ID: 1133179133

View in Genome Browser
Species Human (GRCh38)
Location 16:4039386-4039408
Sequence GCAGGATTGCAGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 1, 2: 8, 3: 79, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133179129_1133179133 5 Left 1133179129 16:4039358-4039380 CCAACGACACTTTAAAAATGCTT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG 0: 1
1: 1
2: 8
3: 79
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133179133 Original CRISPR GCAGGATTGCAGGCCAGGTG CGG Intronic
900143936 1:1150004-1150026 ACGGGGCTGCAGGCCAGGTGAGG + Intergenic
900158851 1:1213977-1213999 CCACGAGTGCAGGCCAGGTGAGG - Exonic
900321459 1:2086394-2086416 CGATGATTCCAGGCCAGGTGCGG - Intronic
900508385 1:3042663-3042685 GCAGTGGTGCATGCCAGGTGCGG - Intergenic
900520599 1:3103640-3103662 GCAGGTGTGCAGGGCAGGAGGGG + Intronic
901532149 1:9860298-9860320 CCAGGATTCTAGGCCGGGTGTGG + Intronic
901657704 1:10779883-10779905 GCAAGATTCCAGCCAAGGTGGGG + Intronic
901740992 1:11341791-11341813 GTTGGATTGGAGCCCAGGTGGGG + Intergenic
902534931 1:17114097-17114119 GGAGGAATTCAGGCCAGGTCAGG - Intronic
902898981 1:19500805-19500827 GCAGGATTTCCAGCCAGGTGCGG + Intergenic
903050781 1:20599326-20599348 GAAGGATTTCAGGCCAGGCGTGG + Intronic
903625447 1:24726924-24726946 GCAGGACCCCAGGCCAGGTGAGG + Intergenic
903746929 1:25593257-25593279 GCACCATTGCAGGCCAGGCTGGG + Intergenic
903912162 1:26735580-26735602 TCTGGATTTCAGGCCGGGTGAGG - Intronic
904378765 1:30097385-30097407 GATGGATTGCAGGGCAGGTGGGG + Intergenic
904520257 1:31089750-31089772 GTAGGTTTGGCGGCCAGGTGCGG - Intergenic
905720772 1:40199150-40199172 GCAGAATTTGAGCCCAGGTGAGG + Intronic
905918811 1:41705275-41705297 GCATCATTGCAGGCCAGGCCAGG - Intronic
905978563 1:42200771-42200793 GAAATATTGAAGGCCAGGTGCGG - Intronic
906630086 1:47359677-47359699 GAAAGGTTTCAGGCCAGGTGTGG - Intronic
906929186 1:50152142-50152164 TCAGGATTACAGACCAGGTATGG + Intronic
907129332 1:52081412-52081434 AGAGGATTTCAGGCCAGGTGCGG - Intronic
907322548 1:53614427-53614449 GCGGGAACACAGGCCAGGTGTGG + Intronic
908530960 1:65033475-65033497 ACAGGAGTTGAGGCCAGGTGTGG - Intergenic
911203647 1:95071255-95071277 GCAGGATTTTAGGCCAGGGGTGG + Intronic
912466238 1:109876946-109876968 GAAGGATTTCAGTCCAGGTATGG + Intergenic
913669786 1:121086209-121086231 ACAAGTTTGCAGGGCAGGTGAGG + Intergenic
914021550 1:143873607-143873629 ACAAGTTTGCAGGGCAGGTGAGG + Intergenic
914660040 1:149781524-149781546 ACAAGTTTGCAGGGCAGGTGAGG + Intergenic
914708981 1:150195624-150195646 GGAGTATTACTGGCCAGGTGTGG + Intergenic
914809895 1:151019789-151019811 ATAGAGTTGCAGGCCAGGTGTGG - Intronic
914914287 1:151809106-151809128 ACAGGAGTCAAGGCCAGGTGTGG + Intronic
915203350 1:154250561-154250583 GGATGGTTGTAGGCCAGGTGCGG + Intronic
915741529 1:158122308-158122330 GGAGGATCCCAGGCCAGGCGTGG + Intergenic
915767185 1:158374455-158374477 ACACGCTTGCAGGCCAGCTGGGG - Intergenic
915981082 1:160420315-160420337 GCAGGTTGGCAGGGCAGGAGAGG - Intronic
916728973 1:167549671-167549693 AAAATATTGCAGGCCAGGTGCGG - Intronic
916860134 1:168794911-168794933 GAAAGATAACAGGCCAGGTGTGG + Intergenic
919426820 1:197442832-197442854 TGAGAATTACAGGCCAGGTGTGG + Intronic
919574816 1:199294591-199294613 ACAAGATTTCAGGCCAGGCGCGG - Intergenic
919645360 1:200089445-200089467 ACAAAGTTGCAGGCCAGGTGTGG - Intronic
920698624 1:208200894-208200916 GAAGGATTGGAGGCCAGGCGCGG - Intronic
921012404 1:211155529-211155551 GAAGGGGTCCAGGCCAGGTGCGG + Intergenic
921016041 1:211191841-211191863 ACAGGAAGTCAGGCCAGGTGCGG + Intergenic
921107135 1:211993387-211993409 GTAAGACTACAGGCCAGGTGCGG + Intronic
921985320 1:221306101-221306123 CCCGGAATGCATGCCAGGTGTGG + Intergenic
922571288 1:226635941-226635963 CCAGCAGTGCAGGGCAGGTGGGG + Intronic
922974096 1:229769295-229769317 GAAGGAGTCCAGGCCGGGTGTGG + Intergenic
924464183 1:244285238-244285260 GAAGGATGCGAGGCCAGGTGTGG + Intergenic
1062832987 10:618312-618334 GCTGGCTTGCAGGCCTGGAGAGG + Intronic
1062948300 10:1477035-1477057 GTTGGATCGTAGGCCAGGTGGGG - Intronic
1066382594 10:34913850-34913872 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1066409874 10:35157338-35157360 TAAGGATACCAGGCCAGGTGTGG + Intronic
1066600963 10:37106756-37106778 GCCGGATAGCAGGCCAGGCGCGG + Intergenic
1066605695 10:37168170-37168192 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1066606478 10:37179962-37179984 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1066607252 10:37191703-37191725 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1068531822 10:58197358-58197380 ATAGGATTCCAGGCCGGGTGCGG + Intronic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069672507 10:70220218-70220240 GCATAATTGCAGGCCAGGTGCGG - Intronic
1069903225 10:71717715-71717737 GCCGGAGTGCAGGCCCAGTGTGG + Intronic
1069977979 10:72231082-72231104 GCAGAAATGAAGGCCTGGTGAGG - Intronic
1070209262 10:74298613-74298635 TGAGGATTTTAGGCCAGGTGTGG + Intronic
1070575714 10:77677116-77677138 GTAATAATGCAGGCCAGGTGAGG + Intergenic
1072368971 10:94744686-94744708 TGAGGTTTGGAGGCCAGGTGTGG + Intronic
1072411994 10:95211372-95211394 GCAGGATTGAATGTAAGGTGGGG - Intronic
1073298860 10:102458447-102458469 ACAAGATTGCTGGCCAGGTGCGG - Intergenic
1073357302 10:102867289-102867311 TAAGGATTGTTGGCCAGGTGTGG + Intronic
1074057294 10:109934017-109934039 GCAGGCTTGCAGGGCTTGTGAGG + Intergenic
1074870204 10:117570150-117570172 CCAGGACTCCAAGCCAGGTGGGG - Intergenic
1075418730 10:122285279-122285301 CAAGGATGCCAGGCCAGGTGAGG - Intronic
1075610154 10:123847232-123847254 TGAAGATTTCAGGCCAGGTGCGG + Intronic
1075690776 10:124392813-124392835 GCCGGAGTGCAAGCCAGATGCGG - Intergenic
1076898119 10:133324401-133324423 CCAGGCTTGCTGGCTAGGTGCGG - Intronic
1077002663 11:332192-332214 GCTTTATTGCTGGCCAGGTGCGG + Intergenic
1077074569 11:694551-694573 GCAGGTGTGCAGGGCGGGTGGGG + Intronic
