ID: 1133181993

View in Genome Browser
Species Human (GRCh38)
Location 16:4063479-4063501
Sequence TGGGACGATCGCTCAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40256
Summary {0: 1, 1: 19, 2: 478, 3: 6149, 4: 33609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133181988_1133181993 8 Left 1133181988 16:4063448-4063470 CCTGTAATCTCAACACTTTGGAA 0: 87
1: 3449
2: 53084
3: 344224
4: 244167
Right 1133181993 16:4063479-4063501 TGGGACGATCGCTCAAGCCCAGG 0: 1
1: 19
2: 478
3: 6149
4: 33609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133181993 Original CRISPR TGGGACGATCGCTCAAGCCC AGG Intronic
Too many off-targets to display for this crispr