ID: 1133177543

View in Genome Browser
Species Human (GRCh38)
Location 16:4026645-4026667
Sequence GGGCACTACTCAGCATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133177539_1133177543 -10 Left 1133177539 16:4026632-4026654 CCTCCCCACAATGGGGCACTACT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG 0: 1
1: 0
2: 2
3: 11
4: 105
1133177531_1133177543 25 Left 1133177531 16:4026597-4026619 CCTTCCCAGGATGAATGGATAAA 0: 1
1: 3
2: 71
3: 822
4: 4005
Right 1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG 0: 1
1: 0
2: 2
3: 11
4: 105
1133177533_1133177543 20 Left 1133177533 16:4026602-4026624 CCAGGATGAATGGATAAACACAC 0: 1
1: 2
2: 3
3: 19
4: 183
Right 1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG 0: 1
1: 0
2: 2
3: 11
4: 105
1133177538_1133177543 -9 Left 1133177538 16:4026631-4026653 CCCTCCCCACAATGGGGCACTAC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG 0: 1
1: 0
2: 2
3: 11
4: 105
1133177532_1133177543 21 Left 1133177532 16:4026601-4026623 CCCAGGATGAATGGATAAACACA 0: 1
1: 2
2: 44
3: 135
4: 480
Right 1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG 0: 1
1: 0
2: 2
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133177543 Original CRISPR GGGCACTACTCAGCATCACA AGG Intronic
905293662 1:36940635-36940657 GGGCACTGCCCAGCATCTGAGGG + Intronic
905403132 1:37717261-37717283 GGGCACTACCCAGCCTTCCATGG - Exonic
907250492 1:53135017-53135039 GGGGACTGCTCTGCCTCACAGGG + Intronic
910595883 1:88979971-88979993 GGACACTACTCAGCAATAAAAGG + Exonic
918445819 1:184615728-184615750 GGCCCCATCTCAGCATCACAGGG - Intronic
923414200 1:233738997-233739019 GGGCATTATTCAGAATCAGACGG - Intergenic
1064995137 10:21290116-21290138 GAGGACCACACAGCATCACATGG - Intergenic
1066649765 10:37643182-37643204 GGGCACTGTTCAGGATCATAAGG - Intergenic
1067169875 10:43897863-43897885 GGGCACTAAGCAGGTTCACAGGG + Intergenic
1069147795 10:64917506-64917528 GGGCACCAGTCAGCATCATGAGG + Intergenic
1073480047 10:103780612-103780634 GGGTTCCACTCAGCAACACAGGG - Intronic
1076493417 10:130879684-130879706 GGTCTCAACTCAGCATCCCATGG - Intergenic
1076588121 10:131563849-131563871 GGGCACTACACAACAACAAAAGG + Intergenic
1077375298 11:2202816-2202838 GGGCACCACTCAGCACCGGATGG - Intergenic
1078572935 11:12475129-12475151 AGCCACTACCCAGCAACACAAGG + Intronic
1078773262 11:14370779-14370801 GAGCACTATTCAGAATCACCTGG + Intergenic
1079183460 11:18214838-18214860 GGGCACTAGTCAGAGTCACAAGG + Intronic
1079209639 11:18449767-18449789 GGGCTCTACTCAGGAGCACAAGG - Intronic
1080298813 11:30760730-30760752 GGGCTCTACTCAGATTAACATGG + Intergenic
1080642391 11:34165379-34165401 GGGCACTGCTCAGCGTGGCAGGG + Intronic
1081104567 11:39049046-39049068 GGGTAATACTCAGCTTCACATGG + Intergenic
1082848482 11:57744822-57744844 CGGTACTCCTCAGCCTCACAGGG + Exonic
1084416032 11:69033511-69033533 GGGGGCTTCTCAGCTTCACAGGG + Intergenic
1089614634 11:119688358-119688380 GGGGTCTGCTCAGGATCACAGGG - Intronic
1095788491 12:46137629-46137651 GGTCCCTTCTCAGCATCTCAGGG + Intergenic
1103862652 12:124026756-124026778 TGGCACGACTCACCATCCCATGG - Intronic
1107673431 13:42770272-42770294 GGGCACTGCACTGCAGCACAAGG + Intergenic
