ID: 1133178328

View in Genome Browser
Species Human (GRCh38)
Location 16:4033077-4033099
Sequence ACTTCAGACTGATGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 10, 3: 19, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133178325_1133178328 11 Left 1133178325 16:4033043-4033065 CCATTTGGTTGCTGTGCAAACAC 0: 1
1: 0
2: 0
3: 19
4: 158
Right 1133178328 16:4033077-4033099 ACTTCAGACTGATGTCCTGGAGG 0: 1
1: 1
2: 10
3: 19
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133178328 Original CRISPR ACTTCAGACTGATGTCCTGG AGG Intronic
901122337 1:6905967-6905989 CCTTCAGATAGATGTCCTGAAGG + Intronic
901489037 1:9587058-9587080 ACTGCAAACTGATTACCTGGTGG - Intergenic
903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG + Intergenic
905975382 1:42170477-42170499 ACTTCAGACTCATTGCCAGGTGG + Intergenic
907600121 1:55760642-55760664 AGCTCAGACTGCTGTGCTGGTGG - Intergenic
908111457 1:60902767-60902789 AATTCATACAGATATCCTGGTGG - Intronic
910618836 1:89230533-89230555 ATCTCAGACTGCTGTGCTGGTGG + Intergenic
911183365 1:94880403-94880425 ACTTCAGCATAATGTCCTTGGGG - Intronic
912745162 1:112239854-112239876 AAATCAGGCTGAGGTCCTGGAGG + Intergenic
914455131 1:147829248-147829270 ACTACAGACTGATATCCCTGAGG - Intergenic
915859967 1:159433598-159433620 ACTTCAGCCTGATCTAATGGAGG - Intergenic
917219926 1:172717693-172717715 AGTTCAAAATGATATCCTGGAGG + Intergenic
920714190 1:208324126-208324148 ACTTCAGGCTGAGGGCCTGCCGG + Intergenic
924816677 1:247448097-247448119 ACTCCAGGCTGGGGTCCTGGGGG + Intronic
1066257644 10:33696161-33696183 ACTTCAGACTGCTGTGCTGGTGG + Intergenic
1075061854 10:119262181-119262203 ACTTCAGACCTATTTCCTGGTGG - Intronic
1076124844 10:127965928-127965950 ACCTCAGACTGAAGGCCAGGAGG - Intronic
1076724688 10:132407871-132407893 ACTCCCGTCTGCTGTCCTGGGGG + Intronic
1076784111 10:132740880-132740902 ACGTCACAGTGATTTCCTGGAGG + Intronic
1077369215 11:2173769-2173791 CCTTCAGGCTGAGGTCTTGGAGG - Intergenic
1079280244 11:19080738-19080760 ACTTCATACTGCTGACCTTGAGG + Intergenic
1086423859 11:86664904-86664926 ACTACAGAATGAAGTGCTGGAGG - Intronic
1086608442 11:88725148-88725170 ACTTCAGACTGCTGTGCTGGTGG - Intronic
1089474111 11:118744436-118744458 CCTTCCCACTGATTTCCTGGGGG + Intergenic
1091528931 12:1335659-1335681 ACTTCAGACCAATATCCTTGAGG - Intronic
1091655749 12:2345743-2345765 ACTTCAAAATGATGACATGGAGG + Intronic
1095835709 12:46637223-46637245 ATGTCAGACTGAAGGCCTGGTGG - Intergenic
1096595658 12:52693387-52693409 ACTTCAGAGCCCTGTCCTGGGGG - Intronic
1096895670 12:54818939-54818961 ACCTCAGACTGTTGTGCTGGTGG + Intergenic
1099476779 12:83117326-83117348 ACTACAGACTGATATCCCTGAGG + Intronic
1101490990 12:105209302-105209324 ACTTCAAAGTGAGGTCCTGATGG + Intronic
1102401092 12:112630428-112630450 ACTTCAGCCTGATGCCGTGGGGG + Intronic
1102610167 12:114105005-114105027 ACTTGGGCCTGCTGTCCTGGGGG - Intergenic
1103255656 12:119539559-119539581 ACTTCAGACTGCTGTGCTGGCGG + Intronic
1106156310 13:27160657-27160679 TCTTCAGACTGATGTGCTCAGGG - Intronic
1107811995 13:44209306-44209328 ACTCCACACTGATGTCTTGGGGG - Intergenic
1107973869 13:45670704-45670726 AGTTTACACTGATGTACTGGTGG + Intergenic
1111056077 13:82952864-82952886 ACTCCAGACTGCTGTGCTGGTGG - Intergenic
1113569305 13:111342662-111342684 TTTTCAGAGGGATGTCCTGGTGG + Intronic
1113595727 13:111530452-111530474 GCTTCAGGCTGCTGTCCTGCTGG + Intergenic
1115899505 14:38129190-38129212 ACTTCAGAGGGATGGCTTGGTGG + Intergenic
1116923995 14:50614351-50614373 ACTTCAGAATGATTTACTGCAGG + Exonic
1119844266 14:77816782-77816804 ACTTGTGACTGATGTTGTGGGGG + Intronic
1129799747 15:78405355-78405377 ACTGCAGCCTGCTGCCCTGGTGG + Intergenic
1131283522 15:91039700-91039722 ACTACAGAATAATGTCCAGGAGG + Intergenic
1133178328 16:4033077-4033099 ACTTCAGACTGATGTCCTGGAGG + Intronic
1137556033 16:49470864-49470886 ACTTCAGAATCATGCCCTGCAGG + Intergenic
1137760328 16:50935254-50935276 ACTTCAGAATCATGTCCTGGAGG - Intergenic
1139000638 16:62506090-62506112 ACTCCAAAGTGATGTCCTGGGGG + Intergenic
1139322798 16:66129077-66129099 ACCTCAGCCTGATCCCCTGGGGG + Intergenic
1140756261 16:78070121-78070143 ACGTCAGCCTGATGTCCAGGTGG + Intergenic
1141754145 16:85980138-85980160 GCTTCAGACAGATGCCCGGGGGG + Intergenic
1141823315 16:86462660-86462682 CCTGCACACTGATGGCCTGGTGG - Intergenic
1142568486 17:856392-856414 ACTTAAGACTCATCTCCTAGCGG - Intronic
1145757280 17:27401857-27401879 ACACCAGCCTGATCTCCTGGGGG + Intergenic
1146132484 17:30291395-30291417 GCTTCAGACAGATGTCCAGCAGG + Exonic
1147772924 17:42879957-42879979 CCTTCATAGTGATGTCATGGTGG + Intergenic
1149558051 17:57588202-57588224 ACTTGAGACTGCCCTCCTGGTGG - Intronic
1153562244 18:6383187-6383209 ACCTCAGACTGCTGTGCTGACGG + Intronic
1156168034 18:34447691-34447713 ACTTCTTACTAGTGTCCTGGTGG + Intergenic
1160076933 18:75686501-75686523 ACTCCAGACTTATGTACAGGTGG + Intergenic
1163115205 19:15185004-15185026 AGTTCACACTGACGTCCTGTTGG + Exonic
925703045 2:6658308-6658330 AATTCAGTCTGAGGTCCTGGGGG - Intergenic
926420278 2:12689203-12689225 ACTTCAGAGGGTTGTCTTGGTGG + Intergenic
929981084 2:46681118-46681140 ACATCAGACAGCTGTCCTTGTGG + Intergenic
931576154 2:63721254-63721276 ACTTCAGAGTGGTGTCATGAGGG + Intronic
931638906 2:64364176-64364198 GCTTCAGTCTGATGTGGTGGAGG + Intergenic
933763071 2:85687437-85687459 ACTTCAGAGGGATGTCCAGCTGG - Intronic
934723871 2:96602323-96602345 ACTTCACACTGGTGGCCTGTGGG + Exonic
935857110 2:107287079-107287101 AATTTGGACTGATGACCTGGAGG + Intergenic
936999979 2:118457159-118457181 ACTTCAGACTGCTGTGTTGGCGG + Intergenic
941399935 2:165018332-165018354 AGTGCAGACTGATGCCCTTGAGG - Intergenic
943094880 2:183416868-183416890 ACTTCAGACTGCTGTGCTGGAGG - Intergenic
948558286 2:238832966-238832988 CCCTCAGACTCATGCCCTGGAGG - Intergenic
1170778883 20:19405334-19405356 ACTTGAGAGTGATGTGCTAGTGG - Intronic
1171055840 20:21905141-21905163 ATTTCAGACTGATGGGCTTGGGG + Intergenic
1174086117 20:48008489-48008511 ACATCATTCTGAGGTCCTGGGGG + Intergenic
1176976391 21:15326726-15326748 ACTGCAGTCTGAACTCCTGGGGG + Intergenic
1179914264 21:44466463-44466485 ACTTGAGACTGAGGTCCAGAGGG + Intergenic
1181935436 22:26434941-26434963 GCTTCATAATGATGTCCAGGAGG + Intronic
1182870311 22:33640698-33640720 ACTTCAGACTGCTGTGCTGGTGG - Intronic
1183587282 22:38760264-38760286 ACTTCAGACTCGTGCCCAGGAGG + Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
950261413 3:11545299-11545321 AATTCAGTCTGATGCCCTGTGGG + Intronic
953363906 3:42325407-42325429 ACTTCAGAATGTTGGCCGGGAGG - Intergenic
953916938 3:46926371-46926393 AGTTCTCACTGCTGTCCTGGTGG - Intronic
956279354 3:67540316-67540338 ACTTCAGACTGATGTGCTGGCGG - Intronic
961264426 3:125629870-125629892 ACTACAGACTGATATCCTTGAGG - Intergenic
961644982 3:128388075-128388097 AGTTCAGAGTGAGGACCTGGTGG - Intronic
961917187 3:130389224-130389246 ACTTAACACTGAAGTCCAGGTGG - Intronic
962893744 3:139695584-139695606 ACTTCAGCCTGATTTCCAGCTGG + Intergenic
963290617 3:143483432-143483454 ACTTCTGACTCATCTCATGGTGG - Intronic
963751143 3:149181132-149181154 ATTTAAGACTGATGTTCTGATGG - Intronic
965287643 3:166837728-166837750 ACTTGTGACTGATGTCCAGTAGG + Intergenic
965479930 3:169205806-169205828 ATTGCAAACTGGTGTCCTGGGGG + Intronic
965662930 3:171061115-171061137 ACGTCAGAATGGTGTCCTTGTGG - Intergenic
965903190 3:173669339-173669361 ACTTCAGACTTCTGGCCTGAAGG - Intronic
966251240 3:177867292-177867314 ACTTCAGGCTATTATCCTGGAGG + Intergenic
967562668 3:190934887-190934909 ACTTCAGACTGCTGTGCTGGCGG + Intergenic
967849257 3:194070335-194070357 ACCTCAGCCTGATTTTCTGGGGG - Intergenic
967966591 3:194965060-194965082 ACTTCAGACTTCTGTCCTCCAGG + Intergenic
969798371 4:9543449-9543471 TCTGCACCCTGATGTCCTGGGGG + Intergenic
970662789 4:18305071-18305093 ACTTCTGACTGAAGGCTTGGAGG + Intergenic
979363629 4:119794340-119794362 AGTTCAGGCAGATGTCATGGAGG + Intergenic
982118797 4:152119348-152119370 CCTTCAGACTGATGCCCTGTGGG - Intergenic
982319560 4:154064105-154064127 ACTTGAGAGTGATGACCTAGGGG + Intergenic
983179447 4:164630705-164630727 ACTTCAGACTGCTGTGCTGGTGG - Intergenic
985492625 5:188302-188324 ACACCTGCCTGATGTCCTGGGGG + Exonic
988817733 5:34851198-34851220 CCTTCAGACTGAGGTCCCAGAGG - Intronic
990852267 5:60220088-60220110 GCTTCAGGCCTATGTCCTGGGGG + Intronic
991528776 5:67592744-67592766 CCTTCACACTGATGTCCTTTCGG + Intergenic
995379647 5:111517870-111517892 ACTTGAAACTGGTGTCCAGGGGG + Intergenic
998381097 5:141726054-141726076 ACTTGAGAGTGACGACCTGGGGG - Intergenic
1005374331 6:25166664-25166686 ACTTCATACTCCTGTGCTGGTGG - Intergenic
1005463803 6:26092761-26092783 ACTTCATGGTGATGTTCTGGGGG - Exonic
1006112041 6:31753313-31753335 ACGTCCGACTCATGACCTGGGGG + Exonic
1009718274 6:67428326-67428348 GCTTCAGACTGCTGTGTTGGCGG + Intergenic
1012551342 6:100466964-100466986 GCTTAAGGCTGACGTCCTGGGGG + Intergenic
1014609341 6:123521847-123521869 ACTTCACAGAGATGTCCTCGAGG - Intronic
1015110089 6:129582856-129582878 ACTTCAGAGTGCTGTTCTGAGGG + Intronic
1018707615 6:166474597-166474619 ACTGCAAACTCCTGTCCTGGGGG + Intronic
1018933828 6:168260535-168260557 ACTTCAGGCTTAGGTCCTGGGGG + Intergenic
1019971538 7:4544931-4544953 ATGTCAGCCTGATGTCCTCGAGG + Intergenic
1020739081 7:11990453-11990475 ACTTCAGAGGGATGTCTTGATGG - Intergenic
1021838547 7:24704123-24704145 ACTTGACTCTGATTTCCTGGAGG + Intronic
1022475643 7:30707805-30707827 ACTTCAGAGTGCTCTCCTGGTGG + Intronic
1023688710 7:42763878-42763900 AATACAGTCTGATATCCTGGAGG + Intergenic
1023852016 7:44155730-44155752 ATTTCAGTCTGAGGTCTTGGCGG + Intronic
1028192646 7:87870683-87870705 ACTTCAGAGTGATGGCTTGATGG + Intronic
1029693937 7:102201148-102201170 ACTACAGCTTGATGACCTGGTGG - Intronic
1030359195 7:108577759-108577781 TCTTCAGAATGATGTTCTGCAGG + Intergenic
1033525607 7:142210452-142210474 ACTTCAGACAGCTGTGCTGGCGG - Intronic
1037258529 8:16981824-16981846 ACTTCAGAGGGATGGCCTGATGG + Intergenic
1037285481 8:17294329-17294351 ACCTCAGACTGCTATGCTGGCGG + Intronic
1040956105 8:52981515-52981537 CCTTCAGTCAAATGTCCTGGAGG + Intergenic
1042865460 8:73353183-73353205 GCTTTAGACTCATGTCCTGATGG - Intergenic
1043277280 8:78414566-78414588 ACTTCAATCTGATGTCCTTGGGG + Intergenic
1044592194 8:93924486-93924508 ACATAAGAGTGATGTGCTGGTGG - Exonic
1050593802 9:7186005-7186027 CCTTCAGATTGATGTGCTGTGGG - Intergenic
1051199426 9:14599717-14599739 ACTTCAGACTGCTGTGCTGGTGG - Intergenic
1051982901 9:23045961-23045983 ACTCCAGACTGCTGTGCTGGCGG - Intergenic
1055550121 9:77425492-77425514 ACTCTAGACTGATGCCCGGGAGG + Intronic
1055571772 9:77624032-77624054 ACCTCAGACTGCTGTGCTAGTGG - Intronic
1058182511 9:101815780-101815802 ACTTCAGACTTCTGTGCTAGTGG - Intergenic
1059075131 9:111185089-111185111 ACTACAGACTGATATCCGTGAGG - Intergenic
1060966104 9:127713137-127713159 ACAGCAGCCTGAGGTCCTGGGGG - Exonic
1185664928 X:1757978-1758000 ACATCAGAGTGAAGACCTGGAGG - Intergenic
1186559224 X:10592735-10592757 ATTTCAGACTTATTTCTTGGAGG - Intronic
1189590639 X:42507295-42507317 ACTTCAGACTGCTGTGCTGGTGG - Intergenic
1192496064 X:71617321-71617343 AGTTCAGGCTGAAGTCCTGTGGG + Exonic
1193065481 X:77254894-77254916 ACTTCAGACTACTGTGCGGGCGG - Intergenic
1193254033 X:79325540-79325562 ACTTCAGGCTGCTGTGCTGGCGG + Intergenic
1195233920 X:102878308-102878330 TCTTCACACTGCTGTCCTGATGG + Intergenic
1196602951 X:117622963-117622985 ACTTCAGACTGCTATGCTGGTGG + Intergenic
1197762762 X:130039298-130039320 ACTTGACACTGTTGTCCTTGGGG + Intronic
1199327412 X:146515300-146515322 TGCTCAGACTAATGTCCTGGAGG + Intergenic
1201906643 Y:19092441-19092463 ATTTCAGACTGCTGTCCTCTGGG - Intergenic
1201979355 Y:19890830-19890852 ATTTCAGACTGCTGTGCTGGTGG + Intergenic