ID: 1133185089

View in Genome Browser
Species Human (GRCh38)
Location 16:4090180-4090202
Sequence AAGTATCCATAGGGCGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133185089_1133185098 5 Left 1133185089 16:4090180-4090202 CCCCCCACGCCCTATGGATACTT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1133185098 16:4090208-4090230 CCCAACTTAGCAAATACAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 115
1133185089_1133185100 8 Left 1133185089 16:4090180-4090202 CCCCCCACGCCCTATGGATACTT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1133185100 16:4090211-4090233 AACTTAGCAAATACAGCTGGAGG 0: 1
1: 0
2: 2
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133185089 Original CRISPR AAGTATCCATAGGGCGTGGG GGG (reversed) Intronic
905298819 1:36972195-36972217 GAGAATCCACAGGGCCTGGGAGG + Intronic
914719828 1:150280750-150280772 GAGTTTCCATAGAGTGTGGGGGG + Intronic
915545927 1:156597799-156597821 GAGCAGCAATAGGGCGTGGGAGG - Intronic
1063973076 10:11395077-11395099 AAGTAGCCACGGGGCATGGGTGG - Intergenic
1070152343 10:73812397-73812419 AAGTACCCAAAGGGAGTAGGAGG + Intergenic
1076992343 11:282047-282069 AAGTTTTCATAGGTTGTGGGTGG - Intronic
1078699847 11:13669311-13669333 AAGGATTGATAGGGCCTGGGTGG + Intronic
1084019496 11:66409282-66409304 ATGTCTCCATAGAGGGTGGGGGG - Intergenic
1087648138 11:100831845-100831867 AAGTATGAATAGGGCATAGGAGG - Intronic
1090206384 11:124886766-124886788 ATGTACCCATAGGTGGTGGGGGG + Exonic
1097714743 12:62954530-62954552 GAGTTTCCATAGGCCCTGGGTGG + Intergenic
1102112936 12:110378811-110378833 AAGTAACCATAGTGTGTGGAAGG - Intronic
1108673375 13:52714073-52714095 AAGTATGCTGAGGGCTTGGGAGG + Intronic
1109495983 13:63172350-63172372 AAGTATCAATAGGACATGTGTGG + Intergenic
1119381840 14:74234145-74234167 AAGTATCATTGGGGCGGGGGGGG + Intergenic
1125889685 15:43256397-43256419 GAGCAGCCATAGGGAGTGGGAGG - Intronic
1129931230 15:79412589-79412611 AAGTTGCCATTGGGCGTGAGGGG + Intronic
1132944394 16:2524618-2524640 GTGTATCCATAGGGCTTGTGAGG + Intronic
1133185089 16:4090180-4090202 AAGTATCCATAGGGCGTGGGGGG - Intronic
1135656871 16:24257574-24257596 ATGTGTGCATAGGGTGTGGGTGG - Intronic
1142125053 16:88406058-88406080 AACTTTCCACAGGGCCTGGGAGG + Intergenic
1150772755 17:68055470-68055492 AAGTATCCATATGTGGTGGCAGG - Intergenic
1162340067 19:10086743-10086765 AAGTCCCCACAGGGCGTTGGGGG - Intronic
1165362880 19:35347414-35347436 AAGTCTTCATGGGGCCTGGGGGG + Intergenic
1166841420 19:45699396-45699418 GAGTATCCTTAGAGCCTGGGAGG + Intronic
1167378307 19:49124063-49124085 AAGTGTCTATAGGGCGGGGAGGG - Intronic
928043482 2:27903094-27903116 AATTATCCATACGGTGGGGGGGG - Intronic
936290873 2:111223050-111223072 CAGGATCCATGGGGTGTGGGGGG + Intergenic
947581678 2:231323551-231323573 AGGCATCCTTAGGGCTTGGGAGG - Intronic
1170438481 20:16353802-16353824 AGGTATCCATATGGGGTGGAAGG + Intronic
1172009770 20:31839823-31839845 AAGTGTCCTAAGGGAGTGGGAGG + Intergenic
1173307241 20:41862331-41862353 AAGTATCCATTGGGAGTAGAGGG + Intergenic
967423270 3:189297483-189297505 AAGTAGTCAGAGGGAGTGGGAGG - Intronic
967795651 3:193596127-193596149 TGGTATCCAAAGGGAGTGGGAGG - Intronic
974237337 4:59199085-59199107 AAGTATCCCTTGAGCCTGGGAGG - Intergenic
985919970 5:2962781-2962803 AAGAATCAATTGGGAGTGGGCGG + Intergenic
987255695 5:16148559-16148581 AAGGATCCATAGGTCGGGTGGGG - Intronic
990211000 5:53481249-53481271 AAGTATCCAAAAGATGTGGGAGG - Intronic
997059907 5:130488575-130488597 AAGTTTCCCTAGGCCCTGGGTGG - Intergenic
999285258 5:150390801-150390823 CAGTATCCCTAGGGCCTGGCAGG - Intronic
1003946105 6:11077458-11077480 AAGTATCCTGAGGGCATGGTAGG + Intergenic
1006272545 6:32975131-32975153 AAGTTTCCAGAGTGGGTGGGAGG + Intronic
1012999299 6:106006642-106006664 AAGTATCCTCAGGGTTTGGGTGG + Intergenic
1013361596 6:109398441-109398463 AATTATCCCTATGGAGTGGGTGG + Intronic
1013796351 6:113893628-113893650 AAATAGCCAGAGGGAGTGGGAGG - Intergenic
1017324459 6:153130455-153130477 ATGTATGTATAGGGGGTGGGGGG - Intronic
1023691551 7:42794222-42794244 AAGAAGCCACAGGGAGTGGGTGG + Intergenic
1026241948 7:68583387-68583409 CTGTATCCTGAGGGCGTGGGTGG - Intergenic
1029055397 7:97735154-97735176 AAGTAAGCTTAGGGGGTGGGTGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1038896691 8:31791117-31791139 AAGAATCCATTGAGCCTGGGAGG + Intronic
1042994153 8:74675494-74675516 TAGTATCTATAGGGAGTGGGGGG + Intronic
1060937514 9:127524233-127524255 AAGTGTCCACAGGGGGAGGGAGG + Intronic
1186229539 X:7438651-7438673 AAGCATCCATAGGGAGTGAAGGG + Intergenic
1188231175 X:27665181-27665203 AAGTATTCATAAGTCATGGGAGG + Intronic
1195780682 X:108460391-108460413 AAGTATCTTTAGGGGGTGGAGGG - Intronic
1196892129 X:120301575-120301597 AAGAATCCGTGGGGGGTGGGGGG - Intronic