1113236413 13:108279998-108280020 GGGTATTACTCAACATCACACGG - Intronic
1114550679 14:23531196-23531218 AGTCACTACTCAGAATCACTGGG + Intronic
1114793525 14:25685757-25685779 GGGCCCTTCTCAGCAGCTCAGGG - Intergenic
1123203786 14:106692430-106692452 GGGCATTGCTCAGGATCACCAGG - Intergenic
1123208815 14:106738937-106738959 GGGCATTGCTCAGGATCACCAGG - Intergenic
1125378394 15:39059159-39059181 GGGCACAACCAAGCACCACAGGG - Intergenic
1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG + Intronic
1140647177 16:77045328-77045350 GCGCACTTCACAGCATCACAGGG + Intergenic
1141195366 16:81856686-81856708 GGGCAGTATTCAGCTTCCCATGG - Intronic
1141801852 16:86315190-86315212 GGGCACCACTGGGCATCACTAGG + Intergenic
1142150694 16:88511347-88511369 GGGCACTCCTCAGCCTCGCCGGG + Intronic
1142181383 16:88672538-88672560 GGGCACTTCTCATCCGCACAAGG - Intergenic
1142365276 16:89646762-89646784 GGGCCCCACTCAGCTTCACAAGG + Intronic
1146960365 17:36969990-36970012 GGATACTACTCAGCAACAAAAGG - Intronic
1153377438 18:4396554-4396576 CAGCACTACTCAGCTCCACATGG - Intronic
1154173680 18:12068000-12068022 GGGCCATACTCCCCATCACAGGG + Intergenic
1156627946 18:38932216-38932238 GGGCACTCATAAGAATCACATGG - Intergenic
1158198125 18:54910710-54910732 GGGCACCACTGAGCATGAGAGGG - Intronic
1160262320 18:77306095-77306117 GCGCACTAGTCAGTATCAGAAGG - Intergenic
1161952567 19:7475981-7476003 GGGGACTGCTCAGGGTCACACGG - Intergenic
1166270153 19:41708579-41708601 GAGTACTTCTCAGCATCACGTGG - Intronic
1166438084 19:42786434-42786456 TTGCTCTACTCAGTATCACAAGG - Intronic
1167050701 19:47076208-47076230 GGACACTACACAGCAACAAATGG + Intronic
925561538 2:5201393-5201415 GGGCATTACTCCGGATCTCAAGG - Intergenic
926740817 2:16109244-16109266 GGGCAGTTCTCTCCATCACAGGG + Intergenic
927522375 2:23707149-23707171 GGACAATACTGTGCATCACAAGG + Exonic
939587519 2:144023213-144023235 AGGCATTACTCAGCATGACTTGG + Intronic
941635013 2:167927048-167927070 GGGCAGCACAGAGCATCACATGG + Intergenic
1171021493 20:21588247-21588269 GGACACTGCTCAGCATCCTACGG + Intergenic
1171436428 20:25128388-25128410 GGGCACTAATCACATTCACAAGG + Intergenic
1178621152 21:34177627-34177649 GGGCATCACTCAGCATTGCAGGG + Intergenic
1179888034 21:44322755-44322777 GGGCACCACTCAGCATCACCAGG - Intronic
1181275195 22:21683615-21683637 GGCCACTGCTCTGCAGCACAAGG - Intronic
1181565713 22:23735993-23736015 CCGTACTACTCAGGATCACATGG - Intergenic
1182065284 22:27426939-27426961 GGGCACTTCTCATCCTCACCTGG - Intergenic
1183439704 22:37816260-37816282 GGGCATCACCCAGCATCACAGGG - Exonic
1185357269 22:50381241-50381263 GGCCCCACCTCAGCATCACACGG + Intronic
1185357287 22:50381307-50381329 GGCCCCACCTCAGCATCACACGG + Intronic
1185357293 22:50381329-50381351 GGCCTCACCTCAGCATCACACGG + Intronic
1185357304 22:50381373-50381395 GGCCCCACCTCAGCATCACACGG + Intronic
1185357317 22:50381417-50381439 GGCCCCACCTCAGCATCACACGG + Intronic
949765478 3:7521411-7521433 GGGCACTAATCACATTCACAGGG - Intronic
951856888 3:27207073-27207095 GGTGACTACTCTGCATCCCAGGG + Intronic
953889668 3:46742754-46742776 GGGCAAAAGTCAGCATCACAGGG + Intronic
954955829 3:54517701-54517723 GGGGACTCCTGAGCCTCACAGGG + Intronic
954988081 3:54813371-54813393 GGGCACTTCTCATCATCATGAGG - Intronic
