ID: 1133170096

View in Genome Browser
Species Human (GRCh38)
Location 16:3977525-3977547
Sequence CTCCCTCGCCACCGTCGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133170096_1133170102 1 Left 1133170096 16:3977525-3977547 CCCCCACGACGGTGGCGAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1133170102 16:3977549-3977571 ACCTCATCCAGGAGCTGAGCTGG 0: 1
1: 0
2: 4
3: 21
4: 257
1133170096_1133170101 -10 Left 1133170096 16:3977525-3977547 CCCCCACGACGGTGGCGAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1133170101 16:3977538-3977560 GGCGAGGGAGGACCTCATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 242
1133170096_1133170105 26 Left 1133170096 16:3977525-3977547 CCCCCACGACGGTGGCGAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1133170105 16:3977574-3977596 GAAGTTACAGTAGTGCACGACGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133170096 Original CRISPR CTCCCTCGCCACCGTCGTGG GGG (reversed) Exonic