1077077704 11:708893-708915 GCAGGATGGCAGGAGAGGTGAGG - Intronic
1077100702 11:821102-821124 GCAGGAGTGCTGGCCAGCTTGGG - Intronic
1077888830 11:6404739-6404761 GCAGGACAGCAGCGCAGGTGAGG - Intronic
1078531119 11:12137360-12137382 GCAGGATTGGAGCCCAGGACTGG - Intronic
1079352021 11:19699803-19699825 GCAGTTTTGCAGGCCAGGAGAGG - Intronic
1079374531 11:19880111-19880133 GCTGAAATGCAGTCCAGGTGGGG + Exonic
1081077367 11:38693577-38693599 GCAGTATGGCAGGCCAAGAGAGG - Intergenic
1081428606 11:42951497-42951519 ACAGGTTTGCAGGTCAGCTGTGG - Intergenic
1082027058 11:47580236-47580258 GCAGAAATGCAGGCAATGTGAGG + Intronic
1083106106 11:60360316-60360338 GCTGGAGTGCAAGACAGGTGTGG - Intronic
1083398544 11:62408062-62408084 ACAGAATTGGAGTCCAGGTGCGG - Intronic
1083481351 11:62949654-62949676 CCAGGACTCCTGGCCAGGTGTGG - Intronic
1083735690 11:64679345-64679367 TCAGGATTGAGGGCCAGGCGTGG + Intronic
1084135723 11:67179568-67179590 ACAGCATTCCAGGCCGGGTGCGG - Intronic
1084256407 11:67946047-67946069 CAAGCAATGCAGGCCAGGTGTGG - Intergenic
1084417649 11:69042744-69042766 CCAGGGATGCTGGCCAGGTGTGG - Intergenic
1084522625 11:69673841-69673863 AGTGGATTGCAGGCCAGGTGCGG - Intronic
1084901719 11:72314887-72314909 GCAGGCCTGCATGCCAGGTTAGG + Intronic
1086102175 11:83112492-83112514 ACAGCATTGGTGGCCAGGTGTGG + Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088670136 11:112132584-112132606 GCTAGCTAGCAGGCCAGGTGCGG - Intronic
1088934926 11:114390119-114390141 CAAAGATTGTAGGCCAGGTGTGG - Intergenic
1089246112 11:117121313-117121335 GAAGGATTGAAGGCTAGGGGAGG + Intergenic
1089384250 11:118057619-118057641 GCAGTGTTGCTGGCCAGGTGTGG + Intergenic
1089403686 11:118180370-118180392 GCAGAATTGCAGGGAAGGAGAGG + Intergenic
1089664577 11:120010029-120010051 GAAGAATTACAGGCCAGGAGAGG - Intergenic
1089678813 11:120108123-120108145 GCAGAATTCCATGCCAGGTTAGG + Intergenic
1089787268 11:120916953-120916975 CCAGGCTTTCCGGCCAGGTGTGG + Intronic
1090005186 11:122996082-122996104 GTAGGTTTGCAGGCCGGGTGTGG + Intergenic
1090293462 11:125566610-125566632 GAAGGATGGCGGGCCAGGTGCGG + Intergenic
1090348618 11:126091708-126091730 GGAGGATTTCAGGCCCGGCGCGG + Intergenic
1091847864 12:3671150-3671172 GCAGAAATGCAGGCCAGCAGAGG + Intronic
1092161048 12:6315743-6315765 GCAGGATTTCAGGCCAGTCTGGG + Intronic
1092326949 12:7542782-7542804 ACAGAACTGAAGGCCAGGTGAGG + Intergenic
1092369772 12:7907149-7907171 GTATGATTGCAGGCCTGGTGGGG - Intergenic
1092832789 12:12461460-12461482 ATAGGAATGCTGGCCAGGTGCGG - Intronic
1092879529 12:12877276-12877298 CCAGCATTGTAAGCCAGGTGAGG - Intergenic
1093192876 12:16095111-16095133 GCAGGCTCACAGGCCGGGTGTGG - Intergenic
1093871384 12:24295851-24295873 ACAGTATTCAAGGCCAGGTGCGG - Intergenic
1094204610 12:27827066-27827088 GAATGATATCAGGCCAGGTGTGG - Intergenic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1096041419 12:48520547-48520569 ACAGGGTGGCTGGCCAGGTGGGG + Intronic
1096641548 12:52998597-52998619 TCTGGTTAGCAGGCCAGGTGCGG - Intergenic
1096784812 12:54010801-54010823 CTAGGATTACAGGCCTGGTGGGG + Intronic
1097016574 12:55991636-55991658 GTAAGTTTGCCGGCCAGGTGTGG + Intronic
1097229905 12:57504175-57504197 TCAGGCCTGCAGGCCAGGGGAGG - Intronic
1097489689 12:60250403-60250425 GCAGGATTGCAGGCTGGGTGCGG - Intergenic
1097665999 12:62477749-62477771 GCAGGAATGGAGGTGAGGTGGGG - Intronic
1097797960 12:63883991-63884013 GTAGGAGAGCAGGCCAGGCGCGG + Intronic
1097918095 12:65041099-65041121 GCAGGATTACAGGCTAGGCTTGG - Intergenic
1099003132 12:77204598-77204620 GCAAGTTTGCAGGCCAATTGGGG - Intergenic
1099533985 12:83823480-83823502 GCTGGAGTGTAAGCCAGGTGCGG - Intergenic
1100310526 12:93390881-93390903 GCAGCATTCCAGGCCAGGCATGG - Intronic
1101418537 12:104529865-104529887 GCATGATTACAGGCTGGGTGCGG + Intronic
1102394792 12:112576288-112576310 GCAGGATTGCAGACCCTGTGTGG + Intronic
1102463278 12:113113398-113113420 GCAGGGTTGCAGGCAGGCTGTGG - Intronic
1102469286 12:113150488-113150510 GCAGGAGAGCAGGTCAGGTGGGG - Intronic
1102579789 12:113879098-113879120 GCAGGATGGGTGGCCAGGAGGGG - Intronic
1102699981 12:114830626-114830648 GAAGTATTTGAGGCCAGGTGTGG - Intergenic
1102760957 12:115384585-115384607 ACAACATTCCAGGCCAGGTGAGG + Intergenic
1103118879 12:118363829-118363851 ACAGGTTTACAGGCCAGGCGCGG + Intronic
1103419765 12:120771045-120771067 GCAGCAATGCACGCCAGGAGAGG - Intronic
1103505153 12:121437961-121437983 ACAAGAATGCAGGCCAGGCGTGG + Intronic
1104761075 12:131297836-131297858 GCAGAAAGGCAGGCCTGGTGCGG + Intergenic
1104818702 12:131662956-131662978 GCAGAAAGGCAGGCCTGGTGCGG - Intergenic
1105383279 13:19907014-19907036 ACAAAATTGCAGTCCAGGTGTGG - Intergenic
1105499468 13:20958908-20958930 ACAGGATTTCGGGCCAGGAGTGG + Intergenic
1105734260 13:23251490-23251512 GAAGGAATGCAGGCCAGGCATGG + Intronic
1106019760 13:25903407-25903429 GGAGGATGGGAGACCAGGTGGGG - Intronic
1107854269 13:44599305-44599327 ACAGAATTGGAGCCCAGGTGTGG - Intergenic
1107860333 13:44654681-44654703 AGAGGAATGCAGGCCAGGCGCGG + Intergenic
1108323141 13:49305766-49305788 CCAGGATTTCAGTCCAGGTGTGG + Intergenic
1108429783 13:50341998-50342020 GGAGGATTGGTGGCTAGGTGAGG - Intronic
1108755366 13:53495048-53495070 TAGGCATTGCAGGCCAGGTGTGG + Intergenic
1108952716 13:56114296-56114318 GCAGGATTGAAGTCCAGGCCAGG + Intergenic
1109252102 13:60032013-60032035 TAATGACTGCAGGCCAGGTGCGG - Intronic
1111028526 13:82567060-82567082 GCCGGTGTGCAAGCCAGGTGTGG - Intergenic
1112225365 13:97534280-97534302 GCAGTATTCCAGACCAGATGGGG - Intergenic
1113732830 13:112654585-112654607 GTGGGATTGCAAGCCAGGAGAGG - Intronic
1113887646 13:113669361-113669383 GCAGGATTGCTGGGCAGGCGGGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1114314589 14:21497815-21497837 ACAGGAATGCAGGCTGGGTGCGG - Exonic
1114853313 14:26406857-26406879 GCATGATAGCTGTCCAGGTGGGG + Intergenic
1115212297 14:30979956-30979978 GAATTATTTCAGGCCAGGTGCGG + Intronic
1115269457 14:31535646-31535668 GCAGGATTTCATGCAAAGTGTGG + Intronic
1116897429 14:50330942-50330964 GCAGTACACCAGGCCAGGTGCGG + Exonic
1118716671 14:68564698-68564720 GCTGGCTTTCAGGCCTGGTGTGG + Intronic
1121737134 14:96226361-96226383 GCAAAGTGGCAGGCCAGGTGCGG + Intronic
1121785804 14:96660110-96660132 GCAGGAATGCAGGGCTGGGGAGG - Intergenic
1121904362 14:97726271-97726293 GCAGGGTTGCAGGCCAGGTGGGG - Intergenic
1121994537 14:98592117-98592139 ATAGCATTGCTGGCCAGGTGTGG - Intergenic
1122551722 14:102553839-102553861 AAAGGAATGCTGGCCAGGTGTGG + Intergenic
1122725732 14:103750538-103750560 ACTGGATTGCAGGCCGGGTGCGG + Intronic
1122837494 14:104437308-104437330 GAAGGCTTCCAGGGCAGGTGGGG - Intergenic
1122879236 14:104682574-104682596 CCTGGCCTGCAGGCCAGGTGAGG + Intergenic
1123093140 14:105751019-105751041 GGAGGATGGCATCCCAGGTGGGG + Intergenic
1123435654 15:20252196-20252218 GAAAGATAGGAGGCCAGGTGCGG + Intergenic
1124128770 15:26966620-26966642 CCAGAATGGCAGGCCAGGCGCGG + Intergenic
1124510697 15:30322005-30322027 GCATAATTGAAGGCCAGGTGTGG - Intergenic
1124732191 15:32208530-32208552 GTATAATTGAAGGCCAGGTGTGG + Intergenic
1124899587 15:33809789-33809811 AGAGGAATCCAGGCCAGGTGCGG - Intronic
1124916259 15:33977780-33977802 GGACTATTTCAGGCCAGGTGTGG + Intronic
1125530488 15:40410123-40410145 GCAGGACTGGAGGCCAGGCATGG - Intronic
1125731065 15:41893100-41893122 CCAGGATGGGAGGACAGGTGAGG - Intronic
1126125340 15:45290525-45290547 GCAGCATTGCACGCCAGGCTGGG - Intergenic
1126146615 15:45479383-45479405 ACAGGCTTGCAGGCCAGATTTGG + Intergenic
1126579071 15:50226439-50226461 AAAGAATTACAGGCCAGGTGTGG + Intronic
1127426354 15:58862766-58862788 ATAGGATTTCTGGCCAGGTGCGG + Intergenic
1127483463 15:59398466-59398488 ACATGAATCCAGGCCAGGTGTGG + Intronic
1127675770 15:61237144-61237166 ACAGCATAGGAGGCCAGGTGCGG - Intergenic
1127919534 15:63482319-63482341 GTAGGATAGTTGGCCAGGTGCGG - Intergenic
1128085902 15:64886573-64886595 TCAGGACTCCAGGCCAGGCGCGG + Intronic
1128767261 15:70258826-70258848 GCAGGCTTCCAGGGCTGGTGAGG - Intergenic
1129264668 15:74387296-74387318 GCAGGGCAGCTGGCCAGGTGTGG + Intergenic
1129537743 15:76327914-76327936 GCAGGAATGCAGGCATGCTGTGG - Intergenic
1129744483 15:78008401-78008423 GCAGGAATGCAGCCCATCTGTGG + Intronic
1129836560 15:78711305-78711327 AAACAATTGCAGGCCAGGTGCGG - Intronic
1130552525 15:84900024-84900046 GCAAGCCTGCCGGCCAGGTGTGG + Intronic
1130860915 15:87888840-87888862 TCTGGATTGCAGACCTGGTGAGG + Intronic
1132075612 15:98817453-98817475 GCTGGGTTGGGGGCCAGGTGTGG + Intronic
1132353078 15:101152482-101152504 GTAGTAGTGTAGGCCAGGTGCGG - Intergenic
1132486461 16:194654-194676 GGAGGACAGCAGGCCAGGGGAGG + Intronic
1132929145 16:2449801-2449823 GGAGGAAAGCAGGCCAGGGGTGG - Intronic
1133018479 16:2955633-2955655 TCAGGCCTGCAGGCCCGGTGAGG - Intergenic
1133166328 16:3950131-3950153 GTAGGATTACAGGCCGGGCGCGG - Intergenic
1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG + Intronic
1133218513 16:4307821-4307843 GCGGGATTCCAAGCCAGGGGCGG - Intergenic
1133908636 16:10044320-10044342 AAAATATTGCAGGCCAGGTGTGG - Intronic
1134080676 16:11323017-11323039 CCAGGATTCCAGGCCAGGCCAGG + Intronic
1134586318 16:15414451-15414473 TCTGGGTTTCAGGCCAGGTGTGG + Intronic
1134821359 16:17250004-17250026 GCAGGATGAGAGGACAGGTGAGG - Intronic
1134828410 16:17303239-17303261 AGAGGATTGCAGGCCAGATTTGG - Intronic
1135314860 16:21436014-21436036 TCTGGGTTTCAGGCCAGGTGTGG + Intronic
1135367785 16:21868288-21868310 TCTGGGTTTCAGGCCAGGTGTGG + Intronic
1135444031 16:22502868-22502890 TCTGGGTTTCAGGCCAGGTGTGG - Intronic
1135833005 16:25795259-25795281 GCGGGATGGGGGGCCAGGTGCGG - Intronic
1135857024 16:26021301-26021323 GCAGGAATGCAGGTCCAGTGTGG - Intronic
1135875725 16:26198349-26198371 GCAGCAGAGCCGGCCAGGTGAGG - Intergenic
1136192908 16:28628765-28628787 TCTGGGTTTCAGGCCAGGTGTGG - Intergenic
1136311529 16:29414695-29414717 TCTGGGTTTCAGGCCAGGTGTGG + Intergenic
1136324973 16:29516482-29516504 TCTGGGTTTCAGGCCAGGTGTGG + Intergenic
1136439658 16:30256466-30256488 TCTGGGTTTCAGGCCAGGTGTGG + Intergenic
1136545448 16:30951786-30951808 GCAGGAACGCAGGCCAAGTGTGG + Intronic
1136656464 16:31712207-31712229 GCTGGATTGAAGGCCAGGTGGGG + Intergenic
1136848950 16:33598799-33598821 GAAAGATAGGAGGCCAGGTGTGG - Intergenic
1137239907 16:46647413-46647435 GCAGCATGGCAGACCAGTTGGGG + Intergenic
1137448716 16:48550611-48550633 GCAGGCTTATAGGCCGGGTGTGG + Intronic
1138372487 16:56538374-56538396 GTAGAATTTCAGGCCAGGCGTGG + Intergenic
1138583423 16:57956079-57956101 GCAGGATTCCCCGCCAGCTGTGG - Intronic
1138689434 16:58753738-58753760 GCCAGAGTGCAAGCCAGGTGTGG - Intergenic
1139235769 16:65337329-65337351 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1139505324 16:67395587-67395609 GGAGGCTGGGAGGCCAGGTGTGG + Intronic
1139859063 16:70005746-70005768 TCTGGGTTTCAGGCCAGGTGTGG + Intergenic
1139878399 16:70164567-70164589 TAAGGATTTTAGGCCAGGTGCGG + Intergenic
1139886161 16:70208766-70208788 TCTGGGTTTCAGGCCAGGTGTGG + Intergenic
1140081785 16:71755133-71755155 ACAGCATCACAGGCCAGGTGTGG + Intronic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140359165 16:74330249-74330271 TAAGGATTTTAGGCCAGGTGCGG - Intergenic
1140448258 16:75049292-75049314 AAAGGATTCCAGGCCGGGTGTGG - Intronic
1140457534 16:75113880-75113902 GGGAGATGGCAGGCCAGGTGAGG + Intronic
1140459268 16:75125750-75125772 GAAGGTTTTCAGGCCGGGTGCGG + Intergenic
1141784180 16:86187520-86187542 GGCAGATGGCAGGCCAGGTGTGG + Intergenic
1141925987 16:87169985-87170007 GGAGGGCTGCAGCCCAGGTGAGG - Intronic
1142025911 16:87813488-87813510 GCTTTATTGCAGGCCAGGCGCGG + Intergenic
1142103224 16:88286553-88286575 GCAGGGGCCCAGGCCAGGTGAGG - Intergenic
1203110657 16_KI270728v1_random:1447449-1447471 GAAAGATAGGAGGCCAGGTGTGG - Intergenic
1142923220 17:3209330-3209352 TAAATATTGCAGGCCAGGTGTGG + Intergenic
1143392008 17:6564668-6564690 GCAGATTGGGAGGCCAGGTGTGG - Intergenic
1143443149 17:6991331-6991353 GATGGGTTTCAGGCCAGGTGCGG - Intronic
1144066625 17:11630142-11630164 ACTGTATTGCAGGCCAGGTGCGG + Intronic
1144125278 17:12197235-12197257 ATAGGACTGCAGGCCAGGTGCGG + Intergenic
1144211099 17:13016492-13016514 AAAGAATTCCAGGCCAGGTGCGG + Intronic
1144866647 17:18339848-18339870 AAAGGATTCCCGGCCAGGTGAGG - Intronic
1144958454 17:19031518-19031540 GCAGCCTTCCAGGCCAGGAGGGG + Intronic
1144976705 17:19143006-19143028 GCAGCCTTCCAGGCCAGGAGGGG - Intronic
1145713776 17:26999867-26999889 GCAGGAAGACAGGGCAGGTGTGG + Intergenic
1146020875 17:29277720-29277742 GCATGTTTTCCGGCCAGGTGCGG + Intronic
1146028581 17:29344878-29344900 GGGGGATTGATGGCCAGGTGTGG + Intergenic
1146260585 17:31417631-31417653 GAAGGAATGCAGCCTAGGTGGGG + Intronic
1147198397 17:38782895-38782917 GCTATATTTCAGGCCAGGTGCGG + Intronic
1147350699 17:39840884-39840906 GGAGGGTTTCAGGCCAGGTGTGG + Intronic
1147406440 17:40215819-40215841 TCAAGACTACAGGCCAGGTGTGG + Intergenic
1147609516 17:41793379-41793401 ACAGGCTGGCAGGGCAGGTGGGG - Intergenic
1147953950 17:44122287-44122309 GCAGGATTGCAGTCTGGGTCTGG - Intronic
1148160566 17:45447561-45447583 GCAGGATGTCAGCCCAGGAGTGG - Intronic
1149033120 17:52105530-52105552 TAAGGATTTGAGGCCAGGTGTGG - Intronic
1149208535 17:54277316-54277338 AAAGTTTTGCAGGCCAGGTGCGG - Intergenic
1150009255 17:61489563-61489585 GCAGCATTGCAGGCCTGGGCAGG - Intergenic
1150158236 17:62871916-62871938 AAAGTATGGCAGGCCAGGTGCGG + Intergenic
1150391857 17:64794442-64794464 GCAGGATGTCAGCCCAGGAGTGG - Intergenic
1150681343 17:67286998-67287020 AGAGATTTGCAGGCCAGGTGTGG + Intergenic
1150788929 17:68184492-68184514 GCAGGATGTCAGCCCAGGAGTGG - Intergenic
1150910975 17:69387169-69387191 ACAGGATTTCTGGCCAGGTGCGG + Intergenic
1150984267 17:70177573-70177595 GCAAGTGTGGAGGCCAGGTGTGG - Exonic
1151682738 17:75630343-75630365 GCGGGACTCCAGGCCTGGTGGGG + Intronic
1151882704 17:76904625-76904647 GCCTGTTTGCAGGGCAGGTGGGG + Intronic
1151975189 17:77480507-77480529 GCAGGCTTCCAGGCCAGGAGGGG - Intronic
1152091847 17:78251624-78251646 GCAGGTGTGCAGGCTGGGTGTGG - Intergenic
1152232255 17:79119844-79119866 TCAGGAGTGCGGCCCAGGTGTGG - Intronic
1152582241 17:81171203-81171225 GCAGGGCTGGAGGCCAGGAGGGG + Intergenic
1153116128 18:1658590-1658612 AAATGAATGCAGGCCAGGTGCGG - Intergenic
1153579406 18:6557209-6557231 CCAGGATGCCAGGCCAGGAGCGG - Intronic
1153655060 18:7274824-7274846 GAAAAAATGCAGGCCAGGTGTGG - Intergenic
1153951201 18:10059159-10059181 GAAAGACTGCAGGCCAAGTGAGG - Intergenic
1154038569 18:10832005-10832027 ACAGAGTTGGAGGCCAGGTGCGG + Intronic
1154411098 18:14142744-14142766 GCAGGAGGGCAGGACAGCTGGGG - Intergenic
1155031274 18:21986371-21986393 GCTGTACTTCAGGCCAGGTGCGG - Intergenic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1157309207 18:46539168-46539190 ACAGATTTGCAGGCCAGGTGTGG + Intronic
1157480458 18:48050439-48050461 GCAGGGTGGCAGAGCAGGTGGGG - Intronic
1157580962 18:48773923-48773945 GGAGGGTTGAAGGCCAAGTGTGG - Intronic
1158590537 18:58775110-58775132 GAAAGAAGGCAGGCCAGGTGCGG + Intergenic
1158595114 18:58809134-58809156 ACAGGGGAGCAGGCCAGGTGCGG + Intergenic
1158607713 18:58910763-58910785 TGAGAATTTCAGGCCAGGTGCGG - Intronic
1161001825 19:1914528-1914550 GGTGGATGTCAGGCCAGGTGGGG + Intronic
1161021768 19:2014446-2014468 CCAGGGATGCAGGCCAGGTGGGG + Intronic
1161292963 19:3505708-3505730 ACAGGTTTTTAGGCCAGGTGCGG - Intergenic
1161430046 19:4226177-4226199 ACAGGAGCGCAGGCCAGGGGAGG - Intergenic
1161494739 19:4580925-4580947 GCTGGATTGGGGCCCAGGTGGGG - Intergenic
1161569502 19:5022808-5022830 GCAGGAGTGCTCTCCAGGTGGGG + Intronic
1161732756 19:5971960-5971982 GCAAGAATGCAGGCCAAGGGTGG + Intronic
1161784575 19:6315803-6315825 ATAGTATTCCAGGCCAGGTGTGG - Intronic
1161795522 19:6384210-6384232 ACAGGACTGCAGGCCAGGTTGGG + Intronic
1161819951 19:6524006-6524028 GAATGAATGAAGGCCAGGTGCGG + Intergenic
1161948775 19:7455544-7455566 GCAGCGATGCAGGCCAGGGGTGG - Intronic
1162050506 19:8029615-8029637 GGAAGATTGCAGGGCTGGTGGGG - Intronic
1162244361 19:9387171-9387193 ATAGAATTGCAGGCCAGGCGTGG + Intergenic
1162293710 19:9798205-9798227 CCACGATCTCAGGCCAGGTGCGG + Intergenic
1162501098 19:11054366-11054388 GCAGGAGGCCAGGCCAGGTTTGG + Intronic
1163704742 19:18805647-18805669 TCTGGGTTGTAGGCCAGGTGTGG - Intergenic
1164107551 19:22122073-22122095 GCAAGATTTGAGGCCGGGTGTGG - Intergenic
1164706303 19:30322803-30322825 GCAGGACCGCAGGCCATCTGAGG - Intronic
1165163227 19:33831036-33831058 GAAGTATTTGAGGCCAGGTGCGG - Intergenic
1165431862 19:35777502-35777524 GCAGGATGGCAGGTCGGGGGAGG - Intronic
1165836233 19:38758098-38758120 TCAGGGATACAGGCCAGGTGTGG - Intronic
1166075209 19:40410243-40410265 GCGGGTTGGCATGCCAGGTGGGG - Intronic
1166292699 19:41873286-41873308 GCGGGATTGCAGGCCTGCTCGGG - Intergenic
1166538596 19:43591555-43591577 TCAGGATTCCTGGCCAGGGGCGG + Exonic
1166730286 19:45055497-45055519 GCAGGCTGGCAGGCCAGAAGGGG - Intronic
1166889156 19:45979778-45979800 TTAAAATTGCAGGCCAGGTGTGG - Intergenic
1166978044 19:46616620-46616642 GAAGGGTTTCTGGCCAGGTGCGG - Intergenic
1167540652 19:50085300-50085322 GCTGGTATCCAGGCCAGGTGTGG + Intergenic
1167562479 19:50234108-50234130 GTAGGGTAGGAGGCCAGGTGCGG - Intronic
1167629064 19:50612513-50612535 GCTGGTATCCAGGCCAGGTGTGG - Intergenic
925542222 2:4978360-4978382 GCAGGATTAGAGGCCATGTATGG - Intergenic
925551659 2:5082449-5082471 GCGGCATACCAGGCCAGGTGTGG - Intergenic
926390929 2:12391982-12392004 GCAGCATTTCAGTCCAGGTTTGG + Intergenic
926703311 2:15818577-15818599 GGAGGATTCCAGGCCTGCTGGGG + Intergenic
927041012 2:19230378-19230400 GTAGGACTCAAGGCCAGGTGTGG + Intergenic
927104047 2:19809201-19809223 GCAGGATACCGGGCCTGGTGTGG - Intergenic
927523891 2:23720281-23720303 CCAGGAGGGCAGGCCAGGTGTGG + Intergenic
927651776 2:24917827-24917849 TCAGGATTGCAGGAGATGTGGGG - Intronic
927668416 2:25048302-25048324 GAATGATTCCAGGCCAGCTGTGG - Intronic
927751928 2:25677093-25677115 ATTGGACTGCAGGCCAGGTGCGG + Intergenic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
928299408 2:30112190-30112212 GCTGTAGAGCAGGCCAGGTGCGG + Intergenic
928394855 2:30935737-30935759 TCAGGATTGCAGGCCAGGCCTGG + Intronic
929117319 2:38455547-38455569 ATAGGAAAGCAGGCCAGGTGTGG - Intergenic
929222794 2:39482463-39482485 AAATGAGTGCAGGCCAGGTGTGG - Intergenic
929440707 2:41964159-41964181 GGAGGATTGCAGCCCAGCAGTGG - Intergenic
930777156 2:55184393-55184415 ACAGGAATGTTGGCCAGGTGTGG - Intronic
930787634 2:55286180-55286202 AAAGGATTTGAGGCCAGGTGTGG + Intergenic
931083894 2:58807558-58807580 GCAGAAGGGCAGGACAGGTGCGG - Intergenic
931219942 2:60280016-60280038 CCAGGAGGGCAGTCCAGGTGTGG + Intergenic
931598187 2:63973834-63973856 ACAGGATTGGTGGTCAGGTGTGG - Intronic
931725295 2:65104066-65104088 GCATGTTTCCTGGCCAGGTGCGG - Intronic
932460920 2:71881339-71881361 GAAGGTTTTCAGGCCAGGTCTGG + Intergenic
933228851 2:79782525-79782547 GAAGGCAAGCAGGCCAGGTGCGG - Intronic
933730932 2:85455845-85455867 GCAGGAGTGGAGGCAGGGTGGGG + Intergenic
933808541 2:86017711-86017733 GTTAGAATGCAGGCCAGGTGCGG - Intergenic
934490714 2:94760584-94760606 GGAGGATCCCAGGGCAGGTGGGG - Intergenic
935137569 2:100321479-100321501 GCAGGCTGGCAGGCCAGGCGCGG - Exonic
935575083 2:104701053-104701075 GCAGGATTGCAGGTCATCTTTGG - Intergenic
935890818 2:107675942-107675964 AAAGTAATGCAGGCCAGGTGTGG + Intergenic
935998889 2:108805433-108805455 TAAGTATTGCAGGCCAGGCGCGG + Intronic
936048098 2:109202242-109202264 GCAGCACTGGAGGCAAGGTGGGG - Intronic
936257258 2:110927444-110927466 GCAGGAGCACAGGACAGGTGTGG - Intronic
938394471 2:130932497-130932519 AAAGGATTCCAGGCCAGGCGCGG - Intronic
939933301 2:148258493-148258515 GGACGATTGGAGGCCACGTGTGG - Intronic
940306878 2:152236422-152236444 GCAGGACAGCTGGCCAGGTGTGG - Intergenic
940384805 2:153058139-153058161 CCAGGAATGGCGGCCAGGTGTGG + Intergenic
941928319 2:170917248-170917270 GCTGGAATGCAAGCCAGGTGTGG - Intergenic
942319669 2:174725537-174725559 CCAGGAGTGCAGGCTAGGTTGGG - Intergenic
943107697 2:183567070-183567092 GTAAGATGGGAGGCCAGGTGAGG + Intergenic
943469414 2:188275320-188275342 CCAGGGTGACAGGCCAGGTGGGG - Intergenic
944121236 2:196242981-196243003 GAAGTTTTGTAGGCCAGGTGCGG - Intronic
944528015 2:200640068-200640090 GAAGGAAGGCATGCCAGGTGTGG + Intronic
944654037 2:201860022-201860044 ACATGATTGCAGCCCAGTTGTGG + Intronic
944830487 2:203529262-203529284 TCAGTAGAGCAGGCCAGGTGCGG - Intronic
945877112 2:215289655-215289677 GCAGGATTGCAGGCAGGCTGAGG - Intergenic
946237974 2:218336769-218336791 AAAGAATTGAAGGCCAGGTGTGG - Intronic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946366961 2:219254302-219254324 GCAGGGGTGAAGGCCAGCTGTGG - Intronic
947117853 2:226791262-226791284 GCGGGCCTGCGGGCCAGGTGGGG - Intronic
947150585 2:227110968-227110990 GCAGTTTTGCCGGCCAGGCGTGG - Intronic
947511364 2:230757385-230757407 ACAGAAATACAGGCCAGGTGAGG - Intronic
947774283 2:232695731-232695753 TGATGATTGCATGCCAGGTGTGG + Intergenic
948230610 2:236346468-236346490 GCAGGACTGGAGGCCAGGCTGGG + Intronic
948306101 2:236947993-236948015 GCAGGAGGGCAGGGCAGGTCAGG + Intergenic
948742195 2:240055397-240055419 GCAGGAGCGCAGGCCAGGGCAGG + Intergenic
948795531 2:240400419-240400441 AGAGGATTGGGGGCCAGGTGGGG + Intergenic
948800047 2:240429394-240429416 GCAGGGTTGTCAGCCAGGTGAGG - Intergenic
948860142 2:240748828-240748850 GCAGGGTGGCTGGCCAGGCGTGG + Intronic
1168777305 20:458602-458624 GTAGAATTGGAGGCCAGGTATGG - Intronic
1169004450 20:2195171-2195193 TGAGGATTTCTGGCCAGGTGCGG + Intergenic
1169033621 20:2432336-2432358 ACATGTTTGCAGGCCAGGTGCGG - Intronic
1169345814 20:4827362-4827384 CAAGGATTACAGGCCAGGTGCGG + Intergenic
1169821927 20:9721355-9721377 GCAAGAATGTTGGCCAGGTGTGG + Intronic
1169830719 20:9821996-9822018 ACAAGAATGCAGGCCCGGTGTGG + Intronic
1169885260 20:10391561-10391583 TCAGAACTGCAGGCTAGGTGTGG + Intergenic
1170254360 20:14323397-14323419 GCAGGATGGCATGCCTGGAGAGG - Exonic
1170691480 20:18619713-18619735 GCAGGAGAGGAGGCCAGGTGCGG - Intronic
1170879492 20:20283564-20283586 TCAGAAATGCAGGCAAGGTGTGG + Intronic
1171880503 20:30614824-30614846 GGAGGATCCCAGGGCAGGTGTGG - Intergenic
1172137412 20:32696499-32696521 GAAGAAATCCAGGCCAGGTGTGG - Intergenic
1172202064 20:33133501-33133523 GCAGGTAGGCAGGCCAAGTGGGG - Intergenic
1172725669 20:37038891-37038913 AAATGACTGCAGGCCAGGTGCGG - Intronic
1172905792 20:38368307-38368329 AAAGCATTGCTGGCCAGGTGCGG + Intronic
1173592967 20:44239856-44239878 ACTGCATGGCAGGCCAGGTGTGG + Intergenic
1173641097 20:44602540-44602562 GAAGACTTGGAGGCCAGGTGCGG + Intronic
1174374652 20:50117785-50117807 GCAGCATTGCACTCCAGGTTGGG + Intronic
1174438297 20:50527647-50527669 GAATTATTTCAGGCCAGGTGCGG - Intronic
1174627241 20:51925997-51926019 ACAGGATACAAGGCCAGGTGTGG + Intergenic
1175136736 20:56829864-56829886 GCAGGATTACAGGGCAGGGTCGG + Intergenic
1175264614 20:57695198-57695220 AAAGGAATGCAGGCCAGGTGAGG + Intronic
1175867611 20:62189030-62189052 ACAGGGTCTCAGGCCAGGTGTGG + Intronic
1176006183 20:62864086-62864108 GAATGATTACAGGCCAGGCGCGG + Intergenic
1176027273 20:62992459-62992481 GGATGCATGCAGGCCAGGTGTGG - Intergenic
1176103753 20:63376101-63376123 GCTGGAGTGCAGGGCTGGTGGGG - Intronic
1176112831 20:63418339-63418361 GGAGGGTGGCAGGCCGGGTGGGG - Intronic
1176290974 21:5044428-5044450 GCAGTTGTGCAGGTCAGGTGGGG + Intergenic
1176841726 21:13848050-13848072 GGAGGATCCCAGGGCAGGTGGGG - Intergenic
1177773231 21:25539865-25539887 GCCAGAGTGCAAGCCAGGTGTGG + Intergenic
1179209077 21:39310846-39310868 GAAGTATTCCAGGCCAGCTGCGG - Intronic
