ID: 1133186895

View in Genome Browser
Species Human (GRCh38)
Location 16:4106394-4106416
Sequence CGGTGCTGCCGCGGAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133186895 Original CRISPR CGGTGCTGCCGCGGAACAGA AGG (reversed) Intronic
900255060 1:1693532-1693554 CGGGGCTGCCGCGGGACATCCGG + Intronic
900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG + Intergenic
903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG + Intronic
904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG + Intergenic
915457153 1:156048497-156048519 CAGTGCTGCCCGGGAACAGGTGG - Exonic
920986707 1:210897525-210897547 TGGAGCTGCTGTGGAACAGAGGG - Intronic
1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG + Intronic
1075519566 10:123135814-123135836 CGGCCCTGCCGCGGCACCGAGGG - Intergenic
1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG + Intronic
1085633948 11:78143460-78143482 AGGTGCTGCAGAGAAACAGATGG + Intergenic
1101022799 12:100571099-100571121 AGGTGCTGCAGCTGAAAAGATGG + Intergenic
1111647327 13:91047157-91047179 CGGAGCTGGCAAGGAACAGAAGG + Intergenic
1119808540 14:77498416-77498438 CCGGGCTGCCGCGGACCAGCCGG - Intronic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1129002599 15:72346807-72346829 CTTTGCTGCTGGGGAACAGAGGG - Intronic
1130620195 15:85453943-85453965 CTGTGCTGACCCAGAACAGAAGG - Intronic
1130656487 15:85795012-85795034 CAGTGCAGCCGCAGAAAAGAAGG + Exonic
1133169430 16:3972066-3972088 GGGGGCTGCCTCGCAACAGAAGG + Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133916091 16:10111390-10111412 CGGTGCCGCCACTGATCAGATGG - Intronic
1139840294 16:69873248-69873270 TGGTGCTGCCACAGAACTGAAGG - Intronic
1151437887 17:74109421-74109443 AGGTACTGCCCCGGAGCAGAGGG + Intergenic
1152867612 17:82733830-82733852 CAGGGCTGCCGCAGAACAGCAGG - Intergenic
1154295530 18:13143681-13143703 GGGTGCTGCAGCTGAAGAGATGG + Intergenic
1157166392 18:45361888-45361910 TGGTGCTCCCGGGGAAAAGATGG - Intronic
1161321379 19:3643239-3643261 CGGAGCAGCCGCGGTACAGGTGG - Exonic
1162801409 19:13112765-13112787 CGGTGTTGGCGGGGAACAGCGGG - Exonic
925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG + Intergenic
928840080 2:35595478-35595500 AGGTGCTGCAGCTGAGCAGATGG + Intergenic
932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG + Exonic
932770647 2:74499137-74499159 CGGAGCCGCCGCGGAACCTAGGG + Intronic
935794527 2:106628545-106628567 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG + Exonic
940270117 2:151881395-151881417 TGGTCCTGCCGGGGAAAAGAAGG + Intronic
943023973 2:182606950-182606972 AGGTGCTGCCGCTGAGGAGATGG + Intergenic
947156290 2:227164987-227165009 CGGGGATGCCCCGGAACAGGTGG + Intronic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
1171466057 20:25328827-25328849 AGGTGCTGCTGTGGAAGAGAAGG - Intronic
1175764524 20:61583223-61583245 CGGTTCTGCGGGGGGACAGAGGG + Intronic
1175764542 20:61583283-61583305 CGGTTCTGCGGGGGGACAGAGGG + Intronic
1176663477 21:9662188-9662210 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1181730005 22:24838298-24838320 GGGTGCTGCAGCTGAAGAGAAGG + Intronic
1182335371 22:29580449-29580471 TGGTGCTGCCACGGCACAGCAGG + Intronic
1182474343 22:30568281-30568303 CTGTGCTGCCGTGGAAAAAAGGG - Intronic
1184954565 22:47877131-47877153 CGGTGGTGGCCCGGACCAGATGG - Intergenic
952662650 3:35870264-35870286 AGGTGATGCAGCTGAACAGATGG - Intergenic
963743758 3:149105618-149105640 CAGTGCTGCAGTGGAAGAGATGG + Intergenic
971923298 4:32971747-32971769 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
978372882 4:108046842-108046864 CGGTGCAGCTGGGGAACAGCTGG - Intergenic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
993649835 5:90506626-90506648 CGATGATGCCGCAGAACAGGAGG + Exonic
994571503 5:101520594-101520616 GGGTGCTGCAGCTGAAGAGATGG - Intergenic
994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG + Intergenic
1007355043 6:41308565-41308587 CCGTGATGCCGAGGAAGAGATGG + Intergenic
1011008626 6:82677946-82677968 AGGTGCTGCAGCTGAAGAGATGG + Intergenic
1013753224 6:113431289-113431311 TGGTGCTGCCTAGGAACAGTAGG - Intergenic
1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG + Intergenic
1033262803 7:139858181-139858203 GGCTGCTGCCTTGGAACAGATGG - Intronic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1040551070 8:48437993-48438015 CGGAACTGCAGGGGAACAGAAGG - Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1056261216 9:84850754-84850776 CGTTTCTGCCTCAGAACAGAGGG - Intronic
1203662621 Un_KI270753v1:59577-59599 CGGTGCTGCAGCTGAGGAGATGG - Intergenic
1203670769 Un_KI270755v1:9252-9274 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1199248153 X:145630924-145630946 CGGTGCTGGCGCGGAACAGTGGG + Intergenic