888212 19:45973865-45973887 CACCCCGAGCAGGGTCTGGGGGG - Intergenic
932451549 2:71813746-71813768 CACACCAAGAGGTCTCTGACAGG - Intergenic
936079660 2:109423659-109423681 GCCCCCAAGAGGTGTCTCAGAGG + Intronic
940201093 2:151151836-151151858 CTCACAAAGAGGGGTATGAGAGG - Intergenic
941254973 2:163217554-163217576 CACCCCATGCATGGTCTGAGAGG + Intergenic
947582519 2:231330469-231330491 CACCCCAGGAAGGGTGTGAGGGG + Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
947745459 2:232504946-232504968 GTCCCAAAGATGGGTCTGAGGGG + Intergenic
948503240 2:238410015-238410037 CAGCTCAAGGGGCGTCTGAGAGG - Intergenic
1168823057 20:789694-789716 CTCAGCAAGAGGGGACTGAGAGG + Intergenic
1169959253 20:11140641-11140663 CACCCTCTGAGGTGTCTGAGTGG + Intergenic
1171362914 20:24602572-24602594 GACCATAAGAGGTGTCTGAGAGG - Intronic
1175321963 20:58094533-58094555 AACTCCAAGAGTGATCTGAGAGG - Intergenic
1175625144 20:60483657-60483679 AACCCCAAGTGGGGTCTGCTGGG + Intergenic
1176039120 20:63055128-63055150 CAACCCCAGTGGGGACTGAGAGG + Intergenic
1178439193 21:32584582-32584604 CATCCAAAGAGGGGTGTGAGTGG + Intronic
1179618107 21:42594803-42594825 CATCCCCAGAGGGCTCTGATAGG - Intergenic
1180924505 22:19544433-19544455 CAGCCCCAGAGGGGTGTGGGTGG - Intergenic
1181343316 22:22199754-22199776 CTCCCAAAGAGGCATCTGAGTGG + Intergenic
1183261502 22:36798593-36798615 CACCCCATGCTGGGTCTGTGTGG - Intergenic
1183989342 22:41587802-41587824 CTCCCCAAGTGCGGTCAGAGTGG + Intronic
950130986 3:10546524-10546546 CACCCCATGTAGGGGCTGAGTGG - Intronic
950515934 3:13465332-13465354 CACCCCAAGAGGGTTGGGACTGG - Intergenic
950607387 3:14094891-14094913 CAACACAAAAGGGCTCTGAGAGG + Intergenic
953561831 3:43998266-43998288 CGCCCCAAGAGGGGGCCGTGGGG + Intergenic
954614233 3:51961315-51961337 CAGCCAAAGAGGGGTTCGAGAGG + Intronic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
955742149 3:62102706-62102728 GACCCCTGGAGAGGTCTGAGAGG + Intronic
960615929 3:119595958-119595980 CTCTCCAAGCGGGGTCAGAGTGG - Intergenic
961819833 3:129570365-129570387 CACCCCAGGATGGCTCTGACTGG - Intronic
963254362 3:143130103-143130125 TACCCCAAGAGGTGTCTGGGAGG + Intergenic
963335701 3:143971915-143971937 CACGACAAGTGGGGTCTGCGAGG - Exonic
967977066 3:195041348-195041370 CATCCCCAGAAGGGCCTGAGAGG + Intergenic
968067412 3:195766392-195766414 CAGCCCAAGAGGGCTCTCGGGGG - Intronic
968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG + Intergenic
969584819 4:8085506-8085528 CACCCCCAGAGCCGTGTGAGTGG - Intronic
978619387 4:110623179-110623201 CACCCGGAGAAGGGTCTGGGAGG - Intronic
981681902 4:147409006-147409028 CACCCCAGGAAGCATCTGAGTGG + Intergenic
982157266 4:152535383-152535405 GACCCCCGGAGGGGGCTGAGGGG + Exonic
985625569 5:983430-983452 CAGCCCAAGTGGGGACAGAGGGG + Intergenic
