ID: 1133169430

View in Genome Browser
Species Human (GRCh38)
Location 16:3972066-3972088
Sequence GGGGGCTGCCTCGCAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133169423_1133169430 24 Left 1133169423 16:3972019-3972041 CCAAGGAAGAAAAGCCATCACAC 0: 1
1: 0
2: 2
3: 22
4: 214
Right 1133169430 16:3972066-3972088 GGGGGCTGCCTCGCAACAGAAGG 0: 1
1: 0
2: 1
3: 6
4: 94
1133169424_1133169430 10 Left 1133169424 16:3972033-3972055 CCATCACACACAGCATGTGCACT 0: 1
1: 0
2: 3
3: 31
4: 225
Right 1133169430 16:3972066-3972088 GGGGGCTGCCTCGCAACAGAAGG 0: 1
1: 0
2: 1
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133169430 Original CRISPR GGGGGCTGCCTCGCAACAGA AGG Intronic
900279656 1:1858463-1858485 GGGTGCTGCCTGTCACCAGAGGG - Intronic
900461974 1:2805943-2805965 GTGGGCAGCCTCGCAGCAGTGGG - Intergenic
900598911 1:3494733-3494755 GGGGGCAGCCTGGAGACAGAAGG + Exonic
903788024 1:25874537-25874559 AGGGGCAGCCTCTCAACAAAAGG + Intergenic
906035811 1:42749808-42749830 GAGGGCTGTCTTTCAACAGATGG + Intronic
906311241 1:44756029-44756051 GGGTGCTCCCTGGAAACAGAAGG - Intronic
918216037 1:182392254-182392276 GGAGGCTCCCTCGCAACAAAAGG - Intergenic
921351064 1:214235357-214235379 GAGGGCTGCCTCGGTTCAGAGGG - Intergenic
922806470 1:228392680-228392702 GGGGGCTGCCTCACTCCAGGAGG + Intergenic
1062916081 10:1242063-1242085 GGGGGCTGCCAGGGAGCAGATGG - Intronic
1062987723 10:1785131-1785153 GAGGGCAGCATTGCAACAGACGG - Intergenic
1063378046 10:5565904-5565926 GGAGGCTTCCTCCCAACAGGCGG - Intergenic
1069919370 10:71807267-71807289 GGGGGCTGCCTTTCTGCAGAGGG - Exonic
1070312976 10:75287207-75287229 GGTGGCAGCCACCCAACAGATGG - Intergenic
1070596782 10:77838216-77838238 GGGGGCTGCCCTTCTACAGACGG + Intronic
1078018040 11:7632245-7632267 AGGGGCTCCCTCTCACCAGAGGG - Intronic
1079733290 11:23962484-23962506 GAGGACTGCCTGCCAACAGAGGG + Intergenic
1080978053 11:37365497-37365519 GGTGGCTGCATCCCCACAGAAGG + Intergenic
1083447170 11:62715864-62715886 GGGGGCAGCCTGGAAACAGAGGG - Exonic
1087176981 11:95105139-95105161 GGGGCCTGGCTGGAAACAGATGG + Intronic
1087736395 11:101839212-101839234 TGGGGCTGCCTGGGAAGAGATGG + Intronic
1089984350 11:122799071-122799093 TGGGGCTGCCTAGAAAGAGAGGG - Intronic
1095465943 12:42488157-42488179 GGGGGCTGCCTTGGAACAACAGG - Intronic
1096544607 12:52328947-52328969 TGGTGCTGCCTTGCAACATATGG + Intergenic
1100325069 12:93532642-93532664 GGGGCCTGTCTCACAACAGGTGG + Intergenic
1118705557 14:68477295-68477317 GAGGGCTTCCTGGCTACAGATGG + Intronic
1119132624 14:72188685-72188707 GGAGGCTGTGTCGCAACACAGGG - Intronic
