ID: 1133172997

View in Genome Browser
Species Human (GRCh38)
Location 16:3993197-3993219
Sequence CCTGAGCGCTGGTTTCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133172987_1133172997 15 Left 1133172987 16:3993159-3993181 CCTTATTGGCCTTTAAAGGAATC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172988_1133172997 6 Left 1133172988 16:3993168-3993190 CCTTTAAAGGAATCCCGCCCAGC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172983_1133172997 30 Left 1133172983 16:3993144-3993166 CCACGCATTTTAAACCCTTATTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172990_1133172997 -8 Left 1133172990 16:3993182-3993204 CCGCCCAGCTCAGCCCCTGAGCG 0: 1
1: 0
2: 8
3: 87
4: 988
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172986_1133172997 16 Left 1133172986 16:3993158-3993180 CCCTTATTGGCCTTTAAAGGAAT 0: 1
1: 0
2: 1
3: 12
4: 209
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172989_1133172997 -7 Left 1133172989 16:3993181-3993203 CCCGCCCAGCTCAGCCCCTGAGC 0: 1
1: 0
2: 10
3: 86
4: 721
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133172997 Original CRISPR CCTGAGCGCTGGTTTCCACG TGG Intronic
900469088 1:2843094-2843116 CCTGAGCTCTGGTTCCCACAGGG + Intergenic
902329746 1:15725462-15725484 CCTGAGAGGTGGTGTGCACGGGG - Exonic
902940057 1:19794418-19794440 ACTGAGTGGTGGTTTCCACTTGG + Intronic
906525585 1:46491368-46491390 CCTCAGCGCTGGTTCCGACCCGG + Intergenic
909595860 1:77405629-77405651 CCTGAGCCCTGGCTTCCCAGTGG + Intronic
915870770 1:159557405-159557427 TCTGAGCAATGGCTTCCACGAGG - Intergenic
919907003 1:202085206-202085228 CCTGAGCCCTGGGTGCCAGGAGG + Intergenic
1063874159 10:10454906-10454928 CTTGAGGGATGGTTTCCAAGGGG - Intergenic
1064261547 10:13790475-13790497 CTTGAGCCCTGGTGTCCACGAGG - Intronic
1078524296 11:12088829-12088851 CCGGGGTGCTGGGTTCCACGAGG + Intergenic
1080839713 11:35972531-35972553 TCTGAGGGCTGGTTTCCTCTGGG - Intronic
1083776157 11:64895208-64895230 CCTGACCTCTGGCTTCCACAGGG - Exonic
1088794967 11:113260153-113260175 CCTGATCTCTGGTTTCCACTCGG - Exonic
1096417486 12:51426111-51426133 CCTCAGGGATGGTTTCCCCGAGG + Intronic
1102865803 12:116373124-116373146 GCTCAGGGCTGGTTCCCACGAGG + Intergenic
1103898192 12:124288279-124288301 CCCCAGCTCTGGTTTCCACAGGG + Intronic
1104286331 12:127428117-127428139 GCTAATCGCTGCTTTCCACGTGG - Intergenic
1106125203 13:26895508-26895530 CCTGAGCCCTGGGTTGCCCGCGG - Intergenic
1111897045 13:94155000-94155022 CTTGAGCGCTGGTGTCCCCAGGG + Intronic
1113100015 13:106707163-106707185 CCTCAGCTCTGGTTTCCAGCCGG - Intergenic
1114032175 14:18587298-18587320 ACTGAGTGCTGGTGTCCACCTGG - Intergenic
1114076953 14:19166328-19166350 ACTGAGTGCTGGTGTCCACCTGG - Intergenic
1114085207 14:19233240-19233262 ACTGAGTGCTGGTGTCCACCTGG + Intergenic