986874861 5:12095516-12095538 CAGCCCAAGAGGGTTATGAGTGG - Intergenic
991038996 5:62157376-62157398 AACCCCAAGAGAGCTGTGAGAGG + Intergenic
999238547 5:150114307-150114329 TACCCCAAGAAGGATGTGAGAGG - Exonic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
1001179532 5:169506573-169506595 CATCCAAAGAGTGGTCTTAGTGG - Intergenic
1004308347 6:14521553-14521575 GACCTCAAGAGGGGACTGAGGGG - Intergenic
1006836822 6:37004155-37004177 CACCCCAAGCCTCGTCTGAGTGG - Intergenic
1007718308 6:43870025-43870047 CAGCCCCAGTGGGGCCTGAGAGG - Intergenic
1017468116 6:154713716-154713738 AAACCCAAGAGTGGTTTGAGGGG + Intergenic
1019368159 7:645855-645877 GAGCCCCAGAGGGGTCTGACTGG - Intronic
1019596190 7:1859513-1859535 CCCCACAAGTGGGATCTGAGTGG + Intronic
1020989551 7:15179950-15179972 AATCCCAAGATGGCTCTGAGTGG + Intergenic
1023982033 7:45075963-45075985 CACCCTCAGAGGGGGATGAGTGG + Exonic
1024548461 7:50541094-50541116 CAGCCTGAGAGGGGTCTGAATGG - Intronic
1028617320 7:92783081-92783103 AACCTCAAGTAGGGTCTGAGAGG - Intronic
1029113282 7:98224079-98224101 CTCCCCAAAAGGGCTCTGATGGG - Intronic
1034994629 7:155570305-155570327 CACCCCAAGTGAGCTCAGAGAGG + Intergenic
1035240258 7:157524406-157524428 CACCCCATGACTGGTCTAAGAGG - Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1042047995 8:64675917-64675939 CACCCCCAGGGGGGTCTCTGAGG + Intronic
1045393370 8:101736730-101736752 CAAACCAAGTGGGGTCTGGGCGG + Intronic
1046538821 8:115552099-115552121 TGCTCCAAGAGAGGTCTGAGGGG + Intronic
1049021465 8:139960333-139960355 CACCCCAACAGGAGTCTCACTGG - Intronic
1049353709 8:142177532-142177554 GACCCCAAGGGGGGTCTGGAGGG + Intergenic
1053152886 9:35754144-35754166 GAGGCCAAGAAGGGTCTGAGAGG - Exonic
1055701978 9:78954580-78954602 CACCCCAAGAGGTATCAGTGAGG - Intergenic
1055734718 9:79314588-79314610 CACCCTCAAAGAGGTCTGAGTGG - Intergenic
1056445525 9:86662880-86662902 CACCCCAAGAGGGTTGTCAGAGG + Intergenic
1057874088 9:98740211-98740233 CAGCACAAGAGGTGTCTGTGTGG - Intronic
1058376502 9:104328234-104328256 CAGCCCCAGAGGAGTTTGAGGGG + Intergenic
1060743367 9:126113976-126113998 CACTCCAAGAGGGCTGTGTGCGG - Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061300820 9:129703974-129703996 GACCCCAAGAGGGGGCAGAGGGG + Intronic
1185562369 X:1069590-1069612 GACCCCAGGATGGGGCTGAGAGG + Intergenic
1190640872 X:52482035-52482057 GAGCCCAAAAGGGGTCTGTGGGG - Intergenic
1190646800 X:52530830-52530852 GAGCCCAAAAGGGGTCTGTGGGG + Intergenic
1191055225 X:56233422-56233444 AACCCCAAGTGGGGTGTGTGGGG - Intronic
1196398162 X:115288380-115288402 CAGCCCAAGAGGAGCCTGGGAGG + Intergenic
1198325237 X:135564861-135564883 TTCTCCAAGAGGGGTGTGAGAGG - Intronic
1198751391 X:139939483-139939505 CACACCTAGAGAGGTCAGAGGGG + Intronic