ID: 1133187175

View in Genome Browser
Species Human (GRCh38)
Location 16:4108370-4108392
Sequence TTTTTTTTTTTTTTTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295059
Summary {0: 12750, 1: 14510, 2: 25740, 3: 52715, 4: 189344}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133187173_1133187175 8 Left 1133187173 16:4108339-4108361 CCTTAATCAGACCGTTTCTTCAT 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1133187175 16:4108370-4108392 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
1133187174_1133187175 -3 Left 1133187174 16:4108350-4108372 CCGTTTCTTCATTTTTTTTTTTT 0: 3
1: 108
2: 2635
3: 34778
4: 59406
Right 1133187175 16:4108370-4108392 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
1133187172_1133187175 13 Left 1133187172 16:4108334-4108356 CCTCACCTTAATCAGACCGTTTC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1133187175 16:4108370-4108392 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
1133187171_1133187175 14 Left 1133187171 16:4108333-4108355 CCCTCACCTTAATCAGACCGTTT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1133187175 16:4108370-4108392 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133187175 Original CRISPR TTTTTTTTTTTTTTTTTTTT TGG Intronic
Too many off-targets to display for this crispr