ID: 1133181079

View in Genome Browser
Species Human (GRCh38)
Location 16:4055163-4055185
Sequence CCTGGGGGCCCTTCCCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133181079 Original CRISPR CCTGGGGGCCCTTCCCGGTG TGG (reversed) Intronic
900168146 1:1252926-1252948 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
900370274 1:2329132-2329154 CCTGTGGGCCCTTGCCGGTGTGG + Intronic
900395936 1:2453265-2453287 CCCTGGGGCCCTTCCCCGTGTGG + Intronic
900628476 1:3620913-3620935 ACAGGGGGCCCTTCCCCGTTTGG + Intergenic
901511587 1:9720547-9720569 CCTGGGGGTCCTGCCCGGGCTGG + Intronic
902620279 1:17646787-17646809 CCTCTGGGCCCGTCCCGGCGAGG + Intronic
903577477 1:24347694-24347716 CCTGAGGGGCCCTGCCGGTGGGG + Intronic
904164444 1:28544673-28544695 CGGGGGGGCCCTTCCCTGTTTGG + Intergenic
904236688 1:29121581-29121603 CCTGGGGCCCCGGCCCGGTGCGG + Exonic
904674141 1:32187898-32187920 CTTGTGGGGCCTTCCTGGTGGGG - Intronic
905709023 1:40085288-40085310 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
906232057 1:44172354-44172376 CCTGGGGGCCCATCCAGGGTGGG - Intergenic
906514977 1:46433580-46433602 CCTGGGCTCCCTTCCAGCTGGGG - Intergenic
906954314 1:50359494-50359516 CCGGGAGGCCCTGCCCAGTGAGG - Intergenic
907455317 1:54571918-54571940 CCTGCGGGCCCTTCCTGCTGGGG - Intronic
910619333 1:89235969-89235991 CGTGGAGGCCCTGCCCAGTGAGG + Intergenic
913074592 1:115331099-115331121 GCTGAGGCCCCTTCCCGATGTGG - Intronic
914991076 1:152500115-152500137 CCTGGGGGTCTTTCCTGCTGTGG + Intergenic
915701582 1:157801936-157801958 CCTGGGGGCCCAGCGCAGTGAGG - Exonic
915728777 1:158037953-158037975 CCTGGGGGTGTTTCCTGGTGAGG - Intronic
917149410 1:171928773-171928795 GCTGGAGGACCTTCCCGGTGAGG + Intronic
919260736 1:195190684-195190706 CCTGGAGGACCTGCCCAGTGTGG - Intergenic
920117179 1:203629222-203629244 CTTGGGGGCCCTGCCCACTGGGG - Intronic
920403818 1:205694069-205694091 CCTGGGGGGGCTTCCCTCTGTGG + Intergenic
920774477 1:208922940-208922962 CCAGAGTTCCCTTCCCGGTGTGG + Intergenic
922886604 1:229025253-229025275 CCTGGTGGCTCTTCCTGGAGGGG - Intergenic
923147859 1:231210320-231210342 CCTGGGGCACCTTCCCGCAGAGG + Intronic
1063115271 10:3067951-3067973 CCCGGGGTCCTTGCCCGGTGGGG + Intronic
1064898212 10:20262844-20262866 CCTGGAGGACCTGCCTGGTGAGG - Intronic
1066255649 10:33676192-33676214 CCTGGGGACCTGTACCGGTGTGG + Intergenic
1066703691 10:38156506-38156528 CCTGGGGGTCCTGCCCCCTGGGG - Intergenic
1067048692 10:43000045-43000067 CCTGGGGGAGCTTCTAGGTGAGG - Intergenic
1067054949 10:43044974-43044996 AGTGGGAGCCCTTCCTGGTGGGG + Intergenic
1067231723 10:44416889-44416911 CCTGGGGGCCCTTCCTGAGCTGG - Intergenic
1067386001 10:45818112-45818134 CCAGGGGGCCATTGCCAGTGTGG + Intergenic
1067448876 10:46369157-46369179 CCTAGGTGGCCTTCTCGGTGCGG - Exonic
1067580925 10:47444947-47444969 CCTGGGGGACCTTCCAGATTTGG + Intergenic
