ID: 1133170096

View in Genome Browser
Species Human (GRCh38)
Location 16:3977525-3977547
Sequence CTCCCTCGCCACCGTCGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133170096_1133170101 -10 Left 1133170096 16:3977525-3977547 CCCCCACGACGGTGGCGAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1133170101 16:3977538-3977560 GGCGAGGGAGGACCTCATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 242
1133170096_1133170105 26 Left 1133170096 16:3977525-3977547 CCCCCACGACGGTGGCGAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1133170105 16:3977574-3977596 GAAGTTACAGTAGTGCACGACGG 0: 1
1: 0
2: 0
3: 4
4: 52
1133170096_1133170102 1 Left 1133170096 16:3977525-3977547 CCCCCACGACGGTGGCGAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1133170102 16:3977549-3977571 ACCTCATCCAGGAGCTGAGCTGG 0: 1
1: 0
2: 4
3: 21
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133170096 Original CRISPR CTCCCTCGCCACCGTCGTGG GGG (reversed) Exonic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
900325720 1:2107843-2107865 CTCCCTCGACACTGCCCTGGGGG - Intronic
900580112 1:3404618-3404640 ATCCCTCGGCAGCGTGGTGGGGG + Intronic
912543357 1:110433504-110433526 CTCCCTCTCCACCCTAATGGAGG + Intergenic
913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG + Intergenic
919712315 1:200739748-200739770 CTCCCTCCCGACCCCCGTGGTGG + Exonic
919842425 1:201619083-201619105 CTCCCTCTCCACTGCAGTGGGGG - Intergenic
1068938314 10:62657443-62657465 CTCCCTCCCCACCAACTTGGTGG - Intronic
1077111017 11:862306-862328 CTCCATGGCCACAGTCGGGGAGG - Intronic
1084113062 11:67025784-67025806 CTCCCTCTCCTCCTCCGTGGAGG + Intronic
1090264010 11:125342812-125342834 CACCCTAGCCACCACCGTGGAGG + Intronic
1090765212 11:129870469-129870491 ATCCCTCCCCACTGTGGTGGGGG + Intronic
1091788864 12:3259739-3259761 CTTCCTCGCCACCCCCGTGCTGG - Intronic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1093736433 12:22625385-22625407 CGCCGTCGCCGTCGTCGTGGTGG + Exonic
1101606043 12:106248143-106248165 CTCCCTCTCCGGGGTCGTGGCGG - Intronic
1106136537 13:26977838-26977860 CTCCCCCGCCACTGTTGTTGGGG + Intergenic
1109047924 13:57437558-57437580 TTCCCTCTCCACCCTGGTGGTGG - Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1117038605 14:51750560-51750582 CTCCCCCACCACCTTCGGGGAGG + Intergenic
1119407472 14:74407600-74407622 CACACTCGCCATCGCCGTGGGGG - Exonic
1122228322 14:100292381-100292403 CACCTTCGCCACCGTCACGGTGG - Exonic
1129778659 15:78254339-78254361 CTCCCTGACCACCCTGGTGGAGG + Intergenic
1130093243 15:80838341-80838363 CTGCCTCGCCACAGTTCTGGAGG - Intronic
1130093616 15:80840447-80840469 CTGCCTCGCCACAGTTCTGGAGG - Intronic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG + Exonic
1141732712 16:85833666-85833688 CTCCCTCACCACCGGGGTGAAGG - Intergenic
1143090093 17:4444978-4445000 CTGCCCTGCCACGGTCGTGGGGG + Intronic
1145026367 17:19470814-19470836 CTCACTCACCACAGTCGTGGGGG + Intergenic
1145276866 17:21436825-21436847 CTCACTCACCACAGTCATGGGGG + Intergenic
1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG + Intergenic
1145713148 17:26994655-26994677 CTCACTCACCACAGTCATGGGGG + Intergenic
1147153419 17:38531353-38531375 CTCCCTGGCCACTGTTTTGGCGG - Exonic
1148615683 17:48998173-48998195 CTTCCTCCCCACCGACGGGGCGG + Intronic
1148664080 17:49361863-49361885 CGCACTCGCCACCGCCGCGGCGG - Intronic
1160716214 19:577985-578007 CTCCATCGACACGCTCGTGGAGG + Exonic
1160869253 19:1269529-1269551 GTCCCTCGCCGCCGGCGGGGCGG - Intronic
1160973580 19:1781125-1781147 CTCCCTCCCCAGCCTCGAGGTGG - Intergenic
1161470550 19:4454949-4454971 ATGCCACGCCACCCTCGTGGCGG + Intronic
1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG + Intronic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
925171664 2:1754029-1754051 CTCCCCTGCTGCCGTCGTGGGGG - Intergenic
928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG + Exonic
948775499 2:240286715-240286737 CTCCCTCACCAGCGTGGTGCAGG - Intergenic
1176418919 21:6499016-6499038 CTCCCCCGCCACCGCCGCGCCGG + Intergenic
1179694412 21:43107338-43107360 CTCCCCCGCCACCGCCGCGCCGG + Intronic
1181182919 22:21079748-21079770 CTCCCTCGGCACTTTCCTGGAGG + Intergenic
1184889619 22:47371830-47371852 CGCCCTCCCCACAGTCGGGGGGG + Intergenic
1185315379 22:50176754-50176776 CCCCCACACCACCGTGGTGGGGG + Intronic
949534790 3:4987208-4987230 CTCCCTCCCCACCGCCGACGGGG - Intergenic
968518873 4:1026783-1026805 CCCCCACCCCACTGTCGTGGTGG + Exonic
968935517 4:3608121-3608143 CTCCCTCTCCACTGAGGTGGGGG + Intergenic
969749738 4:9101010-9101032 CTCCCCCACCAGCTTCGTGGAGG + Intergenic
1002527067 5:179820796-179820818 CGCCCCCGCCACCGTCGTCGCGG - Exonic
1002664124 5:180810296-180810318 CTCCCTCGCTCCCGTGGTGGCGG - Intronic
1003652665 6:7975758-7975780 CTGCCGAGCCACCGTCGGGGTGG - Intronic
1006509607 6:34514960-34514982 CTCCTTCTCCTCCGTGGTGGCGG - Intronic
1007784827 6:44273570-44273592 CTCCCTCCCCACCTCCCTGGGGG + Intronic
1019917337 7:4142128-4142150 CTCCCTCCACACTGTCGAGGTGG - Intronic
1023839461 7:44088260-44088282 CTGCCCAGCCACCCTCGTGGCGG + Intergenic
1024530416 7:50387510-50387532 CTCCTTCCCCACCGTGCTGGGGG - Intronic
1027640911 7:80732864-80732886 CACCATAGCCACCATCGTGGTGG + Intergenic
1028417583 7:90596366-90596388 CGCGCTCGCCGCCGCCGTGGTGG - Intronic
1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG + Intergenic
1034303201 7:150033737-150033759 CTCAGTCCCCACCCTCGTGGGGG + Intergenic
1034801498 7:154058798-154058820 CTCAGTCCCCACTGTCGTGGGGG - Intronic
1034801604 7:154059121-154059143 CTCAGTCCCCACCCTCGTGGGGG - Intronic
1034802003 7:154060649-154060671 CTCAGTCGCCACTCTCGTGGGGG - Intronic
1034802791 7:154063372-154063394 CTCAGTCCCCACCCTCGTGGGGG - Intronic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1038741458 8:30220561-30220583 CTCCCACACCACCCTCGTGAGGG - Intergenic
1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG + Intergenic
1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG + Intronic
1054454667 9:65423736-65423758 CTCCCTCTCCACTGAGGTGGGGG - Intergenic
1060641302 9:125241376-125241398 CTCCCCCAGCCCCGTCGTGGAGG + Intergenic
1062616124 9:137396772-137396794 CTCCTGCTCCACCGTCGGGGAGG + Intronic
1190252571 X:48738069-48738091 ATCCCTCCCTACCTTCGTGGTGG - Intergenic
1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG + Exonic
1200239386 X:154486005-154486027 CTCCTCCTCCACCGCCGTGGGGG + Intronic