1115787263 14:36840100-36840122 CGTGAGCTCTGGTTTCCCTGTGG - Intronic
1120278096 14:82403095-82403117 TTTGAGCGCTGTTTTCCAAGTGG + Intergenic
1121094348 14:91205507-91205529 CCCTAGCACTGGTTCCCACGAGG - Intronic
1122389088 14:101368111-101368133 ACTGTGCCCTGGGTTCCACGTGG + Intergenic
1122947711 14:105020803-105020825 CCTGGGCGCTGGTTCCCCCGCGG - Intronic
1125756734 15:42070023-42070045 CCTGAGGGCTGGGTTCCACCCGG + Exonic
1130990748 15:88874296-88874318 CCTGAGTCCTGGTTTCCACAAGG + Intronic
1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG + Intronic
1135141150 16:19923264-19923286 AGTGAGGGCTGGTTTCCAAGTGG - Intergenic
1141156560 16:81601300-81601322 CCTGCCTGCTGGTTTCCATGGGG - Intronic
1141536761 16:84686854-84686876 GCTGAGGGCTGGGTTCCACGAGG + Intergenic
1145347308 17:22049181-22049203 CCTGAGCCCTGATGTCCACCTGG + Intergenic
1157601056 18:48893529-48893551 CTTGAGCCCCGGTTTCCACTGGG - Intergenic
1160021508 18:75185258-75185280 CCTGAGGGCTGGTTTCCAGGGGG + Intergenic
1160906319 19:1453287-1453309 CCCGAGTGCTGGTGTCCTCGGGG + Exonic
1162732836 19:12729245-12729267 GCTGAGAGCTGGATTCCATGGGG - Intergenic
1162737668 19:12755498-12755520 CCTGATGCCTGGTTTCCAAGGGG + Intronic
1163676817 19:18659564-18659586 CCCGAGCGCTGGGCTCCGCGTGG + Intronic
1164602886 19:29575488-29575510 CCTGAGTCCTGGTTGCCACCAGG - Intergenic
1165325833 19:35114267-35114289 CCTAAGGGCTGGTTTCAACCTGG - Intergenic
925025891 2:607034-607056 CCTGAGCACTGTTGTCCAAGAGG + Intergenic
928115629 2:28543506-28543528 CCTCAGCCCTGGTTTCCCAGAGG + Intronic
938491560 2:131763838-131763860 ACTGAGTGCTGGTGTCCACCTGG - Intronic
938496006 2:131798504-131798526 ACTGAGTGCTGGTGTCCACCTGG + Intronic
941688426 2:168471268-168471290 CCTGAGCCCTGGTTACCAGATGG + Intronic
944540116 2:200746499-200746521 CCTCAGGGCTGGATTCCAGGAGG - Intergenic
945025650 2:205617270-205617292 CCTGAGCACTGGTTTGAACCAGG + Intronic
1176654386 21:9576619-9576641 CCTGAGCCCTGATGTCCACCTGG - Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1179893914 21:44350966-44350988 CCGAAGCGCTGGCTTTCACGCGG + Intronic
1180292765 22:10859953-10859975 ACTGAGTGCTGGTGTCCACCTGG - Intergenic
1180456289 22:15514355-15514377 ACTGAGTGCTGGTGTCCACCTGG - Intergenic
1180495571 22:15889375-15889397 ACTGAGTGCTGGTGTCCACCTGG - Intergenic
1182017626 22:27053974-27053996 CCTGAGCTCTGATTTCCACCCGG + Intergenic
1184339123 22:43876143-43876165 CCTGAGCACTGGTGTCCTTGGGG - Intergenic
1184850124 22:47115155-47115177 CCTGAGCGCTGGGCCCCAGGAGG + Intronic
1184858592 22:47160509-47160531 CCGGAGCCCAGGTGTCCACGTGG - Intronic
1185205746 22:49537065-49537087 CCTCAGTGCTGGTTTCCATGCGG + Intronic
954465561 3:50652496-50652518 CCTGAGCTTTGGTTTACATGAGG + Intergenic
969928092 4:10604003-10604025 CCTGAGGGCAGGTGTCCCCGGGG + Intronic