1067588496 10:47491608-47491630 CCTCGGTGGCCTTCTCGGTGCGG + Exonic
1067635623 10:47999699-47999721 CCTCGGTGGCCTTCTCGGTGCGG + Intergenic
1067877900 10:50020696-50020718 CCTCGGTGGCCTTCTCGGTGCGG - Intergenic
1069621624 10:69840908-69840930 CCTGGGGCCCCTTCCAGCTCTGG - Intronic
1069871300 10:71534879-71534901 CCTGGAGGCCCCTCCTGGTTTGG + Intronic
1070132180 10:73663706-73663728 CCTCGGTGGCCTTCTCGGTGCGG + Intronic
1071609501 10:87020369-87020391 CCTCGGTGGCCTTCTCGGTGCGG - Exonic
1072722153 10:97787703-97787725 CCTGTGGGCTCTTCCCGTGGGGG + Intergenic
1073070667 10:100791229-100791251 CCTGGGGGCCTTTCCAGGACTGG + Intronic
1073454057 10:103626068-103626090 CATGCGGGCCCTTCCCAATGGGG + Intronic
1073875887 10:107920794-107920816 CCTGGAGGACCTGCCCAGTGAGG - Intergenic
1074819331 10:117166963-117166985 CCTGGGGGCCTTTCCTGCAGCGG - Intergenic
1076608398 10:131704173-131704195 GGTGGGGGCCCATCCCGGTGGGG - Intergenic
1076725733 10:132412183-132412205 CATGGGGGACTTTCCCAGTGTGG + Intronic
1076736377 10:132460998-132461020 CCTGGGGGTCCTCCCCAGAGTGG + Intergenic
1077160030 11:1108443-1108465 CCTGGGGCCTCCTCCAGGTGGGG + Intergenic
1077201234 11:1308844-1308866 CCTGGGGGGCCATCAGGGTGCGG + Intronic
1077205012 11:1337745-1337767 CCTGGGGTCCCTCCCCGCGGTGG - Intergenic
1077706625 11:4493002-4493024 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1081545097 11:44066147-44066169 CCTGGAAGCCCAACCCGGTGCGG + Intronic
1082954170 11:58851034-58851056 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1083775599 11:64893098-64893120 CCTGGCGGCCCTTCCCACAGAGG + Intergenic
1084267986 11:68014724-68014746 CCTGGGGGCACTGCCCAGGGAGG - Intronic
1084408427 11:68992155-68992177 CCAGAGGACCCCTCCCGGTGGGG + Intergenic
1084629615 11:70339053-70339075 CCTGGAGACCCTTTCCTGTGTGG + Intronic
1085880659 11:80463397-80463419 CCTGGAGGACCTGCCCAGTGAGG - Intergenic
1086569155 11:88263021-88263043 CCTGGAGGACCTGCCTGGTGAGG + Intergenic
1090355004 11:126134370-126134392 CTTGGGGCCCCTTCCAGCTGAGG - Intergenic
1091267227 11:134280920-134280942 CCTGGGGGCCCTTCTTGCTAAGG + Intronic
1092120059 12:6037626-6037648 CCTGGGTGCCTGTCCTGGTGTGG + Intronic
1092587906 12:9919623-9919645 CCTGGAGGACCCTCCTGGTGAGG + Intronic
1095835889 12:46638239-46638261 CCTGAAGGACCTTCCCAGTGAGG - Intergenic
1096080267 12:48828180-48828202 CCTGAGGGCACTGCCCAGTGGGG - Exonic
1096412501 12:51387620-51387642 CCTGTAGGCCCTTCCAGGTGGGG + Intronic
1096539483 12:52297023-52297045 CCTGTGGGCCCTTGCAGGAGTGG - Intronic
1097777731 12:63668220-63668242 CCTGGAGGTCCTCCCCGGGGAGG - Exonic
1102068047 12:109995751-109995773 CCTGGGTGTCCTGCCCGGGGAGG - Intronic
1102254975 12:111410026-111410048 CCTGGGGGCCCACCCGGATGTGG + Intronic
1102349972 12:112184846-112184868 CCTGTGGGTCCTTCCTGGTGAGG + Exonic
1104738898 12:131158223-131158245 CTTGGGGGAGCTTCCCGGGGTGG + Intergenic