1179216703 21:39373284-39373306 AAAAGATTCCAGGCCAGGTGGGG - Intergenic
1179216793 21:39374412-39374434 GAAAGATTGTTGGCCAGGTGCGG + Intergenic
1179340017 21:40498333-40498355 GCAGTCTTGCAGAGCAGGTGTGG - Intronic
1179710865 21:43212226-43212248 TCAGGATTGAAGCCCAGGTGTGG - Intergenic
1179769937 21:43606994-43607016 ACAGAACTGGAGGCCAGGTGTGG + Intronic
1179866281 21:44219213-44219235 GCAGTTGTGCAGGTCAGGTGGGG - Intergenic
1180624228 22:17183371-17183393 TCAGTTTTGCAGGCCAGGTGCGG - Intronic
1180683127 22:17642885-17642907 GCAGCATTACAGACCAGGTGTGG - Intronic
1180835282 22:18926572-18926594 GCAGGGGTGCAGGGCTGGTGGGG - Intronic
1181342671 22:22195423-22195445 GCAGGATGGAAGGACAGGTCAGG + Intergenic
1181526252 22:23490186-23490208 GTTGGATAGCTGGCCAGGTGTGG + Intergenic
1181812204 22:25410297-25410319 GTAGGATTACAGGCCAGGTGGGG - Intergenic
1182015537 22:27036363-27036385 GCACGCTTTAAGGCCAGGTGCGG - Intergenic
1182020673 22:27079083-27079105 ACAGGATGGCAGGGGAGGTGAGG - Intergenic
1182416705 22:30225929-30225951 GCAGGGGAGAAGGCCAGGTGAGG - Intergenic
1182514099 22:30843072-30843094 ACTGAATTGCAGGCCGGGTGCGG - Intronic
1182544523 22:31067044-31067066 TTAAAATTGCAGGCCAGGTGTGG - Intronic
1182617288 22:31595960-31595982 GGAGGATTTCAGGCCAGGTGTGG + Intronic
1183406591 22:37633291-37633313 CCAGGAGTACGGGCCAGGTGAGG - Exonic
1183537592 22:38412362-38412384 GAAAGATTGCAGGCCGGGCGTGG - Intergenic
1183743697 22:39681617-39681639 GGAGGCCTGCAGGCCAGGAGGGG + Intronic
1183973459 22:41496019-41496041 GATGAGTTGCAGGCCAGGTGTGG + Intronic
1184132971 22:42528806-42528828 GCAGGACTCCAGGCCAGGGTGGG + Intergenic
1184355342 22:43975794-43975816 GCAGGACTGCACCCCAGGTGAGG - Intronic
1184449978 22:44577020-44577042 GCAGGATCCCAGGCTAGGTTGGG - Intergenic
1184578846 22:45398408-45398430 GCCAGAGTGCAGGCCAGGTGCGG + Intronic
1184588340 22:45462866-45462888 ACAAGATTCCAGGCCAGGTGTGG - Intergenic
1184648928 22:45910813-45910835 GCATGATTGCTGGTCGGGTGGGG - Intergenic
1184938963 22:47746925-47746947 TCAAGATGGAAGGCCAGGTGCGG + Intergenic
1203285370 22_KI270734v1_random:151871-151893 GCAGGGGTGCAGGGCTGGTGGGG - Intergenic
949344631 3:3065481-3065503 TGAGGAGTCCAGGCCAGGTGCGG + Intergenic
950467297 3:13162962-13162984 GCAGGGGTGAAGCCCAGGTGAGG - Intergenic
950535453 3:13575684-13575706 GCAGGACTGGGGGCCAGGGGTGG + Intronic
951762516 3:26162040-26162062 GCCGGATTGGAGTCCGGGTGAGG + Intergenic
951911152 3:27752123-27752145 GAAGGCTTGGAGGCCGGGTGCGG + Intergenic
952257824 3:31710717-31710739 GCAGGTTTGGATGGCAGGTGTGG - Intronic
952924731 3:38312784-38312806 GCAGCAGTGGAGGCCATGTGAGG + Intronic
953699269 3:45183445-45183467 GCAGGCAGGCAGGCGAGGTGAGG + Intergenic
953934814 3:47032219-47032241 GAAGTAAAGCAGGCCAGGTGTGG + Intronic
954190054 3:48953218-48953240 TCAGAATTGCTGGCCAGGCGCGG - Intronic
955726793 3:61941866-61941888 GCCAGAATGCTGGCCAGGTGCGG + Intronic
956566027 3:70639597-70639619 TAATGATTCCAGGCCAGGTGTGG - Intergenic
956856427 3:73279697-73279719 GGATGAATGCAGGCCTGGTGTGG - Intergenic
961387389 3:126530182-126530204 GCAGGGTGGCAGGCAGGGTGGGG + Intronic
961475871 3:127145961-127145983 GAGAGATTGGAGGCCAGGTGTGG - Intergenic
965546693 3:169923451-169923473 GCTGCACTGCAGGCCAGGTGTGG + Intronic
965673489 3:171171471-171171493 GCAGGTGTGCAGGCCCAGTGAGG - Intronic
966381575 3:179349795-179349817 GAAGGATTCCTGGCCGGGTGTGG - Intronic
966608911 3:181849069-181849091 GCTGAATATCAGGCCAGGTGTGG + Intergenic
966984458 3:185166649-185166671 GCAGCATGACAGGCCAGGCGCGG + Intergenic
967028486 3:185584842-185584864 ACAGCATTCCAGGCCGGGTGTGG - Intronic
967461289 3:189749831-189749853 AAAGGAATGAAGGCCAGGTGCGG + Intronic
967617225 3:191584685-191584707 GGATGATTACAGGCCAGGTGCGG - Intergenic
967662263 3:192127478-192127500 AAAAGACTGCAGGCCAGGTGCGG + Intergenic
968427075 4:531289-531311 TCAGGAGAGCAGGCCAGATGGGG + Intronic
969074267 4:4565043-4565065 GCAGGTCTGCAGGTCAGCTGAGG + Intergenic
969558426 4:7929701-7929723 GCAGCATTCCAGCCCAGGTGGGG - Intronic
969739004 4:9010540-9010562 CAAGCAATGCAGGCCAGGTGTGG + Intergenic
969798202 4:9542162-9542184 CAAGCAATGCAGGCCAGGTGTGG + Intergenic
970167356 4:13253254-13253276 AGAGGATGGCAGGCCAGCTGAGG + Intergenic
971320134 4:25598940-25598962 ACAGGCTGACAGGCCAGGTGTGG - Intergenic
972009617 4:34160196-34160218 AAAGGTTTGCAGGCCAGGAGAGG + Intergenic
972551488 4:40139385-40139407 GCATAATTCCAGGCCAGGTGCGG - Intronic
973556059 4:52084027-52084049 ACAGGATCTCAGGCCGGGTGTGG - Intronic
973593677 4:52465519-52465541 GCGGGGTTGCTGGCCAGGCGGGG - Intergenic
973816190 4:54621606-54621628 TATGGACTGCAGGCCAGGTGCGG - Intergenic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975258946 4:72273300-72273322 TCATTATTACAGGCCAGGTGTGG - Intergenic
975461556 4:74659419-74659441 AAAGGATTGTAGGCCGGGTGTGG + Intergenic
976256068 4:83102239-83102261 TCATGATTCCTGGCCAGGTGTGG + Intronic
976262435 4:83158420-83158442 GCAGGATTGCAGTGCAGGAAAGG + Intergenic
976657019 4:87499164-87499186 CCAAGATTTTAGGCCAGGTGCGG - Intronic
977295504 4:95204497-95204519 GCAGGAATGCAGGCCAAGTATGG + Intronic
977566341 4:98584229-98584251 AGAGTATTTCAGGCCAGGTGTGG - Intronic
977904059 4:102455571-102455593 GCAGGCTTGCAGGCCTGGGAGGG - Intergenic
978335205 4:107659862-107659884 GCAGTATTTGAGGCCAGGGGTGG - Intronic
981075296 4:140585414-140585436 GCAGGAGAGCAGGCCGGGTGAGG - Intergenic
981548944 4:145923312-145923334 GATTGAATGCAGGCCAGGTGCGG + Intronic
982223584 4:153145453-153145475 TGATGACTGCAGGCCAGGTGCGG + Intergenic
982541911 4:156682935-156682957 TCAAGATTCTAGGCCAGGTGTGG - Intergenic
983557898 4:169074780-169074802 AAAGCATTGCAGGCCAGATGTGG + Intergenic
983740371 4:171123770-171123792 GCAGGAATACAGGCCAGATCTGG + Intergenic
984217248 4:176929036-176929058 GAAAGATTGCAGGCCAGGTGCGG - Intergenic
985205503 4:187530974-187530996 GCAGGAGTAGAGGCCATGTGGGG - Intergenic
985470868 5:44804-44826 TAAAGATTACAGGCCAGGTGCGG + Intergenic
985788974 5:1915297-1915319 GCAGGATTGCAGGACCTCTGGGG - Intergenic
985854426 5:2413744-2413766 GCAGGATTGGGTGCCAGCTGGGG + Intergenic
986286596 5:6363496-6363518 ACAGGAGAGCATGCCAGGTGAGG - Intergenic
986593861 5:9400157-9400179 GCAGGGTTGGAGGCGAAGTGAGG + Intronic
987789722 5:22549261-22549283 AGTGGATTGGAGGCCAGGTGCGG - Intronic
989645902 5:43632338-43632360 GCTGGACTGAAGGCCTGGTGTGG + Intronic
990740169 5:58904220-58904242 GCAGGAGTGCAGGCCCTGGGAGG + Intergenic
991483816 5:67113021-67113043 ACAGGGATGAAGGCCAGGTGTGG + Intronic
991502964 5:67295416-67295438 GCAGGATGGCTGGCGAGGGGCGG + Intergenic
992000563 5:72432223-72432245 GTAGAAATACAGGCCAGGTGCGG - Intergenic
992113944 5:73521976-73521998 CCAGCATTGCTGGCCAGGTACGG + Intergenic
992844716 5:80735091-80735113 ACATGATTACCGGCCAGGTGTGG + Intronic
994079303 5:95688536-95688558 GCATGATTTCTGGCCAGGTGTGG - Intronic
994638358 5:102372105-102372127 GCAGGATTGCAGATCATTTGAGG - Exonic
995086233 5:108113148-108113170 GCAGTATTGCAGGGAAGGTATGG + Intronic
995320099 5:110824398-110824420 ACTGGATTGGAGGCCAGGTGGGG - Intergenic
996207809 5:120763422-120763444 ACATTATTGCAGGCCAGGCGTGG - Intergenic
997238371 5:132288869-132288891 GCAGGATTCCAGGCAAGGAGAGG - Intronic
998066287 5:139161724-139161746 TTAGAATTGCTGGCCAGGTGCGG + Intronic
999349249 5:150851465-150851487 GCACGACGGCAGGCCAGGTGTGG + Intronic
1000079676 5:157833058-157833080 GCAGAAGTCCAGGCCAGGCGCGG + Intronic
1000442381 5:161279296-161279318 CCAGGATTGCAGGCCATGGATGG + Intergenic
1000557951 5:162750531-162750553 TAAGGCATGCAGGCCAGGTGTGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1003028060 6:2576374-2576396 CCAGGGTTTTAGGCCAGGTGTGG - Intergenic
1003110473 6:3248617-3248639 GCAGGCTTCCAGGCAAGGTCAGG - Intronic
1003302552 6:4897624-4897646 TCAGGAGACCAGGCCAGGTGTGG + Intronic
1004048145 6:12046488-12046510 CCTGGGTTGCTGGCCAGGTGCGG + Intronic
1004346347 6:14852716-14852738 GAAGGGTGGGAGGCCAGGTGAGG + Intergenic
1004470252 6:15922574-15922596 GCAGGGCTGCAGGCCAGCGGGGG + Intergenic
1004626814 6:17384722-17384744 GAAGGAAGGAAGGCCAGGTGTGG + Intergenic
1004718074 6:18238157-18238179 ACAAGATTCTAGGCCAGGTGTGG - Intronic
1006131153 6:31870300-31870322 GCAGGAATCCGGGCCAGGAGGGG - Intronic
1006660162 6:35634897-35634919 ACAGCATTTGAGGCCAGGTGTGG + Intronic
1006964998 6:37974353-37974375 GCATGATTTCAGGCCAGGCACGG - Intronic
1007230521 6:40344842-40344864 CCAGGACTGCGGGCCAGCTGGGG - Intergenic
1007469094 6:42076759-42076781 GGAGGATGCCCGGCCAGGTGGGG - Intronic
1007486094 6:42181760-42181782 TCAGGAGTGGAAGCCAGGTGTGG + Intergenic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1008129592 6:47705474-47705496 GCAGCATGACAGGCAAGGTGTGG - Intronic
1008209301 6:48701758-48701780 TCAGGATTGCGGGCACGGTGAGG + Intergenic
1008619748 6:53260081-53260103 GCAGGATTGCAAGCAAGGGTTGG + Intergenic
1008862912 6:56172341-56172363 GCACCATTGCAGGCCAGGAGTGG + Intronic
1009159349 6:60262329-60262351 GCAGGAAAGCAGGACAGTTGAGG + Intergenic
1010071454 6:71750220-71750242 GCAGGATTGAAGTCCAGGCTAGG + Intergenic
1010104387 6:72149854-72149876 GCTGGTCTGCAAGCCAGGTGTGG - Intronic
1010248899 6:73687885-73687907 CCAAGTTTGCAGGCCAGCTGAGG - Intergenic
1011314635 6:86017765-86017787 GCTGGGTTGCAGGAGAGGTGAGG + Intergenic
1012855516 6:104496802-104496824 GCAGGCTGGCAGGCTTGGTGAGG - Intergenic
1013876389 6:114835038-114835060 GCAGGAGTGCAGAGCAAGTGGGG + Intergenic
1015529605 6:134208200-134208222 ATAAGAATGCAGGCCAGGTGCGG - Intronic
1015568260 6:134595810-134595832 GTAGGAAGGCAGCCCAGGTGCGG + Intergenic
1015629842 6:135220997-135221019 TCAAGATTGGTGGCCAGGTGCGG - Intergenic
1015774289 6:136798028-136798050 GCAGGATTGCTGTCCACGTACGG - Intergenic
1016082070 6:139868030-139868052 TTATGATTACAGGCCAGGTGCGG - Intergenic
1017507976 6:155086086-155086108 GCTGGATTGCAGTCCAGCTCAGG + Intronic
1017746061 6:157447609-157447631 GCAGGGCTGCAGGCAGGGTGAGG + Intronic
1017873087 6:158502752-158502774 GCAGGTGTACAGGGCAGGTGGGG - Exonic
1019131605 6:169881050-169881072 CCAGGACTAAAGGCCAGGTGAGG - Intergenic
1019557256 7:1638736-1638758 GCAGGGTTGGTGTCCAGGTGCGG + Intergenic
1019983709 7:4640290-4640312 GCTGGATTACAGGCCACGCGAGG - Intergenic
1021250762 7:18322741-18322763 ACAGGATTGAAGGCAAAGTGTGG + Intronic
1023412371 7:39900779-39900801 CCTGGATTCCAGGCCAGGTGTGG - Intergenic
1023438789 7:40165823-40165845 TAACAATTGCAGGCCAGGTGTGG + Intronic
1023719955 7:43082874-43082896 GATGTATTGTAGGCCAGGTGTGG + Intergenic
1024039766 7:45542996-45543018 GCAAGTATGCTGGCCAGGTGTGG - Intergenic
1025678155 7:63659990-63660012 ACAGGAGTGTAGGCCAGGCGTGG - Intergenic
1026213231 7:68325146-68325168 AAAGGAATGCAGGCCGGGTGTGG + Intergenic
1026634668 7:72070993-72071015 GCATGATTGTTGTCCAGGTGGGG - Intronic
1026636076 7:72082909-72082931 GCAAGAAAGCAGGCCAGGTGTGG + Intronic
1026905143 7:74058644-74058666 GAAGTACTGCAGGCCGGGTGTGG - Intronic
1027131816 7:75596674-75596696 AGAAGATTTCAGGCCAGGTGTGG - Intronic
1027265260 7:76491571-76491593 GCAGGCTCTCAGGCCAGGCGTGG - Intronic
1027316629 7:76989690-76989712 GCAGGCTCTCAGGCCAGGCGTGG - Intergenic
1028154638 7:87415918-87415940 GCAGGATTGAGGGGCAGGGGAGG + Intronic
1029485257 7:100836317-100836339 GCAGGAAGCCAGGCCGGGTGGGG + Intronic
1030019386 7:105258126-105258148 GCATGATATGAGGCCAGGTGCGG + Intronic
1030148992 7:106383986-106384008 TCAAGAATGCTGGCCAGGTGCGG + Intergenic
1031966280 7:128030586-128030608 GCAGGATGGCATTCCAGGTGTGG + Exonic
1033332249 7:140426390-140426412 GCAGGACTTCAGGCTAGGAGAGG + Intergenic
1035563990 8:629047-629069 GCAGGACTACAGGCCAGGTCAGG + Intronic
1035727882 8:1835695-1835717 GCACAATTGCAGCACAGGTGCGG + Intronic
1036126820 8:6070471-6070493 GGAGGCTTACAGGCGAGGTGAGG + Intergenic
1037149261 8:15616285-15616307 TCAGAATATCAGGCCAGGTGTGG + Intronic
1037149410 8:15617426-15617448 ACAGGAATACAGGCCAGGCGCGG - Intronic
1038979182 8:32737961-32737983 GGAGACTTTCAGGCCAGGTGTGG - Intronic
1038992325 8:32881238-32881260 TCAGGTTTGCAGGCCAGGTGTGG - Intergenic
1039181114 8:34867657-34867679 GCAAGATTTCAGGCCAGGCGTGG + Intergenic
1039768946 8:40663194-40663216 GCATGACTACAGGCCAGATGGGG - Intronic
1040073802 8:43209810-43209832 GAGGTATTACAGGCCAGGTGTGG + Intergenic
1040889467 8:52301932-52301954 ACACGAGTGCAGGCCAGGTGAGG + Intronic
1043145575 8:76649278-76649300 GGAGGAGTGTAGGCGAGGTGGGG + Intergenic
1044690294 8:94870339-94870361 GTATTATTTCAGGCCAGGTGCGG - Intronic
1044975090 8:97656707-97656729 CCAGGAATTGAGGCCAGGTGCGG + Intronic
1045035693 8:98174769-98174791 TGGGGCTTGCAGGCCAGGTGTGG - Intergenic
1047109401 8:121772204-121772226 GCAGCATTGCAGTCCAGCTTGGG + Intergenic
1047336577 8:123942109-123942131 GGAGGATTGCAGCTCAGTTGGGG + Intronic
1048798019 8:138169810-138169832 GCAATATAGCAGGACAGGTGTGG + Intronic
1048931836 8:139321415-139321437 GCAGGGCTGGAGCCCAGGTGGGG + Intergenic
1048970790 8:139643913-139643935 GCTGGATTCCAGGGCAGGTGTGG - Intronic
1049380815 8:142314958-142314980 GGGGGTCTGCAGGCCAGGTGGGG - Intronic
1049698306 8:143994361-143994383 GCAGGCGAGGAGGCCAGGTGAGG - Intronic
1050382770 9:5047889-5047911 GAAAAATTTCAGGCCAGGTGTGG - Intronic
1050651879 9:7785410-7785432 GCAGTTATGCAGGCCAGGAGAGG + Intergenic
1050841291 9:10152533-10152555 GAAGGAAATCAGGCCAGGTGTGG + Intronic
1051268477 9:15331837-15331859 GAGGGATTGGTGGCCAGGTGTGG + Intergenic
1051270328 9:15349156-15349178 TCAGCTTTGCAGGCCAGGTGGGG - Intergenic
1052940577 9:34128910-34128932 AAAAGACTGCAGGCCAGGTGCGG + Intergenic
1053190681 9:36064148-36064170 GCATGATTGCAGGCAAAGTATGG - Intronic
1053667281 9:40325110-40325132 GGAGGATCACAGGGCAGGTGGGG + Intronic
1053916860 9:42950215-42950237 GGAGGATCCCAGGGCAGGTGGGG + Intergenic
1054378426 9:64465138-64465160 GGAGGATCACAGGGCAGGTGGGG + Intergenic
1054517329 9:66051173-66051195 GGAGGATCACAGGGCAGGTGGGG - Intergenic
1054955567 9:70905945-70905967 GGAGGATTGCAGGCCAGCCTTGG - Intronic
1055076507 9:72220829-72220851 GCATGCCTGCAGGCCATGTGAGG - Intronic
1055379751 9:75693327-75693349 GCAGTATTCTAAGCCAGGTGCGG + Intergenic
1056800986 9:89691268-89691290 GTACTACTGCAGGCCAGGTGTGG + Intergenic
1057117243 9:92537164-92537186 TAAGAATTTCAGGCCAGGTGCGG - Intronic
1057884507 9:98819725-98819747 GTAGGAGGGAAGGCCAGGTGGGG + Intronic
1058405800 9:104673014-104673036 ACAGTGTTTCAGGCCAGGTGTGG + Intergenic
1058715687 9:107720201-107720223 TCAGAATAGCAGGCCGGGTGCGG - Intergenic
1058860750 9:109115818-109115840 AGTGGATTGTAGGCCAGGTGCGG - Intronic
1059122230 9:111651594-111651616 ACAGAATTGCAGGCTAGGTGCGG + Intronic
1059456739 9:114404520-114404542 GCAGGGGTTCAGGCTAGGTGTGG - Intronic
1060163133 9:121385371-121385393 TAATGATTGCTGGCCAGGTGTGG + Intergenic
1060576190 9:124696946-124696968 GAAAGATTTCAGGCCGGGTGCGG - Intronic
1060590970 9:124816669-124816691 GGAAGATTAGAGGCCAGGTGTGG + Intergenic
1060894500 9:127209062-127209084 GCTGGAATCCAGCCCAGGTGAGG + Intronic
1061092171 9:128432855-128432877 GCAGGAGGCCAGGCCAGGTGCGG + Intronic
1061505376 9:131028951-131028973 CCTGGACTTCAGGCCAGGTGTGG - Intronic
1061772531 9:132937151-132937173 GCAGGAGCCCAGGCCAGGTGTGG + Intronic
1061800433 9:133110633-133110655 GTAGAATTTCAGGCCAGGTGTGG + Intronic
1062033829 9:134373963-134373985 CCAGGCTGGGAGGCCAGGTGAGG - Intronic
1062153843 9:135035048-135035070 GCAGGATTACCAGCCGGGTGTGG + Intergenic
1062153853 9:135035122-135035144 GCAGGATTGCCAGCCAGGTGCGG + Intergenic
1062607039 9:137353088-137353110 GGAGGCTTGGAGGCCAGGAGGGG - Intronic
1185471184 X:384692-384714 GACTGATTCCAGGCCAGGTGTGG + Intronic
1185671317 X:1812416-1812438 AAGGGATTTCAGGCCAGGTGCGG + Intergenic
1185953642 X:4464758-4464780 AATGGAATGCAGGCCAGGTGTGG + Intergenic
1185987633 X:4853491-4853513 GCAGGATATCAGGACAGATGAGG - Intergenic
1186115743 X:6303634-6303656 GCAGCATTGAAGGCCAGGCGTGG + Intergenic
1186820855 X:13285920-13285942 GCCGGAATGCAAGCCAGATGTGG + Intergenic
1187085973 X:16044304-16044326 GAAAGATTTTAGGCCAGGTGCGG + Intergenic
1187086955 X:16050868-16050890 GAAAGATTTTAGGCCAGGTGCGG + Intergenic
1187471495 X:19573770-19573792 ACTGGTTTGCAGGCCAGGGGTGG + Intronic
1187846947 X:23549630-23549652 TCCTGATTTCAGGCCAGGTGCGG + Intergenic
1189424846 X:40890210-40890232 GTAAGATAGAAGGCCAGGTGCGG + Intergenic
1189778219 X:44488991-44489013 GCAGGATATAGGGCCAGGTGCGG + Intergenic
1190572716 X:51800540-51800562 GAAGGGATGAAGGCCAGGTGTGG - Intergenic
1192042285 X:67635349-67635371 GCAGGATTCCAACCCAGGTCTGG + Intronic
1192142802 X:68659820-68659842 GCAGCCCTGCAGGCCAGGTGAGG + Intronic
1192214954 X:69151575-69151597 GCAGGTATTCAGGCCAGGCGTGG + Intergenic
1192764338 X:74126738-74126760 GAAGGGCTGCAGGCCAGGCGTGG + Intergenic
1193085618 X:77446308-77446330 GCAGGGGTGCAGGGCAGGTCTGG + Intergenic
1193089326 X:77477456-77477478 GAAGGCATTCAGGCCAGGTGTGG + Intergenic
1193753703 X:85379775-85379797 GCAGGTTTACATGCCAGGAGAGG + Intergenic
1194250648 X:91570581-91570603 GTGGGATTGCTGGCCAGGTGTGG - Intergenic
1196647304 X:118131834-118131856 TCAAGAATCCAGGCCAGGTGCGG - Intergenic
1196785352 X:119417125-119417147 AAAGGGTTTCAGGCCAGGTGCGG + Intronic
1196820437 X:119696374-119696396 GCATGATTTCAGGCCGGGTGCGG - Intergenic
1196864939 X:120062198-120062220 ATATGTTTGCAGGCCAGGTGTGG + Intergenic
1196878162 X:120174134-120174156 ATATGTTTGCAGGCCAGGTGTGG - Intergenic
1199342252 X:146694515-146694537 AGAGGAATGCAGGCCAGGCGTGG - Intergenic
1199353452 X:146832185-146832207 ACAGAAGTGCAAGCCAGGTGCGG + Intergenic
1200109109 X:153730210-153730232 ACAGGAATGCAGGCCGGGCGCGG - Intronic
1200214057 X:154359649-154359671 GGAGGAGTGCAGGCCAGGTCAGG + Intronic
1200569592 Y:4811830-4811852 GTGGGATTGCTGGCCAGGTGTGG - Intergenic