ID: 1133182698

View in Genome Browser
Species Human (GRCh38)
Location 16:4070298-4070320
Sequence GCAGCTAGTAACTGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133182695_1133182698 4 Left 1133182695 16:4070271-4070293 CCAAATTATGACCTGGAAAAAAA 0: 1
1: 0
2: 6
3: 27
4: 377
Right 1133182698 16:4070298-4070320 GCAGCTAGTAACTGGAAAACTGG 0: 1
1: 0
2: 0
3: 16
4: 190
1133182696_1133182698 -7 Left 1133182696 16:4070282-4070304 CCTGGAAAAAAAACTTGCAGCTA 0: 1
1: 0
2: 1
3: 19
4: 277
Right 1133182698 16:4070298-4070320 GCAGCTAGTAACTGGAAAACTGG 0: 1
1: 0
2: 0
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133182698 Original CRISPR GCAGCTAGTAACTGGAAAAC TGG Intronic
904169536 1:28581832-28581854 GCAGCTAGTAAGTCGACACCGGG + Intergenic
908364156 1:63400992-63401014 GCAGCTTGAATCTGGGAAACCGG - Intronic
908900798 1:68954311-68954333 GCAGCAAATAACAGGAAACCAGG + Intergenic
910003123 1:82360798-82360820 ACAGCCAGAAACTAGAAAACAGG - Intergenic
911213202 1:95164376-95164398 GCAGATGGTACCTGGAAAATCGG - Intronic
911629093 1:100162351-100162373 CAAACTAGAAACTGGAAAACCGG + Intronic
912142720 1:106750989-106751011 GTAGCTAGTAAATGGCAAAATGG + Intergenic
912984758 1:114416344-114416366 GGAGATAGTAAATGGAAAACAGG - Intronic
915888603 1:159749758-159749780 GGAGATAGCAACTGGAAAGCAGG - Intergenic
916915361 1:169400914-169400936 ACAGATGGTACCTGGAAAACTGG + Intronic
917391830 1:174545479-174545501 ACAGATAGTACCTGGAAAATCGG - Intronic
921836896 1:219787551-219787573 GCTGCTTGTAACTGCAACACAGG - Intronic
922136803 1:222836535-222836557 ACAGCCAGTTACTGAAAAACAGG - Intergenic
923116529 1:230945225-230945247 GCAGCTAGTAAGTGGTGGACTGG - Intronic
923872616 1:238012462-238012484 GCAGCAAGAAATTGCAAAACAGG - Intergenic
1062948642 10:1479141-1479163 GCAGCTACTAACTGGGATCCTGG - Intronic
1068609548 10:59043734-59043756 ACAGAGAGTAACTGGAAAAACGG - Intergenic
1069227208 10:65959268-65959290 ACAGATGGTAACTGGAAAATTGG - Intronic
1071355368 10:84788450-84788472 ACAGCTAGTAAGTGGAAGAATGG - Intergenic
1073747763 10:106489303-106489325 GAAGCTAGTCACTTGAAACCAGG + Intergenic
1073838780 10:107474547-107474569 ACAGCTTGTAAGTGGTAAACTGG - Intergenic
1076946773 10:133656985-133657007 TCAGCTAGCAGCTGGGAAACAGG - Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1079862833 11:25695085-25695107 GCAGCTGGAAAGTGCAAAACTGG - Intergenic
1079875309 11:25848814-25848836 GCAGGTAGGAGCAGGAAAACAGG + Intergenic
1081320228 11:41683158-41683180 ACAGCTAGTAACTGGCAGAGGGG - Intergenic
1084718130 11:70886608-70886630 GCAGGTAGTATCTAGCAAACAGG + Intronic
1088706163 11:112466413-112466435 GCAGTTAGTGCCTGGAAAAACGG + Intergenic
1093387463 12:18575697-18575719 GCAGTTGGTAACTGGAAATCGGG + Intronic
1093833118 12:23790932-23790954 GCAGCAAGTAATTGGCAAATTGG + Intronic
1095182438 12:39161417-39161439 GCAGCAAGCAGCTTGAAAACTGG - Intergenic
1095573265 12:43706075-43706097 GGAGCTAGGACCTGGAAAAGGGG + Intergenic
1098015565 12:66100605-66100627 GCAGATGGTACCTGGAAAATCGG - Intergenic