1104957289 12:132473048-132473070 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957361 12:132473290-132473312 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957385 12:132473372-132473394 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957410 12:132473453-132473475 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957422 12:132473494-132473516 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957457 12:132473615-132473637 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957482 12:132473697-132473719 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957494 12:132473738-132473760 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1106103773 13:26716760-26716782 CCTGGGGCCCCTTCCCTGCCAGG - Intergenic
1112051021 13:95644087-95644109 GCTGGGGGCCCTGCCCGGGATGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114988737 14:28262439-28262461 CCTGGGGGACTTGCCCAGTGAGG - Intergenic
1115752991 14:36508690-36508712 CCTGGGGGCCCCTCGCGGCCCGG - Intronic
1115821306 14:37215163-37215185 ACAGGGGGCCCTTCCCTGTTGGG - Intronic
1119258884 14:73224937-73224959 CCTGGGGACCCTTCTGTGTGCGG + Intergenic
1119259293 14:73228109-73228131 CCAGGGGGCCCTCCGCGGAGTGG - Intergenic
1122029198 14:98900349-98900371 CTTGGGGGCCGTTCCTGGTGGGG - Intergenic
1123042642 14:105496633-105496655 CCTGGGAGGCCTTCCGTGTGTGG + Intronic
1202891100 14_KI270722v1_random:158841-158863 GATGGGGGCCCTTCCCTGTTTGG - Intergenic
1123885074 15:24718540-24718562 CATGGAGGCCCTGCCCAGTGAGG + Intergenic
1124179090 15:27456473-27456495 TCTGCGGGTCCTTCCCGGGGGGG - Intronic
1124620332 15:31270388-31270410 CCTGGGGGCCCTGGTCAGTGGGG - Intergenic
1125967909 15:43888951-43888973 CCTGGAGCCCCTTCCAGTTGGGG - Intronic
1126061193 15:44784450-44784472 ACAGGGGGCCCTTCCCTGTTAGG + Intergenic
1127188530 15:56505984-56506006 CCTGGAGGACCTTCCCAGTGAGG - Intergenic
1128622344 15:69161009-69161031 CCTGGGGGCTCTTCCGGCTTGGG + Intronic
1129767962 15:78182217-78182239 CCTGGGGGCCAGCCCCAGTGTGG + Intronic
1129880662 15:79004234-79004256 CCTGGGGGCCGTCTCCGGTGGGG + Intronic
1131229540 15:90649662-90649684 CGTGGGGACCCTTCCCAGAGGGG - Intergenic
1132713277 16:1278621-1278643 CCAGGGGGACCCTCCCGCTGAGG + Intergenic
1132889321 16:2196281-2196303 CCGGGGGCCCCTCCCCGGCGCGG - Intronic
1133181079 16:4055163-4055185 CCTGGGGGCCCTTCCCGGTGTGG - Intronic
1134097014 16:11424706-11424728 CCTGGGGGCCCCTCCAGGCCTGG + Intronic
1134124242 16:11605429-11605451 CCTGGGCTCCCTTCACAGTGTGG + Intronic
1137004900 16:35266719-35266741 CCTGGGGCCTCTTCCCTGAGGGG + Intergenic
1138195396 16:55048128-55048150 GCTGGGGACCCTTCCCCGAGGGG - Intergenic
1141608817 16:85170107-85170129 CCTGGGGCCCCGTCCTGGTGGGG - Intergenic
1141629219 16:85277623-85277645 CCCAGGGGCTCTTCCAGGTGGGG - Intergenic
1142034414 16:87854754-87854776 GCTGGGGGCCCCTCCCAGTCTGG + Intronic
1142364161 16:89640996-89641018 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1142546605 17:708316-708338 ACAGGGGGCCCTTCCCTTTGTGG + Intronic
1142670598 17:1485878-1485900 GCTGGGGTCCCCTCCAGGTGGGG + Intronic
1143507955 17:7379942-7379964 CTTGGGGGCCAGTCCCTGTGTGG - Intergenic
1143563166 17:7707038-7707060 CCTGGGGGCTCTTTCGGATGTGG + Intronic
1143637871 17:8176694-8176716 GCTGGGGGCCGCTCCCGGCGTGG - Intergenic
1143658842 17:8312603-8312625 CCTGGGACCCACTCCCGGTGAGG - Exonic
1143874612 17:9982112-9982134 GCTGGGGGCCCTTCTTGATGAGG + Intronic
1144832003 17:18136941-18136963 CCTTGGGGAGCTTCCAGGTGAGG + Intronic
1145234580 17:21199734-21199756 CCTGGGTGCCCTTCCTGGGCCGG + Intronic
1146530517 17:33604162-33604184 CCTGGGGGCCCCTTCCTGTCTGG - Intronic
1146761274 17:35481530-35481552 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1147835104 17:43324427-43324449 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1148133195 17:45274588-45274610 CCTCTGGGCCCTTGCAGGTGCGG - Exonic
1149576181 17:57715286-57715308 CCTGGTGGCCCCTCTCTGTGTGG - Intergenic
1150858355 17:68774834-68774856 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1152237326 17:79145392-79145414 CCTGGGTGCCCTCCCTGGAGAGG + Intronic
1152323973 17:79624904-79624926 CCTTGGGGCGCTTCGTGGTGGGG - Intergenic
1158676971 18:59529183-59529205 CAGGGAGGCCCTGCCCGGTGAGG + Intronic
1159586469 18:70288474-70288496 CCTGGGGTCCCCTCCCTGCGGGG + Intergenic
1160181960 18:76644539-76644561 CCTGGAGGACCTGCCCAGTGAGG + Intergenic
1160797956 19:954393-954415 CCTGGGGGTCTTTCCCTGAGGGG - Intronic
1160905393 19:1449651-1449673 CCTGAGGGTCCTGCCTGGTGGGG - Intronic
1161179752 19:2871933-2871955 ACAGGGGGCCCTTCCCTGCGTGG + Intronic
1161302811 19:3551230-3551252 CCTGGGAGCCCTGGCTGGTGCGG - Intronic
1161398305 19:4056397-4056419 CCCGGGGGCCCTCCTCGGAGGGG - Intronic
1161834055 19:6632991-6633013 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1162089453 19:8269446-8269468 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1162224196 19:9206087-9206109 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1162236346 19:9312649-9312671 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1162377881 19:10315896-10315918 CCTGGGGGCACTTCCGGGTCGGG - Exonic
1162930809 19:13956584-13956606 CCTGGGGCCCCTTGTCTGTGTGG - Intronic
1162948318 19:14056717-14056739 ACTGGGGGTCCTTCGAGGTGGGG + Exonic
1163084291 19:14968370-14968392 CCTTGGAGCCCTTCCCGGGATGG + Exonic
1163636442 19:18439032-18439054 ACTGGGGCCCCTTCAGGGTGAGG - Intergenic
1163992146 19:21008633-21008655 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1165541175 19:36492880-36492902 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1165808657 19:38597101-38597123 TCTGGGGGCCCGTTCCTGTGCGG - Exonic
1166231152 19:41426520-41426542 GCTGGGGTCCCTGCCCAGTGGGG - Exonic
1166747005 19:45146215-45146237 CCTGGGAGCTCTTCCTGGGGTGG + Intronic
1166999560 19:46737953-46737975 CCTGGGGGCCAGTCCCGCTTGGG - Intronic
1167503789 19:49861148-49861170 CCTGGAGCCCCTCCCCCGTGGGG + Intergenic
1168344271 19:55642737-55642759 CCTGGGGGCGCCTCGCGCTGGGG - Exonic
925910710 2:8571919-8571941 CCTGGGGGCCCTGAGCGGGGAGG - Intergenic
926753286 2:16216644-16216666 CGTGGAGGCCCTTCCCGGCAGGG - Intergenic
929830397 2:45342548-45342570 CCTGGGAGCCCTGCTGGGTGTGG - Intergenic
931543373 2:63353923-63353945 CCTGGAGGACCTGCCCAGTGAGG - Intronic
934519413 2:95010518-95010540 CCTGGTGGTACTTCCCCGTGGGG - Intergenic
934685853 2:96321355-96321377 CCTGGGCGCTCTTCCCCGAGCGG - Intergenic
936363497 2:111829481-111829503 CTTGTGGGCCTTTCCAGGTGGGG - Intronic
938249420 2:129802667-129802689 CCTGGGGTCCTCTCCTGGTGTGG - Intergenic
938369844 2:130762213-130762235 CTTGGGGGCCCTTCTCACTGTGG - Exonic
940335816 2:152526180-152526202 CCTGTGGGCCATTCCAGGTAAGG + Intronic
941916605 2:170817526-170817548 CCGGTGGGCCCTTCTCTGTGGGG + Intronic
942596261 2:177594221-177594243 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
943084459 2:183295602-183295624 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
943611916 2:190044628-190044650 CCTGGAGGACCTACCTGGTGAGG + Intronic
945049177 2:205807059-205807081 CCTGGGGGGACTGCCAGGTGAGG + Intergenic
946913496 2:224490346-224490368 CCAGGGGGCCCTTCCCTGTTTGG - Intronic
948468927 2:238165160-238165182 CCTGGGCTCCCTTCTGGGTGTGG - Intronic
949048970 2:241887017-241887039 CCTCCCTGCCCTTCCCGGTGCGG + Intergenic
1171282082 20:23909704-23909726 CCTGGAGGACCTGCCTGGTGAGG + Intergenic
1171409524 20:24936683-24936705 CCTGGGAGCCCTTCCCTGCCTGG - Intergenic
1171456821 20:25276937-25276959 CCTGTAGGCCCTTCCCGGGCAGG - Intronic
1173706638 20:45115038-45115060 CCTGGGGGCCCTCCTGGCTGTGG - Exonic
1175779077 20:61670898-61670920 CCTAGGGGCCCTTCCTTTTGTGG - Intronic
1175985146 20:62760844-62760866 GCTGGGGGCCCATCGCCGTGGGG + Exonic
1175999025 20:62823978-62824000 CCTGGGGTCCCGTCACTGTGTGG + Intronic
1175999034 20:62824009-62824031 CCTGGGGTCCCGTCACTGTGTGG + Intronic
1175999069 20:62824121-62824143 CCTGGGGTCCCGTCTCTGTGTGG + Intronic
1177393770 21:20507974-20507996 CCAGTGGGCCCTGCCTGGTGAGG + Intergenic
1178596895 21:33962453-33962475 CCTGGGGGTCCTTTCCTTTGTGG + Intergenic
1178831371 21:36059900-36059922 CTTGGGGACACTTCCCGGCGCGG - Exonic
1179450734 21:41466696-41466718 CCAGGGGGCCTTTCCCGCTGAGG - Intronic
1179820717 21:43935381-43935403 CCTGGGGGCACTCCCAGCTGGGG - Intronic
1179907890 21:44433710-44433732 CCGGGGGGCCTTGCACGGTGGGG - Intronic
1179979245 21:44887868-44887890 CCTCGGGTCCCTTCCTGGTGAGG + Intronic
1179979384 21:44888403-44888425 GCTGGTGGGCCTGCCCGGTGTGG + Intronic
1180078983 21:45477795-45477817 CCTGGGGGGCCTGCCCGGCCAGG - Exonic
1180112028 21:45663195-45663217 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1181903008 22:26170595-26170617 CCTGGGGTACCTTACCGGGGTGG - Intronic
1182440750 22:30362502-30362524 CCTGGGGCTCCTGCCCTGTGTGG - Intronic
1184133695 22:42533481-42533503 ACAGGGGGCCCTTCCCTGTTAGG - Intergenic
1184237013 22:43187765-43187787 CCTGGGGCCCGAACCCGGTGAGG + Intergenic
1184492833 22:44820198-44820220 CCTGTGGGCCCTTTCCCGAGAGG + Intronic
1185068770 22:48644984-48645006 CCAGGGGCCCCTTCCAGCTGGGG - Intronic
1185328770 22:50241684-50241706 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1185350461 22:50333935-50333957 CCAGGGGGCCCTTCCCTATTTGG + Intergenic
950415772 3:12868444-12868466 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
952896687 3:38082467-38082489 CCGCGGGGCCCGTCCCGGTTCGG + Intronic
953958103 3:47246905-47246927 CCTGAGGACCCTTCCTTGTGGGG + Intronic
954110998 3:48432995-48433017 CCTGGGGGCCCTGATTGGTGTGG - Exonic
954498639 3:50988821-50988843 CCTGGAGGACCTGCCCAGTGAGG - Intronic
955078938 3:55639973-55639995 CCTGGGGCTCCTGCCCTGTGTGG - Intronic
956688995 3:71858761-71858783 CCTGGGCTGCCTTCCCCGTGAGG + Intergenic
957089377 3:75713929-75713951 GATGGGGGCCCTTCCCTGTTTGG + Intronic
960342909 3:116497186-116497208 CCTGGAGGACCTGCCCAGTGAGG - Intronic
960841549 3:121963785-121963807 CCTGGAGGACCTGCCCAGTGAGG - Intergenic
961530019 3:127534859-127534881 CCTGGGGCGTCTTCCAGGTGGGG + Intergenic
964255680 3:154772275-154772297 CCTGGAGGACCTGCCCGATGAGG + Intergenic
968092688 3:195908757-195908779 CCTGGGGCTCCTTCCCGTTCAGG + Intronic
968108588 3:196022656-196022678 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
968230338 3:197002055-197002077 CCTTGTGGCCCCTCCCGGTGGGG + Exonic
968404704 4:329839-329861 ACAGGGGGCCCTTCCCTGTTAGG + Intergenic
968438712 4:610505-610527 CCTGGAGGCCTTTCCTGGGGTGG - Intergenic
968559110 4:1267706-1267728 ACAGGGGGCCCTTCCCTGTTAGG + Intergenic
968680228 4:1913622-1913644 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
968690127 4:1986052-1986074 CCTGCGGGCCCTGCCCAGTTGGG - Intronic
968958191 4:3729855-3729877 CCTGGGGGCCAGGCCCAGTGGGG - Intergenic
969045696 4:4335000-4335022 ACAGGGGGCCCTTCCCGGTTTGG + Intergenic
969298176 4:6281609-6281631 CCTGGGGGTGGTTCCCGGCGGGG + Intronic
969530689 4:7728677-7728699 CCTGTGGTCCCTCCCCTGTGAGG - Intronic
971003818 4:22351853-22351875 CTTGGAGGACCTGCCCGGTGAGG - Intronic
975377791 4:73665720-73665742 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
975378428 4:73671129-73671151 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
977649551 4:99454145-99454167 CCTGGAGGACCTGCCCGCTGAGG + Intergenic
979553356 4:122016517-122016539 CCTGGGGGCCACACCAGGTGAGG - Intergenic
984944377 4:184959745-184959767 CCTGGGGATTCTTCCTGGTGGGG - Intergenic
985291331 4:188391121-188391143 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
985975531 5:3416686-3416708 CCTGGGGGGCGTTCCTTGTGGGG - Intergenic
986216299 5:5722292-5722314 CCTGAAGGCCCTTCCTGGGGTGG + Intergenic
991286828 5:64986687-64986709 CCTGGGGGCCCAGTCCGGGGGGG - Intronic
994473431 5:100238544-100238566 CCTGGAGGACCTGCCCAGTGAGG + Intergenic
995187807 5:109290146-109290168 CCTGGAGGACCTCCCCAGTGAGG - Intergenic
997635033 5:135398731-135398753 CCTGGCGACCCTTCCTGGGGCGG - Intronic
999052145 5:148534432-148534454 CCTGGAGGACCTGCCTGGTGAGG - Intronic
1001910956 5:175517394-175517416 CCAGTGGGCCCTTCCATGTGGGG - Intronic
1001933028 5:175686637-175686659 CCCGGGAGCCCATCCCGGAGAGG + Intergenic
1001950864 5:175815479-175815501 CCTGGGGCCCCGTGCCTGTGTGG - Intronic
1002453167 5:179331172-179331194 CCTGGGGACCCTTCCTGGCTGGG - Intronic
1002550810 5:179990281-179990303 ACAGGGGGCCCTTCCCTGTTAGG + Intronic
1002575338 5:180170924-180170946 CCTGGGGGCCTTTCCCTGCCTGG + Intronic
1005922179 6:30411969-30411991 ACAGGGGGCCCTTCCCTGTTCGG - Intergenic
1006102297 6:31693117-31693139 CGAGGGGGCCCTTCCCGCCGGGG - Exonic
1006639935 6:35484691-35484713 CCTGGAGTGGCTTCCCGGTGGGG - Intronic
1006931591 6:37692222-37692244 CCTACGGGCCCTGCCCTGTGCGG - Intronic
1006982103 6:38155000-38155022 CCTGGAGGCCCTTCCTAGGGTGG - Intergenic
1007113735 6:39328751-39328773 ACTGGGGCCCCATCCCGCTGGGG + Intergenic
1008973920 6:57402055-57402077 CCTGGCGGACCTGCCCAGTGAGG + Intronic
1009162807 6:60303560-60303582 CCTGGAGGACCTGCCCAGTGAGG + Intergenic
1010547206 6:77173106-77173128 CAAGGGGTCCCTTCCTGGTGGGG + Intergenic
1011184178 6:84656060-84656082 CCTGAAGGACCTTCCCAGTGGGG + Intergenic
1013470302 6:110458179-110458201 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1015197261 6:130537246-130537268 CCTGGAGGACCTGCCTGGTGAGG - Intergenic
1015994792 6:138987390-138987412 CCTGCGGCCCCTGCCCGCTGCGG + Intronic
1018146964 6:160900510-160900532 CCAGCGGGCCCTGCCTGGTGAGG - Intergenic
1019408936 7:898319-898341 CCTGCTGGCCCCTCCAGGTGAGG + Exonic
1019485660 7:1288149-1288171 CCTGGGGACTCTGCCCGCTGGGG - Intergenic
1021186988 7:17576033-17576055 CATGGAGGCCCTGCCTGGTGAGG - Intergenic
1026853065 7:73736854-73736876 CCTGGGGACCCTACCAGGGGAGG - Intronic
1030113760 7:106048142-106048164 CTTTGGAGCCCTTCCAGGTGGGG + Intergenic
1032744750 7:134774359-134774381 CCTGGGAGCCCTGCAGGGTGAGG + Intronic
1033532094 7:142274534-142274556 CCTGGAGGACCTGCCCAGTGAGG + Intergenic
1034257851 7:149734186-149734208 CCTGGGGGCTCTACCCAGTTGGG - Exonic
1035324402 7:158055682-158055704 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1035413294 7:158663447-158663469 GCTGGTGGCCCATCACGGTGTGG + Intronic
1035686512 8:1527330-1527352 CCAGGTGGCCCCTCCCGGAGGGG - Intronic
1037759482 8:21732524-21732546 GCTGGGGGCTCTTCCCTGGGTGG - Intronic
1039454126 8:37696681-37696703 CCTGGGTGCCCTCCCCGGGAGGG + Intronic
1043229895 8:77788441-77788463 CCTGGGGGACCTGCATGGTGAGG + Intergenic
1043229984 8:77788951-77788973 GCTGGAGGCCCTACCCAGTGAGG + Intergenic
1044162442 8:88936039-88936061 CCTGGAGGACCTGCCCAGTGAGG - Intergenic
1045277804 8:100722548-100722570 CCTGTGGCCTCTTCCCGCTGCGG + Exonic
1049436087 8:142586904-142586926 CAGTGGGGTCCTTCCCGGTGGGG - Intergenic
1049494071 8:142921559-142921581 CGCAGGGGCCCTTCCCTGTGAGG + Intergenic
1049612064 8:143560430-143560452 CATGGGGTCCCGTCCCCGTGGGG + Intronic
1049743948 8:144255135-144255157 CCTGGGGGCCCACACCTGTGAGG - Intronic
1049776585 8:144408789-144408811 GCAGCGCGCCCTTCCCGGTGGGG + Intronic
1049810647 8:144567779-144567801 CCAGGGGGCCCTTCCCTGCCTGG - Intronic
1053129174 9:35605573-35605595 CCTGGGGACCCTGCCATGTGAGG + Exonic
1053151903 9:35749041-35749063 CTTGCGGGCCCGTCCCGGGGCGG - Exonic
1056127889 9:83554799-83554821 CCTGGAGGACCTGCCTGGTGAGG + Intergenic
1056572107 9:87825182-87825204 CCTGGGGGTCCTGCCTGCTGTGG + Intergenic
1056592446 9:87974401-87974423 CGTGGGCGCCCTCCCCGATGCGG + Exonic
1056847985 9:90056898-90056920 CCTGGGGGACCTTACAGGTAGGG + Intergenic
1057248644 9:93481175-93481197 CCAGGGGGCCCTGCCCAGGGTGG - Intronic
1057293340 9:93820771-93820793 CTTGGGGGCCCTTGCTGGTCTGG + Intergenic
1058005138 9:99906575-99906597 CCTGGGGGCCCTGCGGGGCGGGG + Intergenic
1058461688 9:105189545-105189567 CCTGGAGGACCTTCCCAGTAAGG + Intergenic
1058504735 9:105656165-105656187 CCGGGGGCCCCTTCCCGACGGGG - Intergenic
1059336712 9:113573647-113573669 CCAGGGTCCCCTTCCAGGTGGGG - Intronic
1059791582 9:117646403-117646425 CCTGGGGACCCTCCCTGGTGTGG - Intergenic
1061377746 9:130236188-130236210 CCTGGGATCCCTTCCTGGAGAGG + Exonic
1062213769 9:135378170-135378192 CCTGAGGGACCTTCTGGGTGGGG + Intergenic
1062327584 9:136019610-136019632 CCTGGTGCACCTTCCCTGTGTGG - Intronic
1062441751 9:136572842-136572864 CCGGTGGGCCCTTCCCCATGAGG + Intergenic
1062634811 9:137485134-137485156 CCTGGGGACGCTTGCAGGTGTGG - Intronic
1188273953 X:28177933-28177955 GCTGGGTGCCCTTCCCTTTGTGG - Intergenic
1188594231 X:31877507-31877529 CCTGGCAGCCTTTCCCTGTGTGG + Intronic
1192317747 X:70065920-70065942 CCTGTGTGCCCTCCCCAGTGAGG - Intergenic
1192930239 X:75799202-75799224 CCAGGAGGCCCTGCCCAGTGAGG + Intergenic
1193789145 X:85797420-85797442 CCTGGAGGACCTTCTCAGTGAGG + Intergenic
1194833633 X:98656394-98656416 CCTGGGGGCCCCTAGAGGTGAGG + Intergenic
1194917504 X:99723296-99723318 CCTGGAGGACCTGCCCAGTGAGG - Intergenic
1194948048 X:100091838-100091860 CCTGGAGGCCCTACCTGGTAAGG - Intergenic
1195473507 X:105259826-105259848 CCTGGAGGACCTGCCCGGTAAGG + Intronic
1196932610 X:120696354-120696376 CCTGGAGAACCTGCCCGGTGAGG - Intergenic
1198272363 X:135066739-135066761 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1200164364 X:154026021-154026043 TCTGGAGGACCTGCCCGGTGGGG - Intronic
1200831319 Y:7690483-7690505 CCTGGGGGCCGTTCCCCAGGAGG - Intergenic
1201423563 Y:13825384-13825406 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic