ID: 1133172997

View in Genome Browser
Species Human (GRCh38)
Location 16:3993197-3993219
Sequence CCTGAGCGCTGGTTTCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133172983_1133172997 30 Left 1133172983 16:3993144-3993166 CCACGCATTTTAAACCCTTATTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172986_1133172997 16 Left 1133172986 16:3993158-3993180 CCCTTATTGGCCTTTAAAGGAAT 0: 1
1: 0
2: 1
3: 12
4: 209
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172987_1133172997 15 Left 1133172987 16:3993159-3993181 CCTTATTGGCCTTTAAAGGAATC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172988_1133172997 6 Left 1133172988 16:3993168-3993190 CCTTTAAAGGAATCCCGCCCAGC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172990_1133172997 -8 Left 1133172990 16:3993182-3993204 CCGCCCAGCTCAGCCCCTGAGCG 0: 1
1: 0
2: 8
3: 87
4: 988
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1133172989_1133172997 -7 Left 1133172989 16:3993181-3993203 CCCGCCCAGCTCAGCCCCTGAGC 0: 1
1: 0
2: 10
3: 86
4: 721
Right 1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG 0: 1
1: 0
2: 1
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133172997 Original CRISPR CCTGAGCGCTGGTTTCCACG TGG Intronic