1099362094 12:81716877-81716899 GCAGCTGGTAACCAGAAAAAAGG + Intronic
1100747205 12:97659496-97659518 GCATCTAGTCCCTGGAATACAGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102526949 12:113519383-113519405 GCAGCTAGTAACTGGGGGACGGG + Intergenic
1102619098 12:114179604-114179626 GCACCAAGAACCTGGAAAACAGG + Intergenic
1108208845 13:48118146-48118168 GCAGCCAGGAGCTGAAAAACTGG + Intergenic
1108606041 13:52039695-52039717 GGAGTTAGTAACTGGAAGATAGG - Intronic
1109406841 13:61911361-61911383 GCAGGAAGTCACTGGAAAATGGG + Intergenic
1110677241 13:78263303-78263325 GAGGCTAGAAATTGGAAAACAGG - Intergenic
1112953398 13:105030537-105030559 GCGGCTAGGAAATGCAAAACTGG - Intergenic
1113147452 13:107223671-107223693 GCAGCAAGTCAATGGAACACAGG - Intronic
1114255999 14:21001776-21001798 GCAGCTATTAATTGGAGAATTGG + Exonic
1115036023 14:28857728-28857750 GAAGCTAGTCACTGCCAAACAGG - Intergenic
1116053810 14:39838663-39838685 ACAGCTGGTAGGTGGAAAACTGG + Intergenic
1116783536 14:49263696-49263718 GTAACAAATAACTGGAAAACTGG + Intergenic
1116832867 14:49739615-49739637 GCAGATAGTAATAAGAAAACTGG + Intronic
1117702086 14:58424406-58424428 ACAGATAGTAACTGGACAGCTGG + Intronic
1118389770 14:65286562-65286584 GCATCTAGCTACTGGAAGACAGG - Intergenic
1122006134 14:98705386-98705408 GCAGCTGGTCAATGGAAAAGGGG + Intergenic
1128745765 15:70113225-70113247 GTAGCTAATAACTGCAGAACAGG + Intergenic
1129896588 15:79112838-79112860 GCAGCCAGTTGCTAGAAAACAGG - Intergenic
1130079528 15:80720301-80720323 ACAAGTAGAAACTGGAAAACAGG - Intronic
1130669721 15:85900769-85900791 GCAGCATGTACCTGGAAATCAGG - Intergenic
1132187234 15:99811624-99811646 ACAGCTAATCACTGGAAATCGGG + Intergenic
1133182698 16:4070298-4070320 GCAGCTAGTAACTGGAAAACTGG + Intronic
1133698086 16:8283948-8283970 GAAGCAAGTAACAGGGAAACGGG - Intergenic
1134395377 16:13857851-13857873 GCATCTAGAAAGTGGAAAACTGG - Intergenic
1135411223 16:22236095-22236117 GCAGCAAAAAACTGGAAACCAGG - Intronic
1137932055 16:52598180-52598202 GCTGGTAGTAATTAGAAAACTGG + Intergenic
1138265955 16:55659817-55659839 ACAGCTAGAAACTGGAACCCAGG - Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1151972689 17:77467028-77467050 GGATTTAGTAACTGGCAAACTGG - Intronic
1203170703 17_GL000205v2_random:145977-145999 TCAGTTAGCAACTGGGAAACAGG - Intergenic
1153578901 18:6551214-6551236 GCAGCTTGGAACTGGGTAACAGG - Intronic
1156802698 18:41137003-41137025 GCAGCTAGTGACTAGAAGCCAGG - Intergenic
1156955893 18:42963404-42963426 GAAGAAAATAACTGGAAAACTGG + Intronic
1157148335 18:45189116-45189138 AAAGCTAGTAAGTGGCAAACTGG + Intergenic
1158301939 18:56062330-56062352 GGAGCTAGGAAATGGAAACCAGG + Intergenic
1162038951 19:7957851-7957873 GAAACTAGCAACTTGAAAACGGG + Intergenic
1166889440 19:45981554-45981576 GCAGCCAGGACCTGGAACACAGG - Intergenic
1168652527 19:58100787-58100809 GCAGCTTGAAACTGGAAGGCAGG + Intronic
925124228 2:1442676-1442698 GCAGCTTGTAACTGACAAAGTGG - Intronic
927060957 2:19418903-19418925 TCAGCTACAAACTGGAAAGCAGG + Intergenic
927938498 2:27088876-27088898 GCAGCTAAGAACTGGATAAGAGG + Intronic