969964971 4:10984704-10984726 CCTGAGGGCAGGTTTCTAGGGGG - Intergenic
970345197 4:15146433-15146455 CGAGAGCCCTGGTTTCCACGGGG - Intergenic
980158310 4:129132646-129132668 CCTGAGGCCTGGTGTCCACCTGG - Intergenic
984619889 4:181940716-181940738 CTTGAGGGCTGGCTACCACGGGG - Intergenic
985782334 5:1877928-1877950 CCTGAGCGCGGGTTCCCTCCTGG + Exonic
992407295 5:76471999-76472021 CCTCACCTCTGCTTTCCACGGGG + Intronic
994060055 5:95465361-95465383 CCTGAGCTGTGGTTTCAAAGAGG - Intronic
995079216 5:108028076-108028098 CCTGAGCTTTTGTTTCCACATGG - Intronic
997238882 5:132293236-132293258 CCTGAGCCCTGGGGTTCACGAGG - Intronic
998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG + Intergenic
1000371667 5:160542396-160542418 CCTGAGAGCAAGTTTTCACGTGG - Intergenic
1002663018 5:180803698-180803720 TCTGAGGCCTGGATTCCACGAGG + Intronic
1007182203 6:39937487-39937509 CCTGACCTCTGGTTTCCAGGTGG + Intergenic
1008960560 6:57261663-57261685 CTTGATAGCTGGTTTCCAGGTGG + Intergenic
1012672333 6:102069904-102069926 CCACACCCCTGGTTTCCACGAGG + Exonic
1017650607 6:156578162-156578184 TATGAGCACTGGTTTCCCCGAGG + Intergenic
1018246525 6:161829590-161829612 CCTGAGCGTTAGTATCCACCTGG - Intronic
1018408410 6:163513889-163513911 CCTGAGCCCTGGTGTGCACAGGG + Intronic
1019647551 7:2139201-2139223 CCTAAGCCCTGGCTGCCACGGGG + Intronic
1021699973 7:23308630-23308652 CCTGAGCTCTGGATTCCATAGGG + Intronic
1022420304 7:30214770-30214792 TCTCAGCATTGGTTTCCACGGGG - Intergenic
1024116916 7:46203275-46203297 CCTGAGTGCTGGGTCCCACAGGG - Intergenic
1029658926 7:101946063-101946085 CCTGACTGCTGGTTTCCTCTGGG - Intronic
1034539307 7:151745972-151745994 GCTGAGCGCTGGGCTCAACGGGG + Intronic
1037119574 8:15266952-15266974 CCTGAGGTCAGGTTTCCATGGGG - Intergenic
1040590780 8:48790169-48790191 CCTGGGAGCTTGTTTCCACTTGG - Intergenic
1040746063 8:50643836-50643858 GCTGAGCCCTGGTTTCCGAGAGG + Intronic
1047717955 8:127613157-127613179 CCTGAGTGCTTATTTCCATGGGG - Intergenic
1049019260 8:139942795-139942817 CCCGAGCTTTCGTTTCCACGTGG - Intronic
1050892749 9:10845545-10845567 CTTGAGTTCTGGTTTCCACATGG + Intergenic
1059812350 9:117869662-117869684 TCTGAGCCCTAGTTTCCATGAGG - Intergenic
1062606439 9:137350755-137350777 CCTGAGCCCTGGGTTCCACTTGG - Intronic
1203632107 Un_KI270750v1:80077-80099 CCTGAGCCCTGATGTCCACCTGG - Intergenic
1197742481 X:129905922-129905944 CCTGGCCCCTGGTTTCCACGTGG - Intergenic
1197780188 X:130151524-130151546 CCTGAGAGCTGGGTTCAACCTGG + Intronic
1199920849 X:152401854-152401876 CCTTAGTGCTGGTTTCTACATGG - Intronic
1199982021 X:152926334-152926356 CCTGGGTGCTGGTATCCTCGGGG + Intronic
1200089143 X:153626269-153626291 CCTGAGCTCTGGTTTCTCAGGGG - Intergenic
1201579423 Y:15495286-15495308 CCTGAGGGCAGGTTCCCAGGAGG + Intergenic