ID: 1133185670

View in Genome Browser
Species Human (GRCh38)
Location 16:4096144-4096166
Sequence ACACACGCCCTGCAATTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133185670 Original CRISPR ACACACGCCCTGCAATTTAG TGG Intronic
909730919 1:78888340-78888362 ACACACACCATGCAATTAGGTGG - Intergenic
921805750 1:219452546-219452568 ACACTGGTACTGCAATTTAGTGG - Intergenic
1064630346 10:17304931-17304953 ACACACCCCCTGCAATATTGCGG - Intergenic
1064630444 10:17305428-17305450 ACACACCCCCTGCGACATAGGGG - Intergenic
1067184093 10:44012486-44012508 ACACACGCCCTGCTATCCAAAGG - Intergenic
1067999314 10:51313058-51313080 ACACACACACTGCAACTTAATGG - Intronic
1068177830 10:53485211-53485233 ACACACGCACAGAAATATAGAGG + Intergenic
1068433049 10:56957718-56957740 ACACGAGGCCTGCAATTTAGAGG - Intergenic
1073625986 10:105097474-105097496 ACACACACCCTCCATTTAAGAGG + Intronic
1075840769 10:125500605-125500627 ACACACGCCCCGCAATGCTGTGG + Intergenic
1085967242 11:81542184-81542206 ACATATGCGCTGCATTTTAGTGG - Intergenic
1085995526 11:81908135-81908157 ACAAACACACTGCAATTTTGTGG - Intergenic
1092703149 12:11255914-11255936 TCCCAGGCCCTGCAGTTTAGAGG - Intergenic
1097816060 12:64075067-64075089 ACACACGCACAGAAATATAGAGG + Intronic
1100506980 12:95231386-95231408 AGGCACGCCCTCCAATTCAGTGG + Intronic
1106807548 13:33326103-33326125 ACACAAGCACTGCACTTCAGTGG + Intronic
1113124299 13:106959473-106959495 AGACAGGCACTGCAATTGAGAGG - Intergenic
1114690162 14:24573905-24573927 ACACACACCCAGCAATTGAAGGG - Intronic
1116107589 14:40530153-40530175 ACACAAGCACTGTAATTGAGTGG - Intergenic
1116517446 14:45818658-45818680 ACACACCCCCTGCGATATTGAGG + Intergenic
1116656336 14:47658014-47658036 ACACAGGCCCTGTAATTCTGGGG - Intronic
1117073067 14:52073603-52073625 ACACACACCCTGGAATTTAATGG - Intergenic
1117601714 14:57382607-57382629 ACACACCCCCTGCAGATAAGGGG + Intergenic
1120004351 14:79340146-79340168 ACACACACCCTTAAATTCAGAGG - Intronic
1122280599 14:100620062-100620084 AGGCCCCCCCTGCAATTTAGGGG + Intergenic
1202879378 14_KI270722v1_random:43460-43482 ACACACACACTGAAATATAGAGG - Intergenic
1126693483 15:51306243-51306265 ACACAAGCACTGCCATTTTGTGG + Intronic
1128805826 15:70530598-70530620 ACACACTTCCTCAAATTTAGAGG + Intergenic
1133185670 16:4096144-4096166 ACACACGCCCTGCAATTTAGTGG + Intronic
1142396659 16:89835813-89835835 ACACACGCGCTGGAATGAAGGGG - Intronic
1142651987 17:1359801-1359823 ACACACACACAACAATTTAGTGG - Intronic
1143916923 17:10301139-10301161 ACAAACGCCCTGCAAAACAGGGG + Intronic
1147865645 17:43550257-43550279 CCAGAAGCCCTGTAATTTAGAGG - Intronic
1150765513 17:67998834-67998856 ACCCACACCCTGAAATGTAGAGG + Intergenic
1156315972 18:35968959-35968981 ACACACGCACAGAAATATAGAGG - Intergenic
1156972735 18:43176536-43176558 ACACAAGTCCTGCAGTTGAGAGG - Intergenic
1163278297 19:16299739-16299761 ACACACCCCCTGCGATATTGAGG + Intergenic
1202654997 1_KI270708v1_random:12469-12491 ACACACACACTGAAATATAGAGG - Intergenic
929242612 2:39666978-39667000 ACACACACCCTGCACTTCAGGGG - Intronic
929883255 2:45855613-45855635 ACACAAGCCCTTGACTTTAGGGG + Intronic
929924122 2:46195246-46195268 GCCCAGGCCCTGCAATTTAGAGG - Intergenic
930326824 2:49930368-49930390 ACACACACTCTGTATTTTAGAGG - Intronic
935240592 2:101174800-101174822 ACACACGCACAGAAATATAGAGG + Intronic
942188138 2:173444281-173444303 ACACAGGCTCTGTATTTTAGAGG - Intergenic
942536426 2:176969267-176969289 ACACACACCTTGCAAGTTTGTGG - Intergenic
943062525 2:183053312-183053334 ACACACGCACAGAAATATAGAGG + Intergenic
945810841 2:214548269-214548291 ACACAAGGCATGCAATTTACAGG + Intronic
1176640682 21:9300924-9300946 ACACACACACTGAAATATAGAGG - Intergenic
1179614391 21:42572323-42572345 ACACCTGCCCTTCACTTTAGGGG + Intronic
1180349707 22:11790307-11790329 ACACACACACTGAAATATAGAGG - Intergenic
1180388496 22:12201932-12201954 ACACACACACTGAAATATAGAGG + Intergenic
1184965377 22:47968078-47968100 GCACATGCCCTGCCATTCAGAGG + Intergenic
956942757 3:74182908-74182930 AGACACTCCCTGAAATATAGTGG + Intergenic
1202746211 3_GL000221v1_random:104100-104122 ACACACACACTGAAATATAGAGG + Intergenic
968732094 4:2274000-2274022 ACACACGGGCTGCGCTTTAGGGG - Intronic
971380533 4:26093189-26093211 ACAGACCACCTGAAATTTAGTGG - Intergenic
971430517 4:26561346-26561368 ACACACCCCCTCCATTTTAAAGG + Intergenic
974535043 4:63163869-63163891 ACACACACACTGAAATATAGAGG + Intergenic
977358707 4:95978605-95978627 ACACACACCCAGAAATATAGAGG - Intergenic
977495808 4:97773980-97774002 ACACACACCCTATATTTTAGAGG - Intronic
984652541 4:182286118-182286140 AAACATGCCCTGCAGTTTAGGGG - Intronic
984790192 4:183608018-183608040 GCACACGCCCTGGAATTCAAAGG - Intergenic
990109931 5:52310149-52310171 ACACACACACAGAAATTTAGAGG - Intergenic
991726311 5:69539328-69539350 ACGCAGGCCTTACAATTTAGAGG - Intronic
991868646 5:71088546-71088568 ACGCAGGCCTTACAATTTAGAGG + Intergenic
995173019 5:109139305-109139327 ACATAGGCCCTGCCTTTTAGGGG - Intronic
1007163430 6:39811158-39811180 ACACACTCCCTTCAGTTTACAGG - Intronic
1015837710 6:137439673-137439695 ACACACACCCTGCATTTGGGAGG - Intergenic
1022654636 7:32307458-32307480 ACCCACCCCTTGCAGTTTAGTGG - Intergenic
1023517947 7:41020930-41020952 ATAGATGTCCTGCAATTTAGGGG + Intergenic
1028309949 7:89318816-89318838 ACACACGCACAGAAATATAGAGG + Intronic
1028683827 7:93569960-93569982 ACACACACACTTCAATTTTGAGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1031101091 7:117480187-117480209 ACACACGCCCTCCTCTTTCGTGG - Intronic
1032707969 7:134438511-134438533 AAGCTCGCACTGCAATTTAGTGG - Intergenic
1033224367 7:139548902-139548924 ACACAGTCCCTGCCATCTAGGGG - Intergenic
1033356780 7:140606756-140606778 ACACAGGCCTTGCTATTTGGGGG - Intronic
1036145384 8:6250297-6250319 ACACACACACTGAAATATAGAGG - Intergenic
1055119214 9:72638862-72638884 TCTCACTCCCTGCAAATTAGTGG + Intronic
1055704365 9:78981453-78981475 ACTAAAGCTCTGCAATTTAGTGG + Intergenic
1187641288 X:21292804-21292826 CCACACGCCCTGCCATCTGGGGG + Intergenic
1195234213 X:102880844-102880866 AAACACACCCTGCAAATTTGGGG - Intergenic