ID: 1133187173

View in Genome Browser
Species Human (GRCh38)
Location 16:4108339-4108361
Sequence ATGAAGAAACGGTCTGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133187173_1133187175 8 Left 1133187173 16:4108339-4108361 CCTTAATCAGACCGTTTCTTCAT 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1133187175 16:4108370-4108392 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133187173 Original CRISPR ATGAAGAAACGGTCTGATTA AGG (reversed) Intronic
902222922 1:14978203-14978225 TTGAAGAAAAGCTCTGATTCAGG - Intronic
902613726 1:17612345-17612367 ATGAAGAGACAGTCAGATGAAGG - Intronic
906976677 1:50581780-50581802 ATGAAGAAAGAGTAAGATTATGG + Intronic
908112103 1:60908163-60908185 AAGAAGAAAGGGTCTCATGAAGG + Intronic
909338855 1:74509068-74509090 AAGAAGAAAGTGTCTGAATAAGG - Intronic
911342658 1:96657504-96657526 AGGAAGAAATGGTGTCATTAAGG + Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
914374363 1:147060774-147060796 ATGAAGAAAAGCTCTGATATGGG - Intergenic
916519135 1:165547537-165547559 AGGAAGAACCAGACTGATTAAGG - Intronic
919598108 1:199589798-199589820 ATGAAGAAACAGTCTAGTAAAGG - Intergenic
923744759 1:236690010-236690032 ATCAAGCCACGGACTGATTATGG - Intronic
1065601408 10:27372832-27372854 ATTTAGAAAATGTCTGATTAAGG + Intergenic
1067546972 10:47199141-47199163 ATCAAGAAACAGTCTGATTTTGG - Intergenic
1068849297 10:61718231-61718253 ATGAAGCAAAGGTCAGATTTTGG + Intronic
1070552868 10:77504543-77504565 ATAAAGAAACTGTCTGCTTGTGG - Intronic
1071005466 10:80879381-80879403 TTCAACAAACAGTCTGATTAAGG + Intergenic
1075221856 10:120592054-120592076 AGGAATAAACGTTCTCATTATGG - Intergenic
1077322444 11:1948299-1948321 AGGAAGAAAAGGTCTGAGTGAGG + Intronic
1085363302 11:75912673-75912695 ATGAACAATCTGTCTGAGTAGGG - Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1090450317 11:126800424-126800446 CTACAGAAACGGTCTCATTAGGG + Intronic
1202805462 11_KI270721v1_random:3612-3634 AGGAAGAAAAGGTCTGAGTGAGG + Intergenic
1091538996 12:1441812-1441834 ATGACGAAACCGTCTCATCACGG - Intronic
1095220110 12:39601521-39601543 ATGAAGAAGTTGTCTTATTATGG + Intronic
1098099493 12:66999067-66999089 ATGAAGAAAATGTCTGAATGTGG - Intergenic
1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG + Intergenic
1105619693 13:22054951-22054973 CTGAGGAAACGGCCTTATTAAGG - Intergenic
1112486491 13:99825074-99825096 ATGAAGTGACTGTCTGCTTATGG - Intronic
1116264250 14:42666213-42666235 ATGAATAAATGCTCTAATTAAGG - Intergenic
1120042988 14:79774565-79774587 ATTCATTAACGGTCTGATTATGG - Intronic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1121816451 14:96932639-96932661 ATGAAGACATGGTCTGAGGATGG + Intergenic
1124379737 15:29155467-29155489 ATGAAGAAACGACCTGAGTCTGG - Intronic
1124693880 15:31847335-31847357 ATGAAAAAAGGGTGTGATCATGG + Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126924312 15:53565963-53565985 GAGAAGGAACGCTCTGATTAGGG + Intronic
1127836274 15:62793621-62793643 ATGAAGAAACATTCAGAGTATGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1132010875 15:98275752-98275774 ATGAAGACACGGCCTTATGATGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1142912261 17:3104373-3104395 ATGAAGAAACGGGATGAACAGGG + Intergenic
1143444612 17:7000148-7000170 GTGAAGAAACAGTCTGGTGAGGG - Intronic
1144227267 17:13161474-13161496 ATGCAAAAACTGTCTGATTTGGG + Intergenic
1145119308 17:20242417-20242439 ATGGAGACACTGTCTGCTTATGG + Intronic
1154938649 18:21088728-21088750 ATGATGAACAGGTTTGATTAGGG + Intronic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1162613564 19:11776494-11776516 ATGACAAAAAGGTCTGTTTAGGG + Intronic
927835519 2:26395236-26395258 ATGAAGAAACTATCTGATAAAGG - Exonic
929556338 2:42927736-42927758 ACCAAGTAACGGTCTGTTTAGGG - Intergenic
929671084 2:43876799-43876821 ATGAAGAGACTGTGTGAATATGG + Intronic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