930733305 2:54749735-54749757 CCAGCTAGTAGCTGTCAAACAGG + Intronic
931051483 2:58419984-58420006 ACAGAAAGTATCTGGAAAACTGG + Intergenic
932608238 2:73178215-73178237 GCAGCTAGTAAGTGGCAGAAGGG - Intergenic
933014062 2:77102036-77102058 ACAGATAGTAACTGGGAAACAGG - Intronic
935155429 2:100480030-100480052 GCCCCTAGTACCTGGAAAACTGG + Intronic
937545850 2:123019653-123019675 GCTGATACTAACTGGAAATCTGG + Intergenic
938823463 2:134981470-134981492 ACAGCTAATAGCTGTAAAACAGG - Exonic
939325713 2:140685478-140685500 ACAGCTTGTAACTGGTGAACAGG + Intronic
939932082 2:148247947-148247969 GCAGCTATGAACTGGAAAGATGG + Intronic
940825214 2:158403952-158403974 ACAGCTAGTAACTGATAAACTGG - Intronic
943069176 2:183120871-183120893 GCAGCAAGCATCTGGAAAAGTGG + Intronic
943252557 2:185547242-185547264 GCAGCTAGTAGAAGAAAAACCGG - Intergenic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
946729991 2:222699864-222699886 GCTGGTATTAACTGAAAAACTGG + Intronic
948936385 2:241167636-241167658 GCAGCCAGTCCCAGGAAAACTGG + Intronic
1169510994 20:6263398-6263420 CCAGCTAGTAATTGCAAATCAGG - Intergenic
1170225815 20:13991043-13991065 GCAGTTTCTAACTGGAAAAGAGG - Intronic
1170695097 20:18650794-18650816 GCAGGTAGTAATTGGGCAACTGG + Intronic
1170745427 20:19094531-19094553 TCAGCTGGGAACTGCAAAACTGG - Intergenic
1170974713 20:21151162-21151184 ACAGCTAGTAAGTGGCATACTGG + Intronic
1172218807 20:33257612-33257634 CCAGCTATTAACTGGAAGCCTGG + Intergenic
1172507210 20:35472352-35472374 GCAGCTAGAAACAGGAAAGAGGG - Intronic
1175122035 20:56723226-56723248 GCATCTAGTGAGTGGAAGACAGG - Intergenic
1175318794 20:58071065-58071087 GCAGCTAGAGATTGGGAAACTGG + Intergenic
1176326687 21:5507808-5507830 TCAGTTAGCAACTGGGAAACAGG - Intergenic
1176331020 21:5548403-5548425 TCAGTTAGTAGCTGGGAAACAGG + Intergenic
1176396737 21:6272548-6272570 TCAGTTAGTAGCTGGGAAACAGG - Intergenic
1176401070 21:6313143-6313165 TCAGTTAGCAACTGGGAAACAGG + Intergenic
1176436087 21:6675961-6675983 TCAGTTAGCAACTGGGAAACAGG - Intergenic
1176440420 21:6716556-6716578 TCAGTTAGTAGCTGGGAAACAGG + Intergenic
1176460349 21:7003031-7003053 TCAGTTAGCAACTGGGAAACAGG - Intergenic
1176464682 21:7043625-7043647 TCAGTTAGTAGCTGGGAAACAGG + Intergenic
1176483910 21:7384809-7384831 TCAGTTAGCAACTGGGAAACAGG - Intergenic
1176488243 21:7425404-7425426 TCAGTTAGTAGCTGGGAAACAGG + Intergenic
1177880109 21:26683593-26683615 GTTGCTAGTAAATGCAAAACTGG - Intergenic
1177926395 21:27221239-27221261 GCAGCTAACAGCTGGAAAAAGGG + Intergenic
950263243 3:11556984-11557006 ACAGCTAAAAACTGTAAAACCGG + Exonic
950381726 3:12621223-12621245 ACAGCTTGTAAGTGGCAAACTGG + Intronic
951277426 3:20705540-20705562 ACAGCTAATAACTTGTAAACAGG - Intergenic
952005980 3:28842673-28842695 ACAACTAGTAACTGCAAAGCAGG - Intergenic
954492726 3:50922430-50922452 ACAGACAGTAACTGGAAAATTGG - Intronic
955720285 3:61873207-61873229 GCAGTTTGTAAGCGGAAAACTGG + Intronic
955991768 3:64635269-64635291 CCAGCTTGTAACTGCAAAGCTGG - Intronic
956326263 3:68056221-68056243 GCAGCTAGAAACTAGCAAAATGG - Intronic
956862483 3:73338738-73338760 ACAGATGGTACCTGGAAAACTGG - Intergenic
958466188 3:94462051-94462073 TCACCTTTTAACTGGAAAACTGG + Intergenic
959096678 3:101964159-101964181 GCACCCAGCAACTGGAAATCAGG - Intergenic
960697499 3:120410371-120410393 ACAGCTAGTAATTGGCAGACTGG - Intronic
963078900 3:141372977-141372999 GCAGCTAGAAATTAGAAATCAGG - Intronic
965889504 3:173493701-173493723 ACAACCAGTAAATGGAAAACTGG + Intronic
966041535 3:175495894-175495916 GCAGCTATTAACTAGCACACTGG - Intronic
966174168 3:177117255-177117277 GCAGCTACTATTTGGAAGACAGG - Intronic
967144053 3:186591087-186591109 GCAGCTGGGAACTGGAAATGGGG + Intronic
967719265 3:192798463-192798485 GCAGCTAGTGACTGAGAACCCGG - Exonic
967807917 3:193731501-193731523 GCTGCTGGAATCTGGAAAACAGG + Intergenic
970578933 4:17455725-17455747 GCAGGAAGTAACTGCAAAAGTGG + Intergenic
971112922 4:23609221-23609243 GCAGCACGTAAAGGGAAAACAGG - Intergenic
972972365 4:44593347-44593369 ACAGATGGTAACTGGAAAATTGG + Intergenic
974630378 4:64480437-64480459 GAAGCTAGGGACTGGAAAAAAGG + Intergenic
976730220 4:88253945-88253967 GCAGCCATTAATTGGAAACCAGG - Intergenic
978104602 4:104886437-104886459 GCAACTTGTGACTGGAATACTGG - Intergenic
978694841 4:111565390-111565412 ACAGATGGTAACTGGAAAATCGG + Intergenic
979318278 4:119293099-119293121 GCAGCTATCAACTGAAAAATAGG - Exonic
982785695 4:159533935-159533957 GCAGGTGGTACCTGGAAAATTGG - Intergenic
982975048 4:162045773-162045795 TCAGTTAATAACTGGAAAAGTGG - Intronic
985450229 4:190057784-190057806 TCAGCTAGCAGCTGGGAAACAGG - Intergenic
988150318 5:27369243-27369265 GCAATTAATAACTGGAACACTGG - Intergenic
989230468 5:39080640-39080662 GCAGTGAGCAACTAGAAAACTGG + Intergenic
993557609 5:89360668-89360690 GCATCTAGTGACTGGAGACCAGG - Intergenic
998976116 5:147650189-147650211 TCAGCTAGTATCTTGAGAACAGG - Intronic
999665317 5:153906692-153906714 GCAGCTACTAACTGGCATTCCGG + Intergenic
1000334254 5:160230283-160230305 ACAGCTAGTAATTGGTAAAGTGG + Intronic
1006006619 6:31007605-31007627 GCAGCGAGAATCTGGAACACAGG + Intergenic
1009398038 6:63224955-63224977 TCAGTGAGGAACTGGAAAACTGG - Intergenic
1009472263 6:64042369-64042391 TTAGCTAGTGACTGGAAAATGGG + Intronic
1011157656 6:84351110-84351132 GCAGCAAGTATCTGGAAAGTAGG - Intergenic
1011397724 6:86927493-86927515 GCAGCCAGTATGTGGCAAACTGG - Intergenic
1011785816 6:90843654-90843676 ATTGCTAGTAACTGAAAAACTGG - Intergenic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1016884732 6:148948853-148948875 GCAGCCAGTAAATAAAAAACAGG + Intronic
1019125474 6:169837792-169837814 GCTCCTAGAAGCTGGAAAACAGG + Intergenic
1021458868 7:20862203-20862225 GCAAATATTAACTGCAAAACTGG + Intergenic
1021935563 7:25627719-25627741 ACAGCTAGTAATTGAAAACCAGG + Intergenic
1031350419 7:120723808-120723830 ACAGGTAGAAACTGGAAAAGTGG + Intronic
1032451949 7:132039335-132039357 GAAGCAAGCAACTGGAAGACAGG - Intergenic
1033738510 7:144249312-144249334 GTAGCTAGTAGCTGGCAAAGAGG - Intergenic
1033744541 7:144301642-144301664 GTAGCTAGTAGCTGGCAAAGAGG + Intergenic
1033902240 7:146157500-146157522 ACAGATGGTACCTGGAAAACTGG + Intronic
1034359763 7:150484265-150484287 GAAGCCAGTCACTGCAAAACAGG - Intergenic
1034379372 7:150677039-150677061 GAAGCCAGTCACTGCAAAACAGG - Intergenic
1036215905 8:6879575-6879597 CCTGCTGGTAAATGGAAAACTGG + Intergenic
1036797346 8:11765880-11765902 AGAGCTAGTAAGTGGAAATCAGG + Intergenic
1037828088 8:22171688-22171710 ACTGCTAGTCACTGGAAAACTGG - Intronic
1042106087 8:65327589-65327611 ACAGCTACTAACTGGAAGACTGG + Intergenic
1042735571 8:71984190-71984212 GCAACTGGTAACAGCAAAACTGG + Intronic
1045315034 8:101036485-101036507 GCAGCAAGTTTCTGGAGAACAGG - Intergenic
1045429720 8:102102561-102102583 GCACCTAGCAAGTGGAAAAAGGG + Intronic
1045551932 8:103180599-103180621 GGAGAGAGAAACTGGAAAACAGG + Intronic
1048858431 8:138703890-138703912 ACAGATTGTAACTGGAAAATTGG + Intronic
1049959447 9:724344-724366 GAAGCTAGTAATGGGAAGACAGG + Intronic
1050422219 9:5477709-5477731 ACAGACAGTACCTGGAAAACCGG - Intergenic
1051260875 9:15263388-15263410 CCAGCCAGTAAATGGCAAACTGG + Intronic
1051681933 9:19616415-19616437 ACAGCTAGTAAATGCAGAACTGG + Intronic
1051886165 9:21895575-21895597 ACAGATGGTACCTGGAAAACTGG + Intronic
1052028809 9:23605346-23605368 ACAGCTAGTAAATGGAACACTGG + Intergenic
1053001400 9:34578878-34578900 GCAGAAAGTAACTGGAGGACGGG - Intronic
1055007846 9:71528911-71528933 GAAGCCAGTAAGTGGAGAACAGG + Intergenic
1056095290 9:83246941-83246963 GCAGATAGGAACTGGAGAAATGG - Exonic
1056182766 9:84101978-84102000 GGCGCTTTTAACTGGAAAACTGG + Intergenic
1056997161 9:91473590-91473612 ACAGACAGTACCTGGAAAACTGG - Intergenic
1057734561 9:97643552-97643574 GCAGCTAGCATCTGGAATACTGG - Intronic
1058543291 9:106034548-106034570 GCAGCTATTATCTGCAAAGCTGG - Intergenic
1058621678 9:106889576-106889598 GCATTCAGTAACAGGAAAACAGG - Intronic
1059080756 9:111246750-111246772 GCAGCTAATAACTGTAAAAGGGG + Intergenic
1060750763 9:126166946-126166968 GCAGCCAGCAGCTGGAATACTGG + Intergenic
1060814817 9:126629485-126629507 ACAGCTAGTAAATGGAACCCAGG + Intronic
1061309665 9:129753844-129753866 GCCTCTAGAAACTGGAAAAGGGG + Intergenic
1203431082 Un_GL000195v1:91923-91945 TCAGTTAGTAGCTGGGAAACAGG - Intergenic
1203435429 Un_GL000195v1:132700-132722 TCAGTTAGCAACTGGGAAACAGG + Intergenic
1186168084 X:6848354-6848376 GCAACTAGTAATTTGAAAATAGG + Intergenic
1187390933 X:18886302-18886324 TAATCTAGTAACTGGAAAATGGG - Intergenic
1189491802 X:41475867-41475889 GCAGCCAGTAGCTGGGAAAGGGG + Intergenic
1189986661 X:46559392-46559414 GCATCTAATAGCTGAAAAACAGG + Intergenic
1190573106 X:51804859-51804881 GCAGATATTAATGGGAAAACAGG + Intronic
1192252642 X:69425518-69425540 GCAGCTGGTGACAGGAAAATAGG - Intergenic
1193289354 X:79753534-79753556 GGAGCTAGTGCCTGGAAAACAGG + Intergenic
1193592488 X:83407383-83407405 ACAGATAGTACCTGGAAAACTGG + Intergenic
1195931852 X:110085947-110085969 TCATCTAGAAACTGGCAAACCGG - Intronic
1196938885 X:120756235-120756257 GAACCTAGTAACAAGAAAACAGG - Intergenic
1202053784 Y:20807896-20807918 GAAGGTATTATCTGGAAAACAGG + Intergenic