956916696 3:73879441-73879463 AGGCAGTACAGAGCATCACATGG - Intergenic
958791422 3:98655618-98655640 TAGCACTACACAGAATCACACGG + Intergenic
959911009 3:111763716-111763738 GGGCACTAATCCTAATCACAAGG - Intronic
962025593 3:131543976-131543998 GTGCTGTACTCAGCAGCACAGGG + Intronic
966515893 3:180820819-180820841 GGGCCCCAGTCAGCAGCACAGGG - Intronic
967378295 3:188829779-188829801 AGGCACTATTCAGGGTCACATGG - Intronic
969131022 4:4991165-4991187 GGGCACTGCTTTGCATCACAGGG - Intergenic
969289446 4:6229352-6229374 GGGCTCTACTCAGCATCCCAAGG + Intergenic
971543403 4:27851711-27851733 GGTCACAGCTCAGCATCAGAGGG + Intergenic
976451915 4:85199943-85199965 GGGCACTGGTCAGAATCACTAGG - Intergenic
977838612 4:101674301-101674323 GGGCCCTCCGCAGCATCCCAGGG - Intronic
983866427 4:172772707-172772729 GGCCACTACTCAGCCTACCATGG - Intronic
984585533 4:181560253-181560275 GGGCACTAATCCCCTTCACAGGG + Intergenic
984621368 4:181956169-181956191 GGGCACTACTCACATTCATAAGG + Intergenic
986331375 5:6718383-6718405 AGGCCCTGCTGAGCATCACAAGG - Intronic
986622428 5:9689441-9689463 GAGCACGAATCAGCATCACCTGG - Intronic
988005253 5:25402246-25402268 GTGCACTTCTCAGCATCTGAAGG - Intergenic
992002597 5:72450381-72450403 GGGCTCTAAACAGCATCCCAGGG + Intronic
1000478692 5:161744494-161744516 GGGCACCAGTCAGAGTCACAAGG - Intergenic
1002857535 6:1051487-1051509 GGGCAATGCAGAGCATCACATGG + Intergenic
1006467860 6:34206776-34206798 GGGCACTACTCATCACCTCCGGG + Intergenic
1007377041 6:41464103-41464125 GGGCACTGCCCAGTATCAGAAGG + Intergenic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1021411280 7:20331615-20331637 GGGCACCGCTCGGCATCTCAGGG - Exonic
1021640930 7:22735520-22735542 GGGCACTAGTCAGAGTCATAAGG + Intergenic
1025261044 7:57417474-57417496 GGGCACTTCTCAGCATTGCCTGG - Intergenic
1031235410 7:119169120-119169142 GGGGACTCCACAGCATCACTGGG + Intergenic
1036096438 8:5729471-5729493 GGGCACTAATCTGAATCAGAAGG + Intergenic
1042338720 8:67656522-67656544 GCTCACAACCCAGCATCACATGG - Intronic
1049392281 8:142378202-142378224 GAACACCGCTCAGCATCACAAGG + Intronic
1054818499 9:69498313-69498335 GGGCAGGACTCAGCTTCCCATGG - Intronic
1055704468 9:78982359-78982381 GGGCACTAGTTAGCCTCCCATGG - Intergenic
1057278508 9:93692027-93692049 GGGCACTAGTCACATTCACAAGG - Intergenic
1062236096 9:135508472-135508494 GGACCCCACTCAGCCTCACAGGG + Intergenic
1188806110 X:34592215-34592237 GGTCACTACTGATCATGACAGGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1190015061 X:46819688-46819710 GGGCACTGGTCAGGGTCACAAGG + Intergenic
1193175121 X:78383931-78383953 GGGCACTAGTCAGAATTTCAAGG + Intergenic
1197139073 X:123096504-123096526 GGGCACCAGTCAGAGTCACAAGG + Intergenic
1198430866 X:136565043-136565065 GAGCACTACTCAGCATCATGAGG - Intergenic
1198956390 X:142136238-142136260 GGGCATTATTCAGAATCACGAGG + Intergenic
1199296938 X:146170188-146170210 GGGCACTACTCAGCTCCTAAAGG - Intergenic
1199308724 X:146297812-146297834 GGGCACCAGTCAGAGTCACAAGG - Intergenic
1199896527 X:152132177-152132199 GGGCATTTCCCAGAATCACATGG - Intergenic
1200248457 X:154539310-154539332 GGATACTACTCAGCAACACTGGG + Intronic
1200747698 Y:6916972-6916994 GGGCACTGGGCAGCATCCCAGGG - Intronic