930240644 2:48932639-48932661 ATGAACAAACAGTCTAATTAAGG + Intergenic
931862994 2:66376643-66376665 ATGAACCAACTGTCTGATGATGG - Intergenic
933863956 2:86499313-86499335 ATGAATAAATGGTTTTATTAGGG + Intergenic
935432819 2:102994709-102994731 ATGAATAAACAGTCTGGTTCTGG - Intergenic
935708202 2:105874358-105874380 ATGGAGATAAGATCTGATTATGG - Intronic
939603724 2:144226426-144226448 ATGACCAAAAGGTCTGCTTAAGG + Intronic
940016485 2:149111399-149111421 ATGAAAAATCAGTCTGATTTGGG + Intronic
946511999 2:220367911-220367933 AGGATGAAAAAGTCTGATTATGG - Intergenic
947166473 2:227267454-227267476 ATGAAAAAATGGACTGAGTAGGG - Intronic
1177852024 21:26359901-26359923 ATGAAGAAAAGGTGTGGTCAAGG + Intergenic
1179087869 21:38236480-38236502 AGGAAGAAACGGCATGTTTATGG - Intronic
1179237021 21:39556601-39556623 ATGAAGCAACGGTATGGTTTAGG - Intronic
1179399511 21:41070819-41070841 AGGAAGAGACGGTATGATGAGGG + Intergenic
1182742197 22:32576096-32576118 ATGAAGCAATGGCCTGAGTATGG + Intronic
1185175894 22:49326429-49326451 ATGAATAATCGGTCCTATTAAGG + Intergenic
949192436 3:1266629-1266651 ATGAATAAAAGGGCTTATTAAGG + Intronic
950671897 3:14532285-14532307 ATGAGGGGAGGGTCTGATTAGGG + Intronic
954510787 3:51123117-51123139 ATGAAGCTACGGACTGGTTATGG - Intronic
955967319 3:64401944-64401966 ATGAAGAAATGGGCTGATAGAGG - Intronic
959317669 3:104829022-104829044 AAGAAGAAAAGCTCTGAATAAGG - Intergenic
960789586 3:121413686-121413708 TTGAAGAAACCTTGTGATTAAGG + Intronic
960915107 3:122686954-122686976 ATAATGAAAAGGTCTGATAAGGG - Intronic
961117249 3:124341083-124341105 AGGAAGAAAGGGGGTGATTAGGG + Intronic
967173967 3:186846016-186846038 ATGAGGAAACTGACAGATTAAGG - Intronic
971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG + Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
974870205 4:67633302-67633324 ATTAAGAAAAGGTCTGATCTTGG - Intronic
975176951 4:71300046-71300068 ATGAAAAATGGGTTTGATTAAGG - Intronic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG + Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984771567 4:183441131-183441153 AGGTAGTAACAGTCTGATTACGG - Intergenic
988135290 5:27162408-27162430 ATTATGCTACGGTCTGATTAAGG - Intergenic
988560355 5:32275294-32275316 ATGAAGACAGGGCCTCATTAGGG + Intronic
996447831 5:123577208-123577230 TTGGAGAAAAGGACTGATTATGG - Intronic
998019541 5:138757847-138757869 ATGAGGCAACAGTCAGATTATGG + Intronic
1002272757 5:178083554-178083576 ATGTAGAAAAGGGCTGATAAGGG + Intergenic
1005326370 6:24705041-24705063 ATGAAGAAAAGCTTTGCTTAAGG - Exonic
1005605341 6:27472168-27472190 AGGAAGGAACGGTATGCTTAGGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1024925135 7:54604598-54604620 ACGAATAAACAGGCTGATTAAGG - Intergenic
1029847867 7:103431507-103431529 ATAGAGAAAGGGTCTCATTATGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1036383830 8:8260633-8260655 AAAAAGAAACAGGCTGATTACGG + Intergenic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1037441619 8:18922180-18922202 ATGAAAAAACGGTTTGTTCAGGG + Intronic
1041554625 8:59139111-59139133 ATTAAGAAACAGTTTTATTAAGG - Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1047486818 8:125338801-125338823 ATGATGAAACTGAATGATTATGG + Intronic
1050204489 9:3182354-3182376 TTGAAGAAAAGGTCCGTTTATGG - Intergenic
1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG + Intronic
1060060727 9:120457149-120457171 ATGAAGAAATGGGCTCATAAAGG + Intronic
1185846651 X:3443601-3443623 ATGAAGCACCTATCTGATTAGGG - Intergenic
1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG + Intronic
1188274696 X:28185293-28185315 ATGAAGAAATGAACTGATGAAGG - Intergenic
1190501492 X:51083056-51083078 ATCAAGAAAATGTCTGATTTTGG + Intergenic
1196464130 X:115956286-115956308 ATGAAGAAACTGCCTAGTTAAGG + Intergenic
1198141034 X:133803607-133803629 ATGAAAAATAGGTCTGATTCAGG + Intronic
1200817873 Y:7552721-7552743 ATGAAGCACCTATCTGATTAGGG + Intergenic