1119727798 14:76932703-76932725 GGGGGCTGCCGGGAGACAGAGGG - Intergenic
1122372171 14:101234784-101234806 GGGGTCTGCTTGGCAGCAGAAGG + Intergenic
1122771473 14:104099763-104099785 TGGGGCTGCCTTGAAACAGCAGG - Intronic
1125553111 15:40562621-40562643 GGGGGCTGCTTCCCAACAGCCGG + Intronic
1125729220 15:41883359-41883381 GGAGGCTGCCTCCCACCAGCTGG - Exonic
1126680661 15:51199037-51199059 GGAGGCCGCCTCCCAGCAGAGGG - Intergenic
1127811020 15:62565528-62565550 GGGCACTGCCTGGCAACAGTTGG + Intronic
1128143500 15:65318619-65318641 GGGGCCTGCCACCTAACAGATGG - Intergenic
1128867262 15:71123711-71123733 GGGATCTGCCTCCCAACAGGAGG + Intronic
1129120460 15:73393394-73393416 GGGGGCAGGCTGGCAAGAGAAGG + Intergenic
1129392746 15:75228778-75228800 GGGGGCTGCCCTGGGACAGAGGG - Intergenic
1130792186 15:87167416-87167438 GGAAGCTGCCTCACTACAGATGG + Intergenic
1132978237 16:2721061-2721083 GGGGGCTTCCTGGCACCAGGCGG + Intergenic
1132996758 16:2827455-2827477 GGGGGGTGCCTCCCACCAGGTGG + Intergenic
1133169430 16:3972066-3972088 GGGGGCTGCCTCGCAACAGAAGG + Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1135972939 16:27085406-27085428 GGGGGCTGCCTCCCAAGGGCTGG + Intergenic
1136480050 16:30535459-30535481 GGGGGCTTCCAAGAAACAGAAGG + Intronic
1142224171 16:88869588-88869610 GGGGGCTCCATCCCAACAGGAGG - Intergenic
1143923092 17:10346443-10346465 GGAGGCTGCCTGGCTCCAGAGGG + Intronic
1144518519 17:15938137-15938159 GAGTTCTGCCTGGCAACAGAGGG + Intergenic
1146642432 17:34551332-34551354 GGGGGCTGGGTCGCATCAGCAGG + Intergenic
1150005695 17:61467666-61467688 GGGGGCTGCCTGGCCCCAGGAGG + Intronic
1150135129 17:62691195-62691217 GGGGGCTGCTTCACAACTGCAGG + Intronic
1152938359 17:83153224-83153246 GGGGGATGCCTGGCCACGGACGG - Intergenic
1153882608 18:9434250-9434272 GGGGGCAGCCTAGCGACAGGCGG + Intergenic
1157099446 18:44716097-44716119 GGAGGTTGCCTCGGAACAAAGGG - Intronic
1157576765 18:48748895-48748917 GAGGGCTGCCCCGCAACAGAGGG - Intronic
1160404669 18:78637606-78637628 GAGGGCTGCCTCGCCAGGGACGG + Intergenic
1160576021 18:79854150-79854172 GGGGGCTGCCTGTCCACAGGAGG + Intergenic
1168032569 19:53692419-53692441 AGGGGCTCCCTCGTAACAGGTGG + Intergenic
928102414 2:28446962-28446984 GAGGGCTTCCTCTAAACAGAGGG + Intergenic
930709359 2:54535687-54535709 GGTGGTTGCCTGGAAACAGATGG + Intronic
939712309 2:145537590-145537612 GGGGGCTATCTGGCAACAGAGGG + Intergenic
1170685706 20:18567612-18567634 GGGGCCTGCCCCGGAACACACGG + Intronic
1172094043 20:32452103-32452125 AGGGGCTGCCTCACAGCATAGGG - Intronic
1173223408 20:41147095-41147117 GGGAGCTGCCTCCAAACAGGTGG - Intronic
1175488752 20:59364512-59364534 AGGGGCTGCCTCGCACATGACGG - Intergenic
1179138090 21:38698324-38698346 AGGGGCTGCCTCCCAGCAGGAGG - Intergenic
1180051148 21:45331601-45331623 GGGGGCAGCCGCTCAGCAGAGGG + Intergenic
1181094277 22:20495369-20495391 GCGGGCGGCCTTGCAACAGGCGG - Intronic
1181465764 22:23109828-23109850 GGGTCCTGCCTCCCAGCAGAAGG - Intronic
1183669793 22:39265771-39265793 GGAGGCTGCCTCGGAGCAGGTGG - Intergenic
1184212111 22:43042146-43042168 GGGGGCAGCCACGAACCAGACGG - Intronic
1184806958 22:46801654-46801676 AGGGCCTGCCTCGCAGCAGTGGG + Intronic
1185395086 22:50582717-50582739 GGCGGCTGCCTGGCCAAAGACGG - Exonic
952830365 3:37559748-37559770 GGGAGCTGCCTTTCAACACAAGG - Intronic
954863413 3:53709100-53709122 GGGTGCAGCCACACAACAGAGGG - Intronic
960525047 3:118700275-118700297 GGGGGCTGCCAAGAAACTGAGGG + Intergenic
963945722 3:151144095-151144117 GGGGGCTTCCTTCTAACAGAGGG - Intronic
968914078 4:3489562-3489584 GGGGACTGCCACTCCACAGAGGG + Intronic
970882125 4:20944713-20944735 GAGGGCTACCTGGCAGCAGATGG - Intronic
978894820 4:113873933-113873955 CAGGGCTGGCTTGCAACAGAAGG - Intergenic
983216967 4:165010860-165010882 GGAGGCTGCCTCCCATCACAGGG + Intergenic
991953008 5:71965152-71965174 GAGGGCTGTCTCCCAACAGCTGG + Intergenic
998427467 5:142040973-142040995 GGGTCCTGCCTCACACCAGAAGG + Intergenic
999433112 5:151540753-151540775 GGGGTCTCCCTCTAAACAGATGG + Exonic
1001544561 5:172563039-172563061 TGGTGCTGCCTAGCAACAGTGGG + Intergenic
1001551241 5:172603649-172603671 CGGGGCTGCTTCTCAACAAAGGG + Intergenic
1006509127 6:34512312-34512334 GGGGTCTGCCTGGCAGCAGATGG + Intronic
1006861473 6:37174249-37174271 GGAGGCTGCCTCCCAACAGTGGG + Exonic
1009437720 6:63636453-63636475 CGGGGCGCCCTCGCAGCAGACGG - Intronic
1011574712 6:88783368-88783390 GGTGGCTGCCTGGAAACGGAAGG + Intronic
1019365889 7:632580-632602 TGGGGCTGCCTTGGTACAGATGG + Intronic
1027190979 7:75995256-75995278 GGGGGATTCCCCTCAACAGAAGG - Intergenic
1029107433 7:98189790-98189812 GAGGGCTGCCTCACCACAGCAGG - Intronic
1033262803 7:139858181-139858203 GGCTGCTGCCTTGGAACAGATGG - Intronic
1034412033 7:150946909-150946931 GGGGGCTGACGGGCAACAGCGGG + Exonic
1034669754 7:152849056-152849078 GGGGGCTGCCTCTCGAGAAATGG + Intronic
1034970770 7:155417925-155417947 GGGGGCTGCCCCTGAACAGTGGG - Intergenic
1044535727 8:93354592-93354614 GGTGGCTCCCTCCCAAGAGAAGG - Intergenic
1049239713 8:141531009-141531031 GGGGGCTGCCCCGCCCCAGCAGG + Intergenic
1049259269 8:141630056-141630078 GTGGGCTGCCTTGAAACAGGTGG - Intergenic
1055280662 9:74670691-74670713 GGGGGCTGTCTGGCAGGAGATGG - Intronic
1193298776 X:79864351-79864373 GGGGGCTGCAGTGCAACAGCTGG + Intergenic