ID: 1133184955

View in Genome Browser
Species Human (GRCh38)
Location 16:4089407-4089429
Sequence AATCGTATGCTATCCTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133184953_1133184955 -4 Left 1133184953 16:4089388-4089410 CCATTCCTTTTTAAGGCTGAATC 0: 2
1: 38
2: 160
3: 407
4: 941
Right 1133184955 16:4089407-4089429 AATCGTATGCTATCCTACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 35
1133184951_1133184955 21 Left 1133184951 16:4089363-4089385 CCACGTTGTCACATGTATCAGAA 0: 1
1: 3
2: 37
3: 375
4: 1708
Right 1133184955 16:4089407-4089429 AATCGTATGCTATCCTACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 35
1133184954_1133184955 -9 Left 1133184954 16:4089393-4089415 CCTTTTTAAGGCTGAATCGTATG 0: 1
1: 2
2: 120
3: 1154
4: 7033
Right 1133184955 16:4089407-4089429 AATCGTATGCTATCCTACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133184955 Original CRISPR AATCGTATGCTATCCTACAG